ID: 1117049571

View in Genome Browser
Species Human (GRCh38)
Location 14:51846828-51846850
Sequence CTCACACAAAAGTGGAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 249}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117049571_1117049576 29 Left 1117049571 14:51846828-51846850 CCTTCCCTCCACTTTTGTGTGAG 0: 1
1: 0
2: 0
3: 16
4: 249
Right 1117049576 14:51846880-51846902 CTTTTCAAACATGATTCTTTTGG 0: 1
1: 0
2: 1
3: 35
4: 474

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117049571 Original CRISPR CTCACACAAAAGTGGAGGGA AGG (reversed) Intronic
902072494 1:13752185-13752207 CTCACACAAATGTGTTAGGAAGG + Intronic
903658378 1:24962595-24962617 TCTCCACAAAAGTGGAGGGAAGG + Intronic
903692126 1:25181891-25181913 CTCTCATGCAAGTGGAGGGAAGG - Intergenic
905223536 1:36465079-36465101 CTCTCAGAAAAGTGAGGGGAAGG - Intergenic
905445757 1:38027578-38027600 CTCAGCAAAAAGTGCAGGGAAGG + Intergenic
906231205 1:44166037-44166059 CTAAAACAAATGTGGAGGTAAGG - Intergenic
907179023 1:52553428-52553450 CTCACACCCACGCGGAGGGAAGG + Intronic
907417197 1:54322771-54322793 CTGACGCATAAGTGGATGGATGG - Intronic
908882569 1:68748830-68748852 TTTACAGAAAAGTGGAGGAAAGG - Intergenic
909052547 1:70783876-70783898 CTCACACATTACTGCAGGGAGGG + Intergenic
910225939 1:84936141-84936163 TTCACAGAGAAGGGGAGGGAAGG + Intronic
910502039 1:87903415-87903437 ATTACACAATAGTGTAGGGAGGG + Intergenic
911601929 1:99856511-99856533 ATAAGACAATAGTGGAGGGAAGG + Intronic
913066898 1:115264189-115264211 CTTACACACAACTGGAGTGAAGG + Intergenic
916085778 1:161268061-161268083 ATGACACAAAAGTGGACGAAAGG + Intronic
917412577 1:174775114-174775136 TTCAAGCAAAAGTGGAGGGAAGG + Intronic
917962970 1:180159004-180159026 CCCACTCACAAGTGCAGGGAGGG - Intronic
918090505 1:181289607-181289629 CTCACATGAAAGTGGAGGAGAGG - Intergenic
918262635 1:182809595-182809617 CCCACACACAGGTGGAGAGAAGG + Intronic
918372756 1:183877657-183877679 TTCACACAAAAGAGGAATGAAGG - Intronic
918854755 1:189737287-189737309 CTAACAGAAAAGAGGAGGAATGG + Intergenic
919355586 1:196517153-196517175 CTCACAGAAAAGTGGTCAGACGG + Intronic
919363748 1:196630483-196630505 ATCCAACAAGAGTGGAGGGAGGG + Intergenic
919426976 1:197445306-197445328 CGCACACAAAAAAGGAGGCATGG - Intronic
919560248 1:199109466-199109488 CTCACACAGAATGGGAGAGAGGG - Intergenic
920196080 1:204228242-204228264 GACACACAGAAATGGAGGGAGGG + Intronic
923542984 1:234902676-234902698 CACACACAAACATGGAGGGCAGG + Intergenic
923717634 1:236438406-236438428 CTGGGACAGAAGTGGAGGGAAGG + Intronic
923727224 1:236517108-236517130 AACACACAAAAGTAGAGAGATGG - Intergenic
924876561 1:248111305-248111327 CACACAGAAAAAAGGAGGGACGG - Intergenic
1063018225 10:2099859-2099881 CTCACATAGAATTTGAGGGAGGG - Intergenic
1063906672 10:10786912-10786934 CACACACAGGAGTGCAGGGAAGG + Intergenic
1065563646 10:26987978-26988000 CATACACAAAAGTGGAGAAACGG - Intergenic
1065749145 10:28869598-28869620 CTAACACAAAGGTGGAGAGCTGG + Intronic
1067041258 10:42954396-42954418 CTCAGAGAAAAGGGGCGGGAGGG + Intergenic
1067877747 10:50020078-50020100 CACAAACACAAGTGGAGTGAGGG - Intergenic
1067877765 10:50020145-50020167 CACAAACACAAGTGGAGTGAGGG - Intergenic
1068640099 10:59394631-59394653 CTCAAGCAAAAGTTGAGGAAAGG - Intergenic
1069655945 10:70088754-70088776 CTAAAAGAAAAGTGGATGGAAGG - Intronic
1070650762 10:78234077-78234099 CTGACACAGGAGAGGAGGGAAGG - Intergenic
1073469081 10:103711693-103711715 CTCACACAGGAGCAGAGGGAAGG + Intronic
1073835661 10:107438087-107438109 AACTCACAAAAGTGGAGGGTGGG + Intergenic
1075591697 10:123696272-123696294 CTCTCACTAAAGGGAAGGGATGG - Intergenic
1075986680 10:126793562-126793584 CACACACAAAAATTGAGGAAAGG + Intergenic
1076231059 10:128820519-128820541 CTCACATAAAGGAGGAGGGTTGG + Intergenic
1076358897 10:129872976-129872998 TTCACACAAGAGTGGGGGCAAGG - Intronic
1077111412 11:863791-863813 CACCCACAAAAGAGGAGGGCAGG - Intronic
1078397130 11:10991171-10991193 CTCACACAAGTGTGGAGGCTGGG - Intergenic
1080621022 11:33986928-33986950 CTAGGACAATAGTGGAGGGAAGG - Intergenic
1080877542 11:36290292-36290314 CTTAAAAAAAAGTGGAGGGTAGG - Intergenic
1083184815 11:61011377-61011399 CTCACAGGAAAGTGGGGGAATGG - Intronic
1084665199 11:70572519-70572541 CTCAGACAGAAGGGAAGGGAAGG + Intronic
1087232277 11:95679595-95679617 CTCACACAATTGTGGAGGCTGGG - Intergenic
1087916048 11:103812069-103812091 ATCAGACTAAAGTGCAGGGAAGG + Intergenic
1088145558 11:106672169-106672191 GTCACACAGAACTGGAAGGAAGG - Intergenic
1089118285 11:116113682-116113704 CTCACACTAAGGTGGAGCCATGG - Intergenic
1090165786 11:124545464-124545486 CTCAAAGAAAAGTGGGTGGAAGG - Intergenic
1090201658 11:124861961-124861983 CTCACACACCAGTGGGGGGTGGG + Intergenic
1091220758 11:133928673-133928695 CTCAAACAGGAGTGTAGGGAGGG + Intronic
1092917524 12:13202154-13202176 CCCAAACAAGAGTGGAAGGATGG - Intronic
1093032237 12:14298765-14298787 CTCAGACAAAGGTGGAAAGACGG + Intergenic
1093210134 12:16298070-16298092 ATGACACAAAAGTGGAGGCAAGG - Intergenic
1093911013 12:24747591-24747613 CTCACAAGAGAGTGGAGGGCAGG + Intergenic
1094543183 12:31379465-31379487 CTCACACAATTGTGGAGGCCTGG - Intergenic
1095266909 12:40171361-40171383 CTCACAAAAAAGTTGTGGGGAGG - Intergenic
1096343419 12:50823350-50823372 CTCTCTCAAAAGTGGGAGGAGGG - Intergenic
1098104237 12:67052752-67052774 CTCTCTCAAAAATGAAGGGAGGG + Intergenic
1099528773 12:83748629-83748651 ATCTCACAAATTTGGAGGGAGGG - Intergenic
1100627227 12:96347555-96347577 CTCACAGAAAGGGGAAGGGAAGG + Intronic
1100816795 12:98394706-98394728 CACAAACAAAAATGGAGGGAAGG + Intergenic
1104501738 12:129292930-129292952 CTCAAACTAAAAGGGAGGGAGGG + Intronic
1105500319 13:20966104-20966126 CTCACTGAAAGGTGGAGAGAAGG + Intergenic
1105761663 13:23521006-23521028 CTCACACAAATGAAGTGGGAAGG - Intergenic
1106267766 13:28125330-28125352 CTCACTTAAAAGTGGAGGCTAGG + Intergenic
1109932726 13:69236094-69236116 CTCAGACAAAATTGAAGGGCTGG - Intergenic
1110902207 13:80837409-80837431 CTCAAAAAAAAGTGGGGGGGTGG - Intergenic
1111607684 13:90562008-90562030 CTCACAAAAAAGTGGATAAATGG + Intergenic
1111898164 13:94167625-94167647 GACAAACAAATGTGGAGGGAAGG + Intronic
1111934094 13:94541846-94541868 ACCACACAAACGTGGAGGGAAGG + Intergenic
1112123643 13:96440626-96440648 ATCACATAAAAGTGAAGAGAAGG + Intronic
1112191466 13:97182137-97182159 CTGCCACAAAAGTGGAAGGAAGG + Intergenic
1112876172 13:104042026-104042048 CTCACTCAAAAATGTATGGATGG + Intergenic
1113002361 13:105656572-105656594 CTGACACAAAACTGAAGGCATGG - Intergenic
1114254250 14:20988380-20988402 CTCGCACAAAAAATGAGGGATGG + Intergenic
1117049571 14:51846828-51846850 CTCACACAAAAGTGGAGGGAAGG - Intronic
1117835982 14:59806614-59806636 CTTACCCAAAGGTGGAGGGTGGG - Intronic
1117983383 14:61363784-61363806 ACCAGACAGAAGTGGAGGGATGG + Intronic
1120495413 14:85228486-85228508 CTCACAAAAATGGGGAGTGAGGG - Intergenic
1122200340 14:100118763-100118785 AACACACAAGAGGGGAGGGAAGG - Intronic
1122790528 14:104182425-104182447 CTCAGACTAATGTGGAGGGCAGG + Intergenic
1122924080 14:104891834-104891856 GTCACCCAGAGGTGGAGGGAGGG + Intronic
1123948559 15:25250620-25250642 CTCACATATCAGTGCAGGGAGGG - Intergenic
1124164302 15:27310125-27310147 CACACAGAAAAGTAGAAGGATGG + Intronic
1125772503 15:42179260-42179282 CTCTTAGAAAAGTGGCGGGAGGG + Intronic
1127039803 15:54962148-54962170 CTCACACTAAAGTTCAGTGAGGG + Intergenic
1127708167 15:61567729-61567751 CTCACTCAATATTGCAGGGAGGG + Intergenic
1130357130 15:83143868-83143890 CTACCACACAACTGGAGGGAGGG - Intronic
1133864798 16:9632664-9632686 CTCACCCAAAACTGGAGGCAGGG - Intergenic
1133923842 16:10179042-10179064 ATTACACAGAAGTGGAGGGAAGG - Intronic
1135085713 16:19473042-19473064 CTCACACAAAAGTGCAGCACAGG + Intronic
1135837435 16:25839405-25839427 CTAAAACAAAAATGGAGGAAGGG - Intronic
1135933373 16:26758417-26758439 CTCACATAAAAAAGGAGGAAAGG - Intergenic
1139118783 16:63989400-63989422 CTGATACAAAAGTCAAGGGAGGG - Intergenic
1140225287 16:73071788-73071810 CTCACAGAAAGGTGGAGATAGGG + Intergenic
1141635885 16:85313550-85313572 CTCACAGCAAAGGGCAGGGAGGG - Intergenic
1142260668 16:89041169-89041191 CTCAAACAGGAGGGGAGGGAAGG - Intergenic
1145941802 17:28746687-28746709 CCCACAGAAAAGGGGAGGAAAGG - Intronic
1148864303 17:50620583-50620605 CTCTCACCTAGGTGGAGGGAGGG - Intronic
1149198438 17:54152514-54152536 CTCCCAGAAAAGTGGAAGAAGGG + Intergenic
1151502420 17:74499636-74499658 CTCCAAAAAAAGTGGGGGGAGGG + Intergenic
1152015525 17:77748036-77748058 TACACAGAAAGGTGGAGGGAAGG - Intergenic
1152032017 17:77848740-77848762 CTCCCACAATGGTGGAGGGAGGG - Intergenic
1152465966 17:80466358-80466380 CTCTCAGACAAGTGCAGGGAAGG + Intergenic
1153662298 18:7335903-7335925 TACACACAAAAGTGGAGTCATGG + Intergenic
1156008018 18:32466649-32466671 CTCACTCAAAACTGGATGGGTGG - Intronic
1156731319 18:40196756-40196778 CTCACTCATTATTGGAGGGAGGG + Intergenic
1157689832 18:49672437-49672459 CTCACACAAATGAGGAGGTTTGG + Intergenic
1158870495 18:61682760-61682782 AGCAAACAAAAGTGGAGGGCAGG - Intergenic
1159012866 18:63074803-63074825 CCCATAGGAAAGTGGAGGGAAGG - Intergenic
1161621706 19:5301187-5301209 CTCAGCCAAAAGTGGAGGACGGG + Intronic
1163193335 19:15696256-15696278 CACACACAAAAGTAGAGGATGGG - Intronic
1163451943 19:17383511-17383533 CAGACATAAAAGTGGAGGGTTGG - Intergenic
1164552385 19:29222345-29222367 TTCACACAAAAGTGCTGAGAAGG - Intergenic
1165768158 19:38363531-38363553 CTAGGACAATAGTGGAGGGAAGG + Intronic
928638488 2:33272905-33272927 CATACACTACAGTGGAGGGAGGG - Intronic
931233939 2:60397845-60397867 CTAAAACAAGAGTGTAGGGAAGG - Intergenic
931480115 2:62631134-62631156 ATAAGACAATAGTGGAGGGAAGG - Intergenic
933160986 2:79025066-79025088 CTCACACAAAGGTAGCTGGAAGG + Intergenic
940972224 2:159906415-159906437 CTCTGACAAATGTTGAGGGAAGG + Intergenic
941827580 2:169917098-169917120 CTGACACAAATGTTGGGGGAGGG - Intronic
943035086 2:182734142-182734164 ATCATAAAAAAGTAGAGGGAAGG - Intronic
943100475 2:183479927-183479949 CTAGGACAATAGTGGAGGGAAGG - Intergenic
943902773 2:193462604-193462626 CTGAGACAAAAGTGTAGGCAGGG - Intergenic
946184615 2:217973051-217973073 CTAACATAAAAGTGGAAGGCAGG + Intronic
948891024 2:240907165-240907187 CTCCCACAAATGTGCAGCGATGG - Intergenic
1168977273 20:1976563-1976585 CTCACAAAATAGTGGTGAGAGGG + Intergenic
1169733850 20:8815395-8815417 CTCACACAAAAGTGCGTTGATGG + Intronic
1170379715 20:15743681-15743703 CTCAAACACAAGTGCAGCGAGGG - Intronic
1170509640 20:17063558-17063580 CTCACCCAACAGAGGATGGAAGG - Intergenic
1172865911 20:38097134-38097156 CTCACACAATTGTGGAGGTTTGG + Intronic
1173413674 20:42837488-42837510 CTGCCATCAAAGTGGAGGGAAGG + Intronic
1174185694 20:48704420-48704442 CTCACCCACAAGGGGAGAGAAGG - Intronic
1174433815 20:50490952-50490974 CACACACATATGGGGAGGGAAGG + Intergenic
1175562895 20:59946885-59946907 CTCACAAAAAAGGGCAGGCAAGG - Exonic
1177427866 21:20948593-20948615 ATGACAAAAAAATGGAGGGATGG - Intergenic
1179060350 21:37973732-37973754 AGCACAAAAAAGTGGAGGAAAGG - Intronic
1179060487 21:37974669-37974691 GGCACAAAAAAGTGGAGGAAAGG - Intronic
1180645744 22:17337438-17337460 CAGACACAAGGGTGGAGGGATGG - Intergenic
1180710677 22:17837355-17837377 GTCACAGAAAAGTGGATGGCAGG - Intronic
1183600883 22:38840134-38840156 CTCCTACAAAAGGGAAGGGAAGG - Intronic
949353375 3:3149882-3149904 ATCATACAAATGTGGAAGGAAGG + Intronic
949514828 3:4797534-4797556 CTAAAACAAAGGTGGAGGGGCGG - Intronic
950268354 3:11592503-11592525 CACACACAAAGGAGGATGGAGGG - Intronic
951072231 3:18344136-18344158 CACACACAAAAGTAGAGACAAGG - Intronic
953541611 3:43824015-43824037 CTCCCAGAAAAGTGGAGCGGAGG - Intergenic
954902117 3:54028863-54028885 CTCAAATCAAAGTAGAGGGATGG - Intergenic
956241432 3:67135006-67135028 CTCACTTAACAGTGGAAGGATGG - Intergenic
956472233 3:69579403-69579425 CACACACAAAACTGGAAGGAGGG - Intergenic
956789266 3:72668275-72668297 CTGGCAGGAAAGTGGAGGGAGGG + Intergenic
956816330 3:72911603-72911625 CTCACACACAAGTGTTGGCAAGG - Intronic
963246746 3:143071078-143071100 CTCAGGCAAAACTGCAGGGAAGG - Intergenic
963247632 3:143077204-143077226 CTCCCACACACCTGGAGGGAGGG - Intergenic
963607577 3:147424204-147424226 CCCATATAAGAGTGGAGGGAAGG + Intronic
963868727 3:150390520-150390542 GACTCACAAAAGTGGAGGGAGGG - Intergenic
967913602 3:194561884-194561906 CTCACTTAAAATTGGAGGGGAGG + Intergenic
967913612 3:194561957-194561979 CTCACATAAAATTGGAGGGGAGG + Intergenic
968192385 3:196678461-196678483 CACACTCCAAAGTTGAGGGAGGG - Intronic
968274662 3:197430963-197430985 CACACACAAAGATGGAAGGAGGG - Intergenic
970384732 4:15544584-15544606 CTCACCCATCAGTGGAGGCATGG - Intronic
971120230 4:23696288-23696310 CTCCAAAAAAAGTGGAGGGTGGG - Intergenic
971672803 4:29585436-29585458 GACACACACAAGTGGATGGAAGG - Intergenic
973608298 4:52609453-52609475 CTCAGACAAAAGATAAGGGAAGG - Intronic
975633620 4:76424222-76424244 ATCGGACAATAGTGGAGGGAAGG - Intergenic
976210567 4:82664426-82664448 GTCACACAAAAGTGCAAGGGGGG + Intronic
976657509 4:87504671-87504693 CTTACACAAAGGTGTAAGGAAGG + Intronic
977207222 4:94177037-94177059 CTCAAGGAAAAGTGGAGGTAGGG + Intergenic
977527976 4:98167156-98167178 CTCAAACAAATCTAGAGGGAGGG - Intergenic
977888555 4:102280032-102280054 CTCTAACAAAATTGGAGGGAAGG + Intronic
978638582 4:110841636-110841658 CACACACAAGAGTGGCAGGAAGG - Intergenic
982269068 4:153568283-153568305 CTGAAACAAAAGTGAGGGGAGGG - Intronic
983491666 4:168397223-168397245 CTAAGACAAATGTTGAGGGAAGG + Intronic
986770185 5:10965954-10965976 CTCAAAAAAAAATGGGGGGAAGG - Intergenic
991418959 5:66421308-66421330 CTGACACAAGATTGGAGGGTAGG - Intergenic
992917688 5:81475817-81475839 CACACACACAAATGGAAGGAGGG - Intronic
993034083 5:82737720-82737742 CACACAGAAAGGTGGAGGAAAGG + Intergenic
993155082 5:84212286-84212308 CACAGATAAAAGTGGAGAGAAGG + Intronic
994138153 5:96311770-96311792 CTTAGATGAAAGTGGAGGGATGG - Intergenic
994373734 5:98995032-98995054 CTCACATAATTGTGGAGGGTGGG - Intergenic
994926829 5:106126774-106126796 CCCCCACAAAAAAGGAGGGATGG - Intergenic
995778763 5:115753976-115753998 CACAGACTAGAGTGGAGGGATGG - Intergenic
996721795 5:126637848-126637870 CACACACAAAAAAGGAAGGAAGG + Intergenic
997327063 5:133030400-133030422 CTCAAACAAAACTGGCTGGAAGG - Intergenic
997701811 5:135907374-135907396 CTCACACTTAAGTGGAAGGGAGG + Intergenic
998420216 5:141978445-141978467 CTCAGAAAAAAGTGCAGAGAAGG + Exonic
1000399048 5:160806049-160806071 AGAACACAAAAGTGGAGGAAGGG - Intronic
1001123284 5:168997329-168997351 CTCCCTCTAAAGTGGGGGGATGG - Intronic
1002605886 5:180382474-180382496 CTCACTGAGAAGTGGAGGGTAGG + Intergenic
1002939946 6:1707377-1707399 CTCACAGAAGAGGGGAGGAAAGG + Intronic
1003894445 6:10593842-10593864 CTCAAACAAAGGAGGATGGAAGG - Intronic
1004219345 6:13732217-13732239 TGCACATAAAACTGGAGGGATGG + Intergenic
1004411614 6:15386290-15386312 CCCACACAGAAGTAGAGAGAGGG - Intronic
1006373206 6:33657900-33657922 CACACACAGAAGTGAAGGGTGGG - Intronic
1006821913 6:36903211-36903233 CACACACAAAATTGGAGGCAGGG - Intronic
1007347180 6:41240367-41240389 CTCAAAAAAAAGGGGTGGGAAGG - Intergenic
1007375036 6:41450829-41450851 CTCACACAAAATGGTAGGCAAGG + Intergenic
1007651614 6:43425917-43425939 ATAAGACAATAGTGGAGGGAAGG - Intergenic
1007966130 6:46005229-46005251 ATAACACAAAAGGGGAAGGAGGG - Intronic
1008264143 6:49402970-49402992 TTCACACAAAAGAAGAGGCAGGG + Intergenic
1010624199 6:78116207-78116229 CTCACACATAAGTGGAAGCAAGG - Intergenic
1011389901 6:86840142-86840164 CTCTTACAAAAATGGAGGTAAGG + Intergenic
1012346414 6:98193040-98193062 ATAACAAAAAGGTGGAGGGATGG - Intergenic
1012875540 6:104721341-104721363 CTCAAACAAAAGGGGAGGAGAGG + Intergenic
1013334690 6:109143931-109143953 CTCACTATAAAGTGGAGGTAAGG - Intronic
1017274549 6:152550898-152550920 ATCACACAGAAGTGCAGGGATGG + Intronic
1018815887 6:167330658-167330680 AACACACCAAAGTGCAGGGAGGG - Intronic
1021434939 7:20603415-20603437 TACAGACAAAAGAGGAGGGAGGG - Intergenic
1021992073 7:26148986-26149008 ATAAGACAATAGTGGAGGGAAGG - Intergenic
1023044336 7:36197821-36197843 ATAAGACAATAGTGGAGGGAAGG - Intronic
1023733493 7:43214855-43214877 CACACAGAAGACTGGAGGGAGGG - Intronic
1024858763 7:53813269-53813291 CTCACAAAAAGATGGAGGAATGG - Intergenic
1026347166 7:69483924-69483946 CTCAAAAAAAAGGGGGGGGAGGG + Intergenic
1028595556 7:92544476-92544498 ATCGGACAATAGTGGAGGGAAGG + Intergenic
1028996451 7:97105410-97105432 CTCAAAAAAAAGAGGAGGCAGGG + Intergenic
1031469708 7:122154458-122154480 CTCATACACAAGCGGAGGGTTGG + Intergenic
1033017675 7:137688490-137688512 GTCACACAAAAGGGCAGAGAAGG + Intronic
1033086675 7:138348829-138348851 TGCACACAAAAGTGAAGGCAGGG - Intergenic
1033323153 7:140358268-140358290 CTCTCAAAAAAGGGCAGGGAAGG + Intronic
1035630631 8:1104331-1104353 ATCACCAAATAGTGGAGGGAGGG + Intergenic
1037390658 8:18387902-18387924 CTCAGACCTAAGTGGAGGGGAGG - Intergenic
1037765775 8:21771365-21771387 CCCACATAGAAGGGGAGGGAAGG + Intronic
1039084573 8:33767150-33767172 TCCAAAAAAAAGTGGAGGGAGGG - Intergenic
1040041185 8:42918494-42918516 ATAGGACAAAAGTGGAGGGAAGG + Intronic
1040420584 8:47236523-47236545 TTCACAGAAAAGTTGAGTGAAGG - Intergenic
1041083013 8:54231293-54231315 CTCAGGGAAAAGTTGAGGGAGGG - Intergenic
1041626489 8:60034713-60034735 CTGAAACACAAGTGGAGGGCTGG - Intergenic
1041708774 8:60874456-60874478 CTCACACAACACTAGAAGGAAGG - Intergenic
1042183969 8:66118856-66118878 CTCACTAAAAAAGGGAGGGATGG + Intergenic
1042193962 8:66216020-66216042 CTGGTACAAAAGTGGAAGGAAGG - Intergenic
1042767157 8:72335213-72335235 ATAACACAAAAAGGGAGGGAAGG - Intergenic
1043261970 8:78212244-78212266 CTGGCAGAGAAGTGGAGGGATGG + Intergenic
1044103903 8:88177380-88177402 CTGCCCCAAAAGTGGAGAGAGGG + Intronic
1044371006 8:91410711-91410733 CTGACGCAAAACTGGAGGGAGGG + Intergenic
1044391198 8:91653810-91653832 CTCACACAAAATAGGCAGGAGGG + Intergenic
1050527072 9:6555333-6555355 CTAACACCCAAGTGGTGGGAAGG - Intronic
1050930354 9:11314895-11314917 CTCACAAAATAGAGGAGGAAGGG - Intergenic
1052765994 9:32641471-32641493 CTCAAAGAAAAGGGAAGGGAAGG + Intergenic
1053554522 9:39121801-39121823 CTAAGACATAAGGGGAGGGAAGG + Intronic
1055398793 9:75901036-75901058 CTCAGACTAAAGAGGAAGGAAGG + Intronic
1055576107 9:77661549-77661571 CTATCACAAAAGGGGAGGCATGG + Intergenic
1057389963 9:94634652-94634674 CTCTCCCAAGAGTGGATGGAGGG + Intronic
1058357384 9:104098931-104098953 CTCACACAAATGAGGAGTAAAGG + Intronic
1058601227 9:106672689-106672711 ATCACACAAAATGGGAGGGCTGG + Intergenic
1058745170 9:107983307-107983329 CTCATACAGAATAGGAGGGAAGG + Intergenic
1058959020 9:109975373-109975395 AGAACACAAAAGTGGAGGAAGGG - Intronic
1060210326 9:121706440-121706462 CTCAGAGAGAAGTGGAGGGGAGG - Intronic
1187789383 X:22932723-22932745 CTCACAGAAAAGTGAGGGAAAGG - Intergenic
1187836875 X:23440122-23440144 CCCAAACAAAAGCTGAGGGATGG + Intergenic
1187977570 X:24718710-24718732 TGCACACACACGTGGAGGGATGG + Intronic
1188944610 X:36283682-36283704 CTCACACAACTGTGGAGGCTTGG - Intronic
1190518805 X:51254965-51254987 CCCACAAGAAAGTAGAGGGATGG - Intergenic
1195386799 X:104321229-104321251 CCCACACACAAGGGGAGAGAAGG - Intergenic
1195633495 X:107086489-107086511 CTCAATCAAAAGTGTTGGGAAGG - Intronic
1195818520 X:108916147-108916169 CTCACTCAAAAGTGGAAGCTAGG + Intergenic
1197799688 X:130336439-130336461 TATACACAAAAGTGGAAGGAAGG - Intergenic
1198479068 X:137023848-137023870 CTCAAGCAAAAGAGAAGGGATGG + Intergenic
1201954566 Y:19608605-19608627 CTCAGATAAAAAGGGAGGGAAGG - Intergenic