ID: 1117046635

View in Genome Browser
Species Human (GRCh38)
Location 14:51819070-51819092
Sequence GACACAGATCTGCTCACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117046635_1117046636 -5 Left 1117046635 14:51819070-51819092 CCTGCAGTGAGCAGATCTGTGTC No data
Right 1117046636 14:51819088-51819110 GTGTCTACTTGTCCTTTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117046635 Original CRISPR GACACAGATCTGCTCACTGC AGG (reversed) Intergenic
No off target data available for this crispr