ID: 1117051535

View in Genome Browser
Species Human (GRCh38)
Location 14:51865256-51865278
Sequence GTGCCTGTCTTTACTAGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 75}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117051535 Original CRISPR GTGCCTGTCTTTACTAGATC TGG Intronic
900252044 1:1675990-1676012 GTCCCTCTCGTTACTAGAGCGGG - Intronic
900262455 1:1738848-1738870 GTCCCTCTCGTTACTAGAGCGGG - Intronic
901095616 1:6676837-6676859 GTGCCTGTCTCTTCCAGTTCTGG - Intronic
902161464 1:14533954-14533976 GTGCCTATCTTTATTAGCTGGGG - Intergenic
903009030 1:20317520-20317542 GTGCCTGTCTTTGCTGGAAAAGG - Exonic
903605611 1:24573071-24573093 GGGCCTGGCTTTCCTAGACCTGG - Intronic
906521990 1:46472798-46472820 TTGCCTGTCCTTTCCAGATCTGG + Intergenic
906602301 1:47140835-47140857 GTGCCTGTCCTTATTGGATATGG + Exonic
913130620 1:115835223-115835245 GTGCCTGTCTTTCCCAGTTTAGG - Intergenic
919483541 1:198118948-198118970 GTTCCTGTATTTATTACATCAGG + Intergenic
922550161 1:226488858-226488880 GTTCCTGTCCTTCCTAGAACAGG + Intergenic
922924867 1:229340400-229340422 GTGCCTGTATTTACCAGCTCAGG - Intronic
1068288764 10:54973947-54973969 GTGCCTTTATTTACTAAATCAGG + Intronic
1069435571 10:68379587-68379609 GTGCGTGTTTTTAATAGATAGGG + Intronic
1074664468 10:115704031-115704053 CTGACTGTCTTTAATAAATCTGG - Intronic
1078287381 11:9970822-9970844 TTCCCTGTCTTTGCTAGATATGG - Intronic
1078547305 11:12255742-12255764 GTGCATGTCCTTACCAGGTCTGG - Exonic
1083327413 11:61879817-61879839 GTGCCTGGCTAAACCAGATCTGG + Intronic
1084775532 11:71372279-71372301 GTGCCTGTCTTTACTGCTTCTGG - Intergenic
1085159833 11:74329900-74329922 TTGCCTGCCTTTCCCAGATCAGG - Intergenic
1098154859 12:67587301-67587323 GTGCATGTCTTTTGCAGATCAGG - Intergenic
1098299800 12:69042873-69042895 GTGCTTGTCATTACTAATTCTGG - Intergenic
1099719573 12:86342943-86342965 ATGACTGTCTTTACTAGATAGGG + Intronic
1100442350 12:94628450-94628472 GTGCCTGTCATTGGTAGCTCTGG - Intronic
1102196701 12:111030674-111030696 GTGCCTGTGCTTATTAGATGTGG - Intergenic
1117051535 14:51865256-51865278 GTGCCTGTCTTTACTAGATCTGG + Intronic
1125577623 15:40766226-40766248 GTGCCTGTCTGTCCTTGATGGGG - Exonic
1133824527 16:9266021-9266043 ATTCATGTCTTTACTAGTTCTGG + Intergenic
1140720319 16:77765628-77765650 GTGTCTTTATTTACTAAATCTGG - Intergenic
1145801626 17:27689882-27689904 GTGTCTGTCTTTATTTGATATGG + Intergenic
1146069136 17:29663257-29663279 TTGCCTCTCTTTACTCAATCTGG + Intronic
1150337543 17:64341672-64341694 GTGTCCTTCTTTCCTAGATCTGG + Exonic
1150858509 17:68776579-68776601 GTGCCTCTCTTAACAAGAGCAGG - Intergenic
1151262859 17:72930341-72930363 GAGCCTGTCTTTGCTAGTTATGG - Intronic
1152204306 17:78966318-78966340 GTGCCTCTGTTCACCAGATCTGG - Intergenic
1162228425 19:9244095-9244117 CTGTCTGTCTTTATTTGATCAGG + Intergenic
925584766 2:5453565-5453587 GTTCCTGCCTTTCCTAGACCTGG + Intergenic
928438362 2:31270864-31270886 CTGCCTGTCTTCCTTAGATCAGG - Intergenic
928458236 2:31444373-31444395 TTGCCTGTCTTTAGGATATCAGG - Intergenic
930899022 2:56481182-56481204 GTGACTGTCTTTGTTAGCTCTGG + Intergenic
932506391 2:72236141-72236163 GTTCCTCTCCTTACTAGAGCAGG + Intronic
937331765 2:121035001-121035023 GTGTCTTTATTTACTAAATCTGG - Intergenic
942472968 2:176281697-176281719 CTGCCTGTTTTTCTTAGATCTGG + Intronic
947530383 2:230905291-230905313 GTGCCAGAGTTGACTAGATCTGG - Intergenic
1169429251 20:5521914-5521936 TTCCCTGTCTCTGCTAGATCTGG + Intergenic
1173661238 20:44735369-44735391 ATGCCTGTCTTTATTAGCTAGGG + Intergenic
1176065003 20:63189989-63190011 GTGTCTGTCTTCACTAGCTGGGG - Intergenic
950354902 3:12399006-12399028 GTGCCTCTCTGTACTGGCTCTGG - Intronic
955390417 3:58518533-58518555 GTGCTTGTCTTGACGAGATGCGG - Intronic
959477281 3:106826374-106826396 GTGCCTGTCTTGAAAAGCTCTGG - Intergenic
960682977 3:120268067-120268089 GAGACTGTCTATAATAGATCTGG + Intronic
968273626 3:197423590-197423612 CTGCCTCTCTTTCCTAGTTCTGG - Intergenic
972319970 4:37964547-37964569 GTGCCTGCCTTCCCGAGATCCGG + Intronic
975481578 4:74886442-74886464 CTGTCTGTCTTTACCAGATGAGG - Intergenic
975893002 4:79051353-79051375 GTGTCACTCTTTACTAGAGCTGG + Intergenic
976944973 4:90753835-90753857 TTGCAAGTCTTTTCTAGATCTGG + Intronic
977607521 4:98996804-98996826 GTGCCTCTCTTCACTAAACCTGG - Intronic
978889122 4:113801264-113801286 TTGCATGTCTTTCCTAGAACAGG - Intergenic
980547846 4:134292749-134292771 GTGCCTGGGTGTACTAGATTAGG - Intergenic
985319967 4:188699893-188699915 CTGCCAATCTTTTCTAGATCTGG + Intergenic
985577495 5:680290-680312 GTGTCTGTCTTCAGTAGATCCGG - Intronic
985592426 5:772386-772408 GTGTCTGTCTTCAGTAGATCCGG - Intergenic
987808239 5:22798527-22798549 GTGACTGTGTTTAATATATCTGG - Intronic
994633827 5:102319998-102320020 TTGATGGTCTTTACTAGATCTGG + Intergenic
996820360 5:127619778-127619800 GAGCCAGTCCTTCCTAGATCAGG + Intergenic
997704653 5:135936759-135936781 GTAACTTCCTTTACTAGATCGGG + Intronic
1000960643 5:167596977-167596999 GAGCCTGGCTTTTCTAAATCCGG + Intronic
1002601616 5:180356980-180357002 GTGCCTGGCATTTCTACATCTGG - Intergenic
1009937754 6:70253614-70253636 GGGCATGACTTTACTATATCTGG + Intronic
1013967095 6:115967914-115967936 GTGCCTGACTTCCCAAGATCTGG - Intronic
1016079119 6:139834196-139834218 TTGCCTGCATGTACTAGATCAGG - Intergenic
1016083342 6:139882050-139882072 GTGCCTATGTTGACCAGATCAGG - Intergenic
1023365080 7:39456053-39456075 GGCCCTGTCTTTAATATATCAGG + Intronic
1024802291 7:53094293-53094315 CTGCCTCTGTTTACTATATCTGG - Intergenic
1030924378 7:115433367-115433389 GTTTCTGTCTTTCCTGGATCTGG + Intergenic
1033410305 7:141111422-141111444 GTGCCTGTATTTGCTGGCTCAGG - Intronic
1041352613 8:56963800-56963822 TGTCCTGTCTTTTCTAGATCTGG + Exonic
1045156799 8:99485032-99485054 GTTCCTGACTTTACAAGAGCTGG - Intronic
1047337847 8:123953501-123953523 GTGCCTGTCTCTACAAGGTGGGG + Intronic
1051459991 9:17301197-17301219 GTGTATGTCTTTACTAAATTGGG + Intronic
1055033206 9:71791402-71791424 CTGCCTGTCATTACCAGCTCCGG - Intronic
1191125144 X:56946565-56946587 TTGCCTGTCTTTATTTGATATGG - Intergenic
1194585523 X:95729006-95729028 GTGCCTGTTTTCACTTGATCAGG + Intergenic