ID: 1117053021

View in Genome Browser
Species Human (GRCh38)
Location 14:51881139-51881161
Sequence CTGCTGAAAAAGATTCAGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117053021_1117053022 -10 Left 1117053021 14:51881139-51881161 CCTCGCTGAATCTTTTTCAGCAG 0: 1
1: 0
2: 0
3: 8
4: 116
Right 1117053022 14:51881152-51881174 TTTTCAGCAGTCAGCCTGCATGG 0: 1
1: 0
2: 0
3: 14
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117053021 Original CRISPR CTGCTGAAAAAGATTCAGCG AGG (reversed) Intronic
900597022 1:3484794-3484816 CTGATGATAAGGATTCAGCAAGG - Intergenic
901022865 1:6263868-6263890 CTGCTGGGAAAGACTCAGCGAGG - Intergenic
908679830 1:66648285-66648307 CTTCTGAAGAAGATTCTGCATGG + Intronic
915357333 1:155263180-155263202 CTGCTATAAAAGATGCAGGGGGG + Exonic
917467706 1:175297097-175297119 CTGCTGGAGAAAATTCAGCCAGG + Intergenic
918123005 1:181556456-181556478 CTGCTGAAAGGGACTCAGAGAGG + Intronic
921454698 1:215355780-215355802 CTTCGGAAAAACATTCAGCAAGG + Intergenic
1064195952 10:13244271-13244293 GTCCTGAAAAAGAATCACCGAGG + Intergenic
1069014670 10:63415798-63415820 CTGCAGAAAAAGATACAGTCTGG + Intronic
1071574113 10:86713543-86713565 CTGCTAAAAAAGATTAAGATTGG - Intronic
1077772450 11:5234690-5234712 CTGCTGAAAGAGATGCGGTGGGG - Intronic
1081807972 11:45900415-45900437 CTGCGGAAAGAGGTTGAGCGTGG - Exonic
1083833123 11:65246111-65246133 CTGCTAAAAAAAATTTAGCTGGG + Intergenic
1084874920 11:72124141-72124163 CTCCTGCAAGAGATTGAGCGTGG - Intronic
1087346837 11:96982226-96982248 CTGTTGAAAAGGATTCATAGGGG + Intergenic
1091133065 11:133162803-133162825 CTGGTGAAATAGATTCATCTGGG - Intronic
1094263620 12:28528668-28528690 CTGCTCAAAAACCTTCAGTGGGG - Intronic
1094464390 12:30736524-30736546 CTCATGAAAAAGATTCACTGTGG + Intronic
1095265878 12:40156922-40156944 TTACTGAAAAAGATTCAACTGGG - Intergenic
1098703634 12:73660089-73660111 CTGCTGAAACACAGTCAGCTTGG - Intergenic
1100453738 12:94732046-94732068 CTGCTGCAAAGGCTTCAGTGTGG - Intergenic
1100818632 12:98409982-98410004 CTGCTAAGGAAGATTCAGCCAGG + Intergenic
1101269796 12:103131654-103131676 CTGAGGAAAAATATTCAGAGGGG - Intergenic
1103476664 12:121223735-121223757 CTGACCAAAAAGATCCAGCGTGG + Intronic
1106001117 13:25724291-25724313 CTCCAGAGAAAGATTCAGCCTGG + Intronic
1107736693 13:43406344-43406366 CTTCTGAAAAAGAAACAGCAAGG + Intronic
1110091237 13:71450595-71450617 ATGCTAAAAATGATTCAGCTTGG + Intronic
1111264583 13:85791953-85791975 CTACTAAAAAATATTCAGCATGG - Intergenic
1112143746 13:96674641-96674663 CTGCTGAGAATGAATCAGTGAGG - Intronic
1113416419 13:110131866-110131888 TTGCTGAATAAGACTCAGTGTGG - Intergenic
1113979820 13:114265127-114265149 CTGCCATAAAAGATTCAGCATGG - Intronic
1117053021 14:51881139-51881161 CTGCTGAAAAAGATTCAGCGAGG - Intronic
1120226598 14:81797466-81797488 CTGCTGATACAGATTCATTGAGG + Intergenic
1121494305 14:94381316-94381338 CTGCCGAAAAAGATTGTGTGGGG + Intronic
1126491836 15:49245704-49245726 CTGCACAAAATTATTCAGCGAGG + Intronic
1129742134 15:77994416-77994438 CTGCGGACATGGATTCAGCGAGG - Intronic
1131663788 15:94547487-94547509 CTGCTGAAGAAGCTTTAGCAGGG + Intergenic
1135667543 16:24348634-24348656 CAGCTCAAAAAGATTCAGTGTGG + Intronic
1139333316 16:66211164-66211186 TTGCTGAAACTGATTCAGCAGGG - Intergenic
1141079874 16:81040736-81040758 CTGCTGAAAACGTTTGAGGGAGG + Intronic
1148180592 17:45602062-45602084 CTGCGGAAAGAGGTTGAGCGTGG + Intergenic
1148268310 17:46243853-46243875 CTGCGGAAAGAGGTTGAGCGTGG - Intergenic
1149425382 17:56549842-56549864 CTTCTAAAAAAGTTTCAGCTAGG - Intergenic
1152994984 18:398189-398211 CTGCTGAATAAGAAGCAGTGTGG - Intronic
1154224599 18:12491603-12491625 CTGGTGACAAAGCTTCAGAGTGG - Intronic
1155304393 18:24464903-24464925 CTACTGAAAAAAATGCAGAGAGG + Intronic
1159297317 18:66510975-66510997 CTCATGAAAAAGAAGCAGCGTGG + Intronic
1159426713 18:68298402-68298424 CTGCTGAAAAGAACCCAGCGTGG - Intergenic
1160494819 18:79366859-79366881 CTGCTGAACAAGAATCAGTGAGG + Intronic
1164499528 19:28804627-28804649 CTGCTGAAAAATAATCAGATTGG - Intergenic
1164499538 19:28805663-28805685 CTGCTGAAAAATTATCAGAGTGG - Intergenic
1165683852 19:37800820-37800842 CTGCTGAAACAGATTGCACGAGG - Intronic
1166950994 19:46428012-46428034 CTGCAGAAAGAGGTTCAGCTTGG + Intergenic
928134152 2:28675546-28675568 CTGCTTAAAATGATTCATCCTGG - Intergenic
928153052 2:28849631-28849653 CTGGTTAAAAAGATTCTGAGGGG + Intronic
928583748 2:32736267-32736289 CTTCTGAATAAAATTCAGCAGGG + Intronic
928805820 2:35153212-35153234 CTGATAAAAAAAATTTAGCGAGG + Intergenic
928911331 2:36424697-36424719 CTGCTGAAAAAACTTCACGGAGG - Intronic
931134817 2:59386371-59386393 CTTCTGAGAAAATTTCAGCGTGG - Intergenic
931550700 2:63442923-63442945 ATGCCGGAAAAGATTCAGAGGGG + Intronic
931553018 2:63468113-63468135 GTGCTGAGAAAGTTTCAGCCAGG - Intronic
934516388 2:94990601-94990623 CTGCTGAAAATGATCCATCTGGG - Intergenic
937125795 2:119474344-119474366 CTGCTGTAAAAGCTCCAGTGGGG - Intronic
938949658 2:136244680-136244702 CTGAGGGAAAAGATTCAGAGAGG - Intergenic
942514914 2:176741899-176741921 CTGCTGAAAAAAAATTAGCCGGG - Intergenic
1170110001 20:12794900-12794922 CTGCTCTAAAATATTCAGCAAGG - Intergenic
1172441651 20:34970527-34970549 CTGCTGAAATAGATCCCGGGAGG - Intergenic
1176014180 20:62920391-62920413 CTGCTGCAAAGGATTCAGCAAGG + Intronic
1176515589 21:7781073-7781095 CTACTGAAAATGGTTTAGCGGGG - Intergenic
1178649617 21:34411085-34411107 CTACTGAAAATGGTTTAGCGGGG - Intergenic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1182675899 22:32039657-32039679 CTGATGAAATGGATTCAGAGAGG + Intergenic
1183318950 22:37153355-37153377 CTGCTGGAAAAGAAGAAGCGTGG + Intronic
950468062 3:13167242-13167264 CTGGAGATAAAGATTCAGCTAGG + Intergenic
951199511 3:19861666-19861688 CAGAGGAAAAAAATTCAGCGGGG - Intergenic
952038809 3:29236488-29236510 CTGGTGAAAAAGATTCGACAAGG - Intergenic
952389514 3:32867998-32868020 CTGTTAAATAAGATTAAGCGGGG - Intronic
952482708 3:33778021-33778043 CTCCAGAAAAAGAATGAGCGGGG - Intergenic
953614837 3:44480584-44480606 CTGCAGAAAAAGATGGAGGGTGG - Intergenic
959530951 3:107433105-107433127 TTGCAGAAAGAGATTCAGAGAGG + Intergenic
961663277 3:128481576-128481598 CTGCTTAAAAAGGGTCAGGGTGG - Intronic
962616185 3:137129229-137129251 CTGCTGAAAAAAAATCACTGAGG + Intergenic
969160561 4:5254078-5254100 CTACAAAAAAAGATTCAGCTGGG - Intronic
980923511 4:139112174-139112196 TTGCTGAAAGAGATTCAGTAGGG - Intronic
981747673 4:148067157-148067179 CTGCTGCAAAAGAATCAGGGCGG - Intronic
988524984 5:31979211-31979233 ATCCTGAAAAAGATTTAGCTCGG - Intronic
990650476 5:57893066-57893088 CTGCTGAAAAATTTTAAGGGAGG + Intergenic
997511489 5:134457851-134457873 CTGCTGAAAACCCTTCAGGGTGG - Intergenic
997727353 5:136132893-136132915 CTGCTAATAAAGTTGCAGCGAGG + Exonic
1001492108 5:172163246-172163268 ATGAGGAAAAAGATTCAGAGAGG + Intronic
1006097467 6:31665135-31665157 CTATTGAAAAAGTTCCAGCGCGG - Intronic
1006097600 6:31665750-31665772 CTGCGGAAAGAGATCCAGCCTGG + Intronic
1008383243 6:50857472-50857494 CTGATGAAGCAGATTCAGAGAGG - Intergenic
1008550071 6:52620433-52620455 CTGCTGAAAAAGAAACAGAGAGG - Intergenic
1010658268 6:78538479-78538501 CTGCTCAAATATTTTCAGCGTGG - Intergenic
1012339075 6:98096562-98096584 CTGCTCAATAAGAGTCAGAGTGG - Intergenic
1013484508 6:110583884-110583906 CTGATGAAAAAGAATCAGGCTGG + Intergenic
1016585774 6:145682935-145682957 CTGCTGAAATAGATACAGACAGG - Intronic
1017530156 6:155281896-155281918 CTGAAAAAAAAGATTAAGCGTGG + Intronic
1021729759 7:23585024-23585046 CTGCTATAAAAGATGCAGGGAGG + Intergenic
1022840393 7:34158735-34158757 GTGATGAAAAAGATTCACCTTGG + Intergenic
1030019294 7:105257177-105257199 CTGCTGAAAAAAATGCTGGGTGG + Intronic
1030905375 7:115174617-115174639 CTGCTGAAATGGCTTCAGCCTGG + Intergenic
1034362443 7:150512568-150512590 CTGATGAAAAAGATTCATATTGG - Intergenic
1035344590 7:158189821-158189843 CTTCTGATAAAGACACAGCGGGG + Intronic
1036961506 8:13249376-13249398 CTGCTGAAAATGAGTCAGGGTGG - Intronic
1037378301 8:18256929-18256951 GTGCTGAAAAAAATTGAGAGAGG - Intergenic
1037590617 8:20309088-20309110 CTATTGAAAAAGATGGAGCGAGG - Intergenic
1041077650 8:54183914-54183936 GTTCTGAAAAAGTTTCAGCAAGG - Intergenic
1042217220 8:66438727-66438749 AGGCTGAAAAAGATTGAGTGAGG + Intronic
1043647611 8:82540506-82540528 GTGCTGAAAAAAATTCAGAGAGG - Intergenic
1045028569 8:98113982-98114004 CTGCTTAAAAACATTTAGCCTGG + Intronic
1045857399 8:106780390-106780412 CTGATGGAAAAGATACAGAGAGG - Intergenic
1045976281 8:108133429-108133451 TTGCTGGAGAAGATTCAGGGAGG - Intergenic
1047776757 8:128077682-128077704 CTGCTGAAAAATTTGCAGAGAGG - Intergenic
1051517609 9:17948259-17948281 CTGCTGAAGAACATGCAGAGAGG - Intergenic
1058605085 9:106712501-106712523 CTGCTGAACCAGATTCAGGCAGG - Intergenic
1058761337 9:108136296-108136318 CTCCTGAAAAATATTCTGAGGGG - Intergenic
1059100630 9:111468713-111468735 CTTCTGAAAATGTTTCAGCTTGG - Intronic
1061780183 9:132991261-132991283 CTGCTGAGAAAGACCCAGCCAGG - Exonic
1187566434 X:20454216-20454238 GTGCTGGAAAAGATTAAGAGTGG + Intergenic
1187976736 X:24710472-24710494 CTGCTGAATAATATTCTGTGTGG + Intronic
1193353217 X:80485636-80485658 CTGCTGAGAAAGCTGCAGGGAGG - Intergenic
1196120007 X:112039771-112039793 CTGCTGAATCAGAGTCAGTGAGG + Intronic
1198803476 X:140471085-140471107 CTGATGAAAGAGATTTAGAGAGG - Intergenic