ID: 1117043858

View in Genome Browser
Species Human (GRCh38)
Location 14:51792477-51792499
Sequence GGGACTTTCTCTAGAATACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117043854_1117043858 -1 Left 1117043854 14:51792455-51792477 CCATTTTGGGCAGTTCTGTTTGG No data
Right 1117043858 14:51792477-51792499 GGGACTTTCTCTAGAATACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117043858 Original CRISPR GGGACTTTCTCTAGAATACA TGG Intergenic