ID: 1117055613

View in Genome Browser
Species Human (GRCh38)
Location 14:51909333-51909355
Sequence AAGGTGAATTTTCAAGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 358}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117055613 Original CRISPR AAGGTGAATTTTCAAGTGAA AGG Intronic
900915250 1:5632905-5632927 AAGGTGAATTTAGACCTGAAAGG + Intergenic
901727451 1:11253228-11253250 AAGGTGGATTTAAAAGTGCATGG - Intronic
904640717 1:31925770-31925792 AAGGTGAATTTAGAAGTATAAGG + Intronic
904752515 1:32749764-32749786 AAGGGGAATTTCCAAGAGAAGGG - Intronic
904872894 1:33632718-33632740 AAGTGGAATTGTCAAGTTAAAGG - Intronic
906516411 1:46441475-46441497 AAGTTCATTTTTAAAGTGAATGG - Intergenic
906615230 1:47229176-47229198 CAGGTGAGTTTTCAGGGGAATGG - Exonic
906726898 1:48050806-48050828 AAGGTGAATTTTTACCTGTAAGG - Intergenic
908970978 1:69830693-69830715 AACGTGAATTTTTTATTGAATGG - Intronic
909154670 1:72058146-72058168 ATGGTGAAGTTTCATGTGAAGGG - Intronic
910121024 1:83790592-83790614 AAAGTTATTTTTCAAGTGTATGG + Intergenic
910680096 1:89854143-89854165 TAGGTGAATATGCAAGTGGATGG + Intronic
910931664 1:92448506-92448528 ATGGTAAATTTTCAAGTTATTGG + Intergenic
911924298 1:103808566-103808588 AAGGAGAAGTGCCAAGTGAAAGG - Intergenic
913349102 1:117838205-117838227 AAGGAGAAGTATCAAGCGAAGGG + Intergenic
913444830 1:118939711-118939733 AAGTTGAAATTTCAAGTATAAGG + Intronic
914329311 1:146651133-146651155 TATGTGAATTTTCAACTGCATGG - Intergenic
915038869 1:152950932-152950954 AAGGTGCAGTTTCTAGTGGAAGG + Intergenic
915241145 1:154522802-154522824 AAGCTGAAGTTTTCAGTGAAGGG - Intronic
915881071 1:159672036-159672058 AAAATGAATTTTCAAATCAACGG + Intergenic
916524680 1:165598435-165598457 AAGCTCAATTTTCCAGTTAAGGG + Intergenic
917758582 1:178130766-178130788 AATGTTATTTTTTAAGTGAAAGG - Intronic
918384818 1:183994769-183994791 AAGGTGAATTTTCAAAAGCAAGG + Intronic
919357257 1:196538874-196538896 AAAGTTAATTTTCAATTGAGTGG - Intronic
921260753 1:213383426-213383448 AAGGTCTACTTTCAAGGGAAGGG - Intergenic
921645839 1:217616717-217616739 AAGGTGAATCTCCAAGGAAAGGG - Intronic
922585090 1:226728011-226728033 GTGGTGAATTTTCAGCTGAAGGG - Intronic
923113442 1:230912029-230912051 AAGGTGACTTTTCAAGGGTAAGG + Intronic
923165048 1:231352792-231352814 AAGGTGAAATTTGAACAGAATGG + Exonic
923389946 1:233504269-233504291 AAGGTGTAATTTAAAGTGGATGG - Intergenic
923610339 1:235486748-235486770 ATGGTTAATTTAAAAGTGAAGGG + Intronic
923666304 1:236001495-236001517 AAGGAGAATTTACAAGTCAAGGG + Intronic
924833380 1:247622478-247622500 CCTCTGAATTTTCAAGTGAAAGG + Intergenic
924934600 1:248757318-248757340 AAGGGGTATTTTCAAGAGCAGGG - Intergenic
1063482057 10:6384871-6384893 AATGTGAATTTTCAAGAGTTAGG + Intergenic
1064766646 10:18682066-18682088 AAGGTGCATTTACCAGAGAAGGG + Intergenic
1065781780 10:29175571-29175593 ACGCTGAACCTTCAAGTGAAAGG - Intergenic
1065819488 10:29512039-29512061 AAGGTGCATTTGCAATTGTAGGG + Intronic
1065953361 10:30672371-30672393 AAGGTGCATTTGCAATTGTAGGG - Intergenic
1068133512 10:52925558-52925580 AAGGAGTATATTCAAATGAATGG - Intergenic
1068275061 10:54784019-54784041 AAGGAGAAGTGTCAAGTGAAGGG + Intronic
1068785131 10:60963929-60963951 AAAATGAATTTCCAACTGAAGGG + Intronic
1068857324 10:61810814-61810836 AAGGAGAAGTGCCAAGTGAAGGG - Intergenic
1072852458 10:98910345-98910367 AAAGAGAAATTTCAACTGAAGGG + Intronic
1073858184 10:107702514-107702536 AAGATGATTTTTAAAATGAAGGG - Intergenic
1074124184 10:110515190-110515212 AAGGTGAATTTTGAACTGAGAGG - Intergenic
1074190460 10:111130802-111130824 AAGGTTAAGTTTTAAGTTAAGGG + Intergenic
1074736834 10:116444071-116444093 AAGGAGAAGTGCCAAGTGAAGGG + Intronic
1075998959 10:126900276-126900298 GAGGAGAATTCTGAAGTGAAAGG - Intergenic
1078108835 11:8375736-8375758 AAGGAGAAGTGCCAAGTGAAGGG - Intergenic
1078345254 11:10541975-10541997 AAGGTGAATCTACAAGTGACTGG - Intergenic
1079556675 11:21767232-21767254 AATGAGAATTTCCAAATGAATGG + Intergenic
1080161366 11:29180536-29180558 AAGATGCATTTCCAAGTGACAGG + Intergenic
1080285067 11:30601359-30601381 AAGGAGAAGTGCCAAGTGAAGGG - Intergenic
1080479993 11:32637795-32637817 AAGGTGAAATTTGAAGTTATAGG - Intronic
1080801815 11:35617318-35617340 AATGTGATTTTTCAATTAAAAGG - Intergenic
1080990779 11:37531673-37531695 AGTGTGCATTTTCAAGGGAAAGG - Intergenic
1080994639 11:37583497-37583519 AATCTGAATGTTCAAATGAATGG + Intergenic
1081178825 11:39962431-39962453 ACCGTGAATTTGCAAGTGGAGGG - Intergenic
1086058833 11:82679921-82679943 AAAGTGAATATTCAAGTTATAGG - Intergenic
1087341634 11:96914470-96914492 AAGGTAAATTGTCAATTTAACGG + Intergenic
1087387644 11:97492076-97492098 AAGATGAAGTTTCAAGGAAAGGG - Intergenic
1088059597 11:105630855-105630877 AATGAGAGTCTTCAAGTGAAAGG + Intronic
1088426711 11:109712783-109712805 AAGGAGAAGTGCCAAGTGAAAGG + Intergenic
1089647833 11:119891827-119891849 CAGGTGAATTATCCAGAGAAGGG - Intergenic
1090705093 11:129329032-129329054 AAGAGAAATTTTCAAGAGAAAGG - Intergenic
1092356333 12:7798438-7798460 AAGGAAAATTTTCTAGAGAAAGG - Exonic
1094300102 12:28955014-28955036 AAGGTCAATTTTCAAGGTCATGG - Intergenic
1094680615 12:32663865-32663887 AAGGTAAATTATAAAATGAAGGG - Intergenic
1096948613 12:55439437-55439459 CAGATGAATGTTAAAGTGAATGG + Intergenic
1097246029 12:57608147-57608169 TAGGAGTATTTTCAGGTGAAGGG + Intronic
1097340979 12:58437832-58437854 CAGGTGAATATTCATGTGTATGG - Intergenic
1097802303 12:63927938-63927960 ATTGTGAATCTTCAAGTGAGTGG + Intronic
1098520408 12:71429584-71429606 AAACTTTATTTTCAAGTGAAAGG + Intronic
1100142048 12:91631317-91631339 GAGTAGAATTTTCAAGTGAGAGG - Intergenic
1100365775 12:93919090-93919112 AAGGAGAAGTGCCAAGTGAAGGG + Intergenic
1100624045 12:96311414-96311436 AAGTTGAATTTACCAGTGAAAGG - Intronic
1100791760 12:98137764-98137786 AAGCAGAATTGTCCAGTGAATGG - Intergenic
1101122589 12:101598329-101598351 AAAGAGAAATTTCCAGTGAAAGG - Intronic
1101124585 12:101618623-101618645 ATGGTGACTTTTCAAATTAAGGG - Intronic
1101130250 12:101682710-101682732 AAGGTGCATTTTCATGTAAGAGG - Intronic
1101167209 12:102050728-102050750 ATAGTGAATTTTAAAGTCAAAGG - Intronic
1102587038 12:113930760-113930782 AGGGTGAAGTTTCAGGTGTAGGG - Intronic
1102793655 12:115669983-115670005 AGGGTTTATTTTCAGGTGAATGG + Intergenic
1103024105 12:117559406-117559428 AAAATGAATCTTCAAGTAAATGG - Intronic
1103458893 12:121088421-121088443 AAGTTGGAATTTCAGGTGAATGG - Intergenic
1106688522 13:32088454-32088476 AGGGTGAATTTTCAAGTTTTTGG - Intronic
1107288479 13:38824055-38824077 CAAGTGATTATTCAAGTGAAAGG + Intronic
1107890363 13:44909098-44909120 AAGTAGAATTACCAAGTGAAAGG + Intergenic
1108357609 13:49641780-49641802 AATGTGGCTTTTCCAGTGAAAGG - Intergenic
1109589835 13:64463348-64463370 AAGGTGATTATTCTATTGAATGG + Intergenic
1109750413 13:66684562-66684584 AAGGAGAAGTGCCAAGTGAAAGG - Intronic
1109805967 13:67443376-67443398 ATGGAGAATTTTCAAGTCAACGG + Intergenic
1109977428 13:69857211-69857233 AAGGAGAGTTTTTAAGTAAAGGG - Intronic
1110211299 13:72976750-72976772 CAGGTAAATGTTCAAGTGAATGG - Intronic
1110592515 13:77280698-77280720 AAGGTGTAATAACAAGTGAATGG + Intronic
1110724369 13:78802714-78802736 AAGGAGAAGTGCCAAGTGAAGGG + Intergenic
1110746834 13:79063884-79063906 AATGTGTATTTTCTAGTCAATGG - Intergenic
1110807775 13:79777698-79777720 ATAGTGTATTTTCAAGTGGAAGG - Intergenic
1111059530 13:82997165-82997187 AATGTGAATTTCCAAGAAAATGG - Intergenic
1111082048 13:83323259-83323281 AAGGAGAAGTGCCAAGTGAAGGG + Intergenic
1111185937 13:84735908-84735930 AAGAAGAATTAGCAAGTGAAAGG - Intergenic
1111358129 13:87138146-87138168 TGGGGGGATTTTCAAGTGAATGG + Intergenic
1112633265 13:101184927-101184949 AAGGTGAAATTTCAGCTAAAGGG - Intronic
1113487199 13:110662962-110662984 AATGTGAATTTTCGTGTGAATGG - Intronic
1114743201 14:25119304-25119326 AAGGAACATTTCCAAGTGAAAGG - Intergenic
1115047782 14:29018884-29018906 AAGGTCAATTTTGAAGAAAAGGG - Intergenic
1115642854 14:35346193-35346215 AAGTTGCATTTTAAAGTTAATGG + Intergenic
1116276971 14:42847578-42847600 AATATGAATTTTGAAGTCAAAGG - Intergenic
1116653464 14:47623392-47623414 AAGCTGAAGTTTCAAGGGACTGG + Intronic
1117055613 14:51909333-51909355 AAGGTGAATTTTCAAGTGAAAGG + Intronic
1118044653 14:61954018-61954040 AAGGAGAACTTTCAGGTTAATGG + Intergenic
1118657077 14:67963898-67963920 AATCAGAATTTTAAAGTGAAAGG + Intronic
1119839222 14:77778593-77778615 AAGGAGAAGTGCCAAGTGAAGGG - Intergenic
1120321064 14:82961613-82961635 AAAGTGAATTTTCATGTGTCTGG + Intergenic
1120565767 14:86054619-86054641 AAGGTTATTTTTCATGAGAAGGG + Intergenic
1120760775 14:88283027-88283049 AATGTGAATTTTCTGGTGCAAGG - Intronic
1121273627 14:92653260-92653282 AAGGTCAATTCTCTAGGGAAGGG - Intronic
1122730485 14:103793411-103793433 AAGGAGAAATGTCAAGTGAAGGG - Intronic
1124075501 15:26440217-26440239 AAGGAGGTTTTTCAGGTGAAAGG - Intergenic
1124369634 15:29096633-29096655 TAGCTCAATTTTCAAGGGAAAGG - Intronic
1125503969 15:40256290-40256312 AATGAGAATATTCCAGTGAAAGG + Intronic
1126672503 15:51129119-51129141 AATTTGCATTTTGAAGTGAAAGG + Intergenic
1126977420 15:54198893-54198915 AAGGTTAATTGTGAAGAGAAAGG + Intronic
1127023192 15:54774417-54774439 AAGTAGAAATTTCATGTGAATGG + Intergenic
1127728894 15:61779957-61779979 AATGTGAATTTTCACCTGCAGGG - Intergenic
1128539611 15:68517542-68517564 AAGGTGGATTTCCAAGTGGAAGG - Intergenic
1130211673 15:81928964-81928986 GAGGTGAATTTTTAAATGAATGG + Intergenic
1130380370 15:83366854-83366876 AACCTGAATTTTCAACTGCATGG - Intergenic
1130861873 15:87898462-87898484 AAAGTGAATTTTGAAGACAAGGG + Intronic
1135696338 16:24590242-24590264 AATGTTCATTGTCAAGTGAATGG - Intergenic
1137357770 16:47783147-47783169 AATGGAAATTTTCAAGTCAAGGG - Intergenic
1140214834 16:72998948-72998970 ACAGTGAGTTTTCAAGTTAAAGG - Intronic
1143031210 17:3968254-3968276 ATGGTGAATGTTCAAGTCAGTGG - Intergenic
1144347954 17:14367091-14367113 AAGGATAATTGCCAAGTGAAGGG + Intergenic
1145199145 17:20924831-20924853 AAGGTAAATTTCCAAGTAAATGG + Intergenic
1146297786 17:31663168-31663190 AAGGGGAATTTGCAAGAGTAGGG - Intergenic
1146703933 17:34986059-34986081 CAGGTGACTTCTCCAGTGAAAGG + Exonic
1148954152 17:51339540-51339562 AAGGTTATTTTTAAATTGAATGG + Intergenic
1150443068 17:65207308-65207330 AAGGTGGATCTTCATGTGTAGGG + Intronic
1152185537 17:78854446-78854468 AAGGTGAATTCTCAGATGATAGG - Exonic
1152382845 17:79951229-79951251 AACATGATTTTTCAAGTGCAGGG + Intronic
1155420919 18:25655062-25655084 AAGGAGAAGTGCCAAGTGAATGG + Intergenic
1155437599 18:25829530-25829552 AAGGTGTATTATAAAATGAATGG + Intergenic
1156628067 18:38933793-38933815 AAGGTGGGTTTTCAAATAAATGG + Intergenic
1156637764 18:39051552-39051574 AAGGAGAATTGCCAAGCGAAGGG - Intergenic
1156839015 18:41589376-41589398 GAGATGGATTTCCAAGTGAAGGG - Intergenic
1156916720 18:42470586-42470608 AAGATGATTTTTCAGGAGAAAGG + Intergenic
1157116985 18:44871197-44871219 AAAGTTAATTCTCTAGTGAAAGG + Intronic
1157923231 18:51735245-51735267 AAGTGGAATTTTTAAGTCAAAGG + Intergenic
1158448026 18:57537911-57537933 AAGGAGAAGTGCCAAGTGAAGGG - Intergenic
1158780325 18:60641392-60641414 AAGGAGAAGTGCCAAGTGAAGGG + Intergenic
1158813402 18:61064744-61064766 AATGACAATTTTCAAGTGCAAGG - Intergenic
1159844458 18:73441886-73441908 AATTTGAATTTTCAGGTGTATGG + Intergenic
1161604571 19:5207548-5207570 AAGGGGAATGTTCCAGTGGAGGG - Intronic
1163734148 19:18968507-18968529 AAGGTGAATTTTTGTGTGTAGGG - Intergenic
1165806418 19:38583791-38583813 AAGGTGAGGTATCAAGTGAATGG - Intronic
1166615622 19:44242398-44242420 ACTTAGAATTTTCAAGTGAATGG - Intronic
1166892426 19:46001584-46001606 AATGTGAATTTTCCAGGGGAAGG + Intronic
925436404 2:3842042-3842064 AAGATGAATCTGCAAGTGGACGG + Intronic
925863881 2:8206750-8206772 TAGGTCTATTTGCAAGTGAAAGG - Intergenic
926709738 2:15869276-15869298 AAGGAGAAGTGCCAAGTGAAGGG + Intergenic
927101810 2:19793559-19793581 AAGGTCACTTTGCAAGTGAGTGG + Intergenic
927362616 2:22253694-22253716 AAAATGAGTTTTCAAGGGAAGGG + Intergenic
927630692 2:24771459-24771481 AAGGTGAATTTTAGAATGAGGGG + Intergenic
928000223 2:27517434-27517456 AAGGAGAAGTGCCAAGTGAAGGG + Intronic
932388133 2:71357530-71357552 AAGGTGAATTTTTAGTTGGATGG + Intronic
933698296 2:85236527-85236549 AGAATGAATTTTCAAGAGAAAGG + Intronic
933949791 2:87318938-87318960 AAGATGATTTTAAAAGTGAATGG + Intergenic
935613907 2:105056027-105056049 AAAGTGAATTTTCCAGATAAGGG + Intronic
936330403 2:111542659-111542681 AAGATGATTTTAAAAGTGAATGG - Intergenic
937577572 2:123442632-123442654 TAAGTGAATTTTTAAGTGTACGG - Intergenic
938313397 2:130309783-130309805 AAGGTCAATCATCAAGTAAATGG - Intergenic
938628505 2:133138601-133138623 AAGGTCACTTATCAAGTTAATGG - Intronic
940491679 2:154369918-154369940 AAGGTGATCTTTCAAGAGACTGG - Intronic
940731224 2:157395053-157395075 AATGTGAATTAACAAGGGAATGG + Intergenic
940834526 2:158506034-158506056 AATGTGAATTTTAAAAAGAATGG + Intronic
941390570 2:164908595-164908617 AAAGAGAATTTTAGAGTGAAGGG + Intronic
941942457 2:171056494-171056516 AATGTGAATTTTGAGGAGAACGG + Exonic
941947760 2:171118939-171118961 AAGGTGTATTTTCAGGTACAGGG - Intronic
942407031 2:175667077-175667099 AAGGTGAATTTTCAACAAAAAGG + Intergenic
943203058 2:184854894-184854916 AATGTGAATATTCAACAGAATGG + Intronic
944640754 2:201723058-201723080 AAGGAGAATTTTCAGATGACTGG - Exonic
945034632 2:205694071-205694093 AAGGTGAGTTCCTAAGTGAAGGG + Intronic
945552177 2:211233923-211233945 AAGGAGAAGTGCCAAGTGAAGGG + Intergenic
945586025 2:211664061-211664083 AAGGTGAATTTGAATTTGAATGG + Intronic
945774198 2:214084078-214084100 AAAATAAATTTTAAAGTGAAGGG - Intronic
946631314 2:221672185-221672207 AAGGAGAAGTGTAAAGTGAAGGG - Intergenic
947070986 2:226287814-226287836 AAGGGCAATTTTCCAGGGAATGG - Intergenic
1169071220 20:2731885-2731907 AATGTGAAGTGGCAAGTGAAAGG - Intronic
1169875311 20:10290929-10290951 AAGGTAAATATTCAAGTGGAGGG - Intronic
1171563586 20:26154320-26154342 AGGGTTAATTTACAAGTGGATGG - Intergenic
1173417312 20:42868536-42868558 AAGATGAATTTATAAGTAAAAGG + Intronic
1173939396 20:46896800-46896822 AAGCTGAAGTTACAAGAGAATGG - Intronic
1174030378 20:47619689-47619711 AAGGTGATTTTTAAATTGAATGG - Intronic
1175664783 20:60849330-60849352 AAGGTGAATTCTTAAGTAACAGG + Intergenic
1175806341 20:61831243-61831265 AAAGTGAAATTTCAATTAAAAGG + Intronic
1177962390 21:27683510-27683532 AAAGGGAATTTTTAAGTGAATGG - Intergenic
1178089733 21:29149942-29149964 AAGTTAAGTATTCAAGTGAATGG - Intronic
1178171595 21:30047153-30047175 AAGGTTAATTTTAATGTGAAAGG + Intergenic
1178191433 21:30286003-30286025 AAGCTAAATTTTCCAGTAAATGG + Intergenic
1178606207 21:34038089-34038111 ATGGGGAATTTTCCAGGGAAAGG - Intergenic
1178668996 21:34574049-34574071 AAGATGAATTTTCCAATGGAAGG + Intronic
1181169006 22:20997909-20997931 GAGGTGAATTTTGGAGTGAAGGG + Exonic
1182254459 22:29028398-29028420 AAAGGGAAATTTCAAGAGAAGGG + Intronic
1182731107 22:32494693-32494715 AACTTGAATATACAAGTGAAAGG - Intronic
1184314743 22:43676937-43676959 AAGGTGATGTTTCTACTGAATGG - Intronic
1185008107 22:48297423-48297445 AAGGAGAAGTGTCGAGTGAAGGG - Intergenic
949282297 3:2360678-2360700 AAGGAGAATTCCCAAGTAAAGGG + Intronic
949801909 3:7913613-7913635 AATGTGATTTTTGAAGTGACTGG - Intergenic
950913343 3:16617351-16617373 AAGGAGAAGTGCCAAGTGAAAGG - Intronic
951339323 3:21465687-21465709 CAGGTGAATTTTCACAGGAAAGG - Intronic
951466534 3:23006030-23006052 AAGGAGACTTTTCTGGTGAAAGG - Intergenic
951644088 3:24867779-24867801 AAGTTGATTTTTCAACTTAATGG - Intergenic
952004092 3:28822361-28822383 AAGGATAATTTTCAAGTGTCTGG + Intergenic
953198332 3:40754656-40754678 AAGGTTAATTCTCCAGAGAAAGG - Intergenic
953248294 3:41217605-41217627 AAATTGAATTTTTAAGTCAAAGG + Intronic
954697064 3:52433362-52433384 AAGCTGAATTTACAAGGAAAGGG - Exonic
955323785 3:57994136-57994158 AAGGTCCATTAACAAGTGAATGG - Intergenic
955495759 3:59530602-59530624 AAGGAGAAGTGGCAAGTGAAGGG + Intergenic
955628161 3:60942440-60942462 AAGGTATATTTTCAAGAGTATGG + Intronic
955663413 3:61325586-61325608 AAATGGAATATTCAAGTGAAAGG + Intergenic
956064345 3:65381135-65381157 AACGTGAGCTTTCAAGGGAAAGG + Intronic
956261511 3:67348190-67348212 AAGAAGAATTTTCAAGTTTATGG + Intergenic
956462794 3:69488290-69488312 CAGGTGAATTTTGAATTGGAGGG - Intronic
956534402 3:70259914-70259936 AAGGAGAAGTGCCAAGTGAAGGG + Intergenic
958026365 3:88054779-88054801 AAGGGGAATTTTGCAGTGACAGG - Exonic
958142810 3:89585149-89585171 AAGGTTAATTTGCTAATGAAGGG - Intergenic
958829593 3:99071561-99071583 AAAGTTTATTTTCAAGTGAGTGG + Intergenic
959256938 3:104027390-104027412 AATGTGGATTTTCAACTGCATGG - Intergenic
959364631 3:105441651-105441673 AAGGTGAATTATGAAGGGTATGG - Intronic
959447462 3:106458028-106458050 AAGTATAATTTTCAAGTGTATGG + Intergenic
960653471 3:119978078-119978100 AAGGTGAATTTTAGAATGAGGGG - Intronic
960654699 3:119990012-119990034 AAGGTGAATTTTAGAATGAGGGG - Intronic
963569540 3:146975469-146975491 AAGGTGAAATGTAAAGTTAAAGG - Intergenic
964034009 3:152173491-152173513 TATGTGAATTTTCAACTGCAAGG + Intergenic
964154795 3:153571903-153571925 AATGTGATTTTTCATTTGAAAGG - Intergenic
964689985 3:159439377-159439399 AAGGAGAAGTGCCAAGTGAAGGG + Intronic
964909418 3:161760273-161760295 AAGGTAATTGTTCAAGTGAAAGG + Intergenic
966581136 3:181565274-181565296 AAGGTGTATTTTCAATTTTAAGG + Intergenic
966710776 3:182970493-182970515 AAGGTGAAAATTCAAGATAATGG - Intronic
967642404 3:191881540-191881562 TAGGTGACCTTTCAAGTGATGGG - Intergenic
969069240 4:4520448-4520470 AAAGTGCATTTTTATGTGAAAGG - Intronic
970522044 4:16895141-16895163 AATCTGAATTTTCAATTAAAGGG + Intronic
970755085 4:19416169-19416191 AAGGTACATTTTCAAGTGTTAGG - Intergenic
970892545 4:21064140-21064162 AAAGTAAATTTCCCAGTGAAAGG - Intronic
971383029 4:26117117-26117139 GAGTTGATTTTTTAAGTGAAGGG + Intergenic
971735141 4:30439549-30439571 GAGGTGAATTCTCAAATGATAGG + Intergenic
972200778 4:36712612-36712634 AAGGTGAAATTGCAGGAGAAGGG - Intergenic
972700437 4:41489807-41489829 CACGTGAATTTTCTACTGAATGG - Intronic
972999801 4:44932376-44932398 AAGGTGTATTTTGAAAGGAAAGG - Intergenic
973652783 4:53013379-53013401 AAGGTGACATTTATAGTGAAAGG - Intronic
974295375 4:59992431-59992453 ATGATTAATTTTCAAGTGAATGG - Intergenic
974324583 4:60397278-60397300 AAGGTGAAATGTCCAGTGAAAGG - Intergenic
974763932 4:66315820-66315842 AAGTTTAATTTTTAAGAGAATGG + Intergenic
974832191 4:67203301-67203323 CAGGCATATTTTCAAGTGAAAGG + Intergenic
976938726 4:90673346-90673368 CAGGTGAATTTCCCAGAGAAGGG - Intronic
977118502 4:93065872-93065894 GATTTGAATTTTCAAGTCAACGG - Intronic
977423337 4:96831735-96831757 AAGAGGAATTTTGAAGGGAAAGG - Intergenic
978049254 4:104175638-104175660 AAGGAGAATTGCCAAGTGAAGGG - Intergenic
978167804 4:105629994-105630016 AAGGTGAAATTTCAAGTGCTGGG - Intronic
978426248 4:108585564-108585586 AAGAAGAACTTTCAAGTAAATGG - Intergenic
978667253 4:111199137-111199159 AAGGAGATGTGTCAAGTGAAAGG + Intergenic
978810058 4:112839647-112839669 AAGGTGAAGTGTAAAGTAAAGGG + Intronic
979163846 4:117499754-117499776 AAGGTAGATATTTAAGTGAATGG + Intergenic
979536006 4:121821660-121821682 AAGGTGATCTTTGAAGTGAAAGG - Intronic
979794410 4:124828791-124828813 AATGTGGAATTTCAAGTGAGTGG - Intergenic
980634387 4:135480493-135480515 AAGATGAATTTTTAAGCTAAAGG - Intergenic
980864634 4:138540681-138540703 GAGAGGAATTTTCTAGTGAAGGG - Intergenic
983349080 4:166563988-166564010 AAGATAAATTTTGAAATGAAAGG + Intergenic
984176650 4:176426772-176426794 AGGGTGAAGTGCCAAGTGAAAGG - Intergenic
984699998 4:182813027-182813049 AAGGAGAAGTTCCAAGCGAAGGG + Intergenic
984833915 4:184001296-184001318 AAAGACAATTTTCAAGTGAGTGG - Intronic
985042512 4:185905809-185905831 AATATGAATTTCCAAGTCAAAGG + Intronic
985133341 4:186760685-186760707 AATTTGAATTTTAAAGTCAAAGG + Intergenic
986239692 5:5949573-5949595 AAAATGATTTGTCAAGTGAAGGG - Intergenic
986580356 5:9259177-9259199 TAGCTGTATTTCCAAGTGAAAGG - Intronic
986991958 5:13564668-13564690 AAGGAGAAGTGCCAAGTGAAGGG - Intergenic
987479505 5:18435344-18435366 AAGGTAAATTTACAACAGAATGG - Intergenic
988460808 5:31436062-31436084 AATGTGAAAATACAAGTGAATGG - Intronic
988545487 5:32152948-32152970 AAGTAGAATTGTCAAGTTAAAGG - Intronic
988627393 5:32892251-32892273 CAAGACAATTTTCAAGTGAATGG + Intergenic
988728563 5:33947443-33947465 AAGGTGAATCTTCAGAAGAAAGG - Intronic
988899729 5:35718925-35718947 AAGCTGAATTTTAAGGTGAGAGG + Intronic
989265273 5:39466179-39466201 ACGGTGAATCTTCAAGTGTGAGG + Intergenic
989704709 5:44315294-44315316 GAGGTGACTTTTCAAGAGCAGGG + Intronic
990194000 5:53292513-53292535 AAAGAGATTTTTCAGGTGAATGG + Intergenic
990884776 5:60579193-60579215 ATGGTGAATTTGGAACTGAAAGG - Intergenic
992011817 5:72535226-72535248 AATGTCAATTGACAAGTGAATGG + Intergenic
992012407 5:72541769-72541791 AAGGTGATTGTTCAGGTGATTGG - Intergenic
992207232 5:74442746-74442768 ACTGTGATTTTGCAAGTGAAAGG + Intergenic
992810597 5:80384178-80384200 AAGTTGAATTTTAAAGTTGATGG - Intergenic
993156937 5:84237490-84237512 AAGCAGAATTTTGAAGTAAATGG + Intronic
993286370 5:86003273-86003295 TACGTGAATTTTCAACTGTATGG + Intergenic
993563856 5:89447726-89447748 AAGATAATTCTTCAAGTGAAAGG + Intergenic
994385824 5:99130304-99130326 AAGGGGAATTTCCCAGTGATTGG - Intergenic
994553510 5:101266471-101266493 AAAATGAATTTTCAAATCAATGG + Intergenic
995097132 5:108250204-108250226 AACGTAATTTTTCATGTGAATGG + Intronic
995210365 5:109530761-109530783 AAAGTGATTATTCAAATGAAGGG + Intergenic
996929129 5:128865174-128865196 AAGGTCAATTTTCAAGTAAGGGG - Intronic
997375713 5:133395766-133395788 AAGGTGGATTTTGAAGAGCAAGG - Intronic
999374154 5:151075211-151075233 AAGGAGAAATTTCAACTGATTGG + Intronic
1000515859 5:162235968-162235990 AAGGAGAATTTCCAAGCAAAGGG + Intergenic
1003015760 6:2466271-2466293 AAGTAGAATTTCCAGGTGAAAGG + Intergenic
1003919382 6:10818676-10818698 AAAGTGAATTTTCAAATGTGAGG + Intronic
1004675749 6:17840555-17840577 AAAATGTATTTTCATGTGAAAGG - Intronic
1004827397 6:19437903-19437925 TATGTGAATCTACAAGTGAAGGG + Intergenic
1004830666 6:19474160-19474182 AGGGTCAAATTTCATGTGAATGG - Intergenic
1005061625 6:21782105-21782127 AAGATAAATTTTTAAGTAAAAGG + Intergenic
1005640272 6:27789374-27789396 AAGGTTAATTTTGAAAAGAATGG - Intergenic
1008421647 6:51307654-51307676 AACCTGAATTTTCACATGAAGGG + Intergenic
1008833238 6:55794814-55794836 AATGTGAATTCTCAAATGAATGG + Intronic
1009923256 6:70089693-70089715 AGGATGAATTTTCAAGGGAAAGG - Intronic
1010099589 6:72088552-72088574 AACATGAAATTTCAAGTGACCGG - Intronic
1010370875 6:75105815-75105837 AAAGTGAGTATTCCAGTGAAAGG - Intronic
1010549527 6:77204084-77204106 AATGTGATTTTTTAAGGGAATGG - Intergenic
1010879678 6:81152355-81152377 AAGGAGAAGTGCCAAGTGAAGGG + Intergenic
1011027768 6:82887831-82887853 AAGAGAAAGTTTCAAGTGAAGGG + Intergenic
1011385657 6:86795591-86795613 AAGGAGAAGTGCCAAGTGAAAGG + Intergenic
1011864079 6:91799527-91799549 AATATCAATTATCAAGTGAATGG - Intergenic
1013392126 6:109696490-109696512 AATGTGAATTGACAGGTGAATGG + Intronic
1013633211 6:112005164-112005186 AAGGGGACTGTACAAGTGAAGGG - Intergenic
1014085754 6:117341451-117341473 AAAGTGAATTTCCAAATGGAAGG - Exonic
1014583666 6:123170278-123170300 AAGGAGAATGGTGAAGTGAAAGG + Intergenic
1014857126 6:126416453-126416475 AATGTGAATTCTCAAGACAATGG + Intergenic
1015988917 6:138915092-138915114 AAAGTGAAGTGTTAAGTGAAAGG - Intronic
1019455790 7:1126722-1126744 CACGTGTCTTTTCAAGTGAATGG + Intronic
1020464930 7:8466765-8466787 AAAGTAAATTTTCAAGACAAGGG - Intronic
1020618010 7:10484068-10484090 AAGGTGAACTTCAAAGAGAATGG + Intergenic
1020618182 7:10486234-10486256 AAGGAGAATTCCCCAGTGAAGGG + Intergenic
1021212960 7:17878952-17878974 AGTGGGAATTGTCAAGTGAATGG - Intronic
1022198745 7:28095403-28095425 AAGGAGAAGTGCCAAGTGAAGGG + Intronic
1025274135 7:57559967-57559989 AGGGTTAATTTACAAGTGGATGG + Intergenic
1027841519 7:83317981-83318003 AAGCTGAATTTTCCAGCTAATGG - Intergenic
1028088092 7:86661994-86662016 ATGGTGAATCTTAAAATGAATGG + Intronic
1028315331 7:89394695-89394717 AAGGTAATTTTTAAAGTGGAAGG - Intergenic
1028331890 7:89605111-89605133 AAGGTAAATTTGGAGGTGAAAGG - Intergenic
1028438050 7:90827955-90827977 AATGTGATTTTTAAATTGAAAGG - Intronic
1028529904 7:91827092-91827114 AAGGTGATATTTAAAGAGAAAGG - Intronic
1029012713 7:97279227-97279249 AATGTGAATTTTCAACTCAGTGG - Intergenic
1029891472 7:103934481-103934503 AAGCTAAATTTGGAAGTGAAAGG - Intronic
1030383044 7:108835065-108835087 AAGGAGAAGTGCCAAGTGAAGGG - Intergenic
1030570525 7:111216673-111216695 AAGTGGAATTTTCAAATAAATGG + Intronic
1031172365 7:118308246-118308268 AAGGAGAAGTGCCAAGTGAAGGG + Intergenic
1033923196 7:146421029-146421051 AAAATGAACTTTGAAGTGAAAGG + Intronic
1036043934 8:5118928-5118950 AAAGTGAATCTTCAGGTGGAGGG - Intergenic
1036523403 8:9513279-9513301 AAGGTGGATTTGCAGATGAACGG - Intergenic
1036722972 8:11194950-11194972 ATGGTAAATTTTCAAGGGAAGGG - Intronic
1036932643 8:12971339-12971361 AAGGTGACTTTGCCAGGGAACGG + Intronic
1039684543 8:39784198-39784220 TAGCTGATTTTTCCAGTGAAAGG + Intronic
1039988789 8:42470072-42470094 AAGGTGAATTTTACAAAGAACGG + Intronic
1041485127 8:58367950-58367972 CAGCTGAATTTTCCAGTGCAGGG - Intergenic
1042266220 8:66911304-66911326 AAGGAGAAGTGCCAAGTGAAGGG - Intronic
1042440255 8:68817834-68817856 AAGGAGAAATGCCAAGTGAAGGG + Intronic
1043728292 8:83641002-83641024 AAGGGGTATTTTCAAGTAAATGG + Intergenic
1043784829 8:84385816-84385838 AAGGTGAATGGCCAAGTTAAGGG - Intronic
1044136746 8:88595101-88595123 CAGGTTAATTTTGAAGTGAGAGG + Intergenic
1044465146 8:92494257-92494279 AAGAGTAATTTTCAAGTTAATGG + Intergenic
1046210786 8:111072319-111072341 AAAGTGAATTTTAATGTGAGGGG + Intergenic
1046718634 8:117594692-117594714 TAGGGCAATTTTCAAGAGAAAGG - Intergenic
1046764528 8:118055460-118055482 GAGGTGGATTTTAAAGAGAATGG - Intronic
1048622702 8:136152270-136152292 AAGGAGAAGTGCCAAGTGAAGGG + Intergenic
1050005860 9:1129585-1129607 TTGGTGAATTTGCAAATGAAAGG + Intergenic
1051368086 9:16335432-16335454 AAGGAGAAGTGCCAAGTGAAGGG + Intergenic
1051539943 9:18204331-18204353 AAGGAGAAGTGCCAAGTGAAGGG - Intergenic
1052069915 9:24069268-24069290 AAGCTGAGTTTACAAGAGAAGGG - Intergenic
1052189282 9:25639024-25639046 CAGATGATTTTTCAGGTGAAAGG - Intergenic
1052677585 9:31646709-31646731 AAGTTGAATTGTAAAGTCAAGGG + Intergenic
1052797562 9:32937650-32937672 AAGGAGAAGTGCCAAGTGAAGGG + Intergenic
1053926002 9:43057540-43057562 AAGGGGAATTTGTAAGTGAGAGG - Intergenic
1055079444 9:72254645-72254667 AAGTTCAGTTTTCAAGTGAGTGG - Intronic
1055141868 9:72885537-72885559 AAGTAGATGTTTCAAGTGAAGGG - Intergenic
1055209677 9:73775604-73775626 AAAATGAATTTTCAAATGAATGG - Intergenic
1056878362 9:90361982-90362004 CACGTGAATTTTCTACTGAATGG - Intergenic
1186294253 X:8131688-8131710 AAGGAGAAGTGCCAAGTGAAGGG - Intergenic
1186813333 X:13211417-13211439 CATTTGAATGTTCAAGTGAATGG - Intergenic
1187082261 X:16003203-16003225 AAGGAGAAGTGCCAAGTGAAGGG - Intergenic
1187195973 X:17083922-17083944 AAGGTGAATTTTATAGTATATGG - Intronic
1187574909 X:20543393-20543415 AAGGAGAAATGTCAAGTAAAGGG - Intergenic
1188324523 X:28784753-28784775 AAGGTAAATTTGGAAGTGAAAGG - Intronic
1189115276 X:38335877-38335899 AAGGTGAAATTTTTAGTGAATGG - Intronic
1189721253 X:43920988-43921010 ATGCTGATTTTGCAAGTGAAAGG + Intergenic
1190122832 X:47676665-47676687 AAGGAGAAGTGCCAAGTGAAAGG - Intergenic
1192087074 X:68110955-68110977 AAGGTGAGTTTCCAGGTTAATGG - Intronic
1192453202 X:71256148-71256170 CAAGTGACTTGTCAAGTGAAGGG + Intergenic
1193483585 X:82059001-82059023 AAGGCGGAGTTTGAAGTGAATGG - Intergenic
1194444250 X:93967710-93967732 AAATTGAATTTCCATGTGAAGGG - Intergenic
1194722377 X:97355309-97355331 AGGGTGAATTTTTACATGAAAGG + Intronic
1194961336 X:100239524-100239546 AATCTGAATTTTAAAGAGAAAGG - Intergenic
1196280409 X:113817576-113817598 AAAATGAAATTGCAAGTGAAAGG - Intergenic
1196929774 X:120669875-120669897 AAGGAGAAGTGCCAAGTGAAGGG - Intergenic
1198006460 X:132499392-132499414 AAGCTGAGTTTTCAAGAGAAAGG + Intergenic
1198107873 X:133478095-133478117 AAGGTATATTTTAAAGTGACAGG + Intergenic
1200374105 X:155761022-155761044 CCAGTGGATTTTCAAGTGAAAGG - Intergenic
1201425263 Y:13843235-13843257 AAGGAGAAGTGCCAAGTGAAGGG + Intergenic
1201635052 Y:16113267-16113289 AAGGTGAATTTTAGAATGAGGGG + Intergenic
1201636380 Y:16127632-16127654 AAGGTGAACTTTAGAATGAAGGG - Intergenic