ID: 1117058062

View in Genome Browser
Species Human (GRCh38)
Location 14:51933075-51933097
Sequence ATGCTCCTGCCAGAGGCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 984
Summary {0: 1, 1: 2, 2: 23, 3: 130, 4: 828}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117058062_1117058066 2 Left 1117058062 14:51933075-51933097 CCTAGAGCCTCTGGCAGGAGCAT 0: 1
1: 2
2: 23
3: 130
4: 828
Right 1117058066 14:51933100-51933122 CTCTGCTGGCACCTTGATTTTGG 0: 2
1: 82
2: 594
3: 1800
4: 3788

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117058062 Original CRISPR ATGCTCCTGCCAGAGGCTCT AGG (reversed) Intronic
900305494 1:2004844-2004866 ATTCTCCTGCCTCAGCCTCTGGG - Intergenic
900475428 1:2874239-2874261 ATGCTTCTGCCAGAGGGTGTGGG - Intergenic
900510795 1:3060116-3060138 ATGCTCCAGCCAGGGTCTTTGGG - Intergenic
900607124 1:3528793-3528815 GTGCTCCTTCTGGAGGCTCTAGG - Intronic
900726954 1:4222780-4222802 TGGCTCCTTCCAGACGCTCTGGG - Intergenic
900934413 1:5756161-5756183 ACGCTTCTTCCAGAGGCTCCAGG + Intergenic
900941465 1:5801370-5801392 GTGCTCCCTCCAGAGGCTCTGGG - Intergenic
901108518 1:6776624-6776646 ACACTCCTTCCAAAGGCTCTAGG - Intergenic
901111306 1:6798522-6798544 ATTCTCCTGCCTCAGCCTCTTGG + Intronic
901290380 1:8119632-8119654 ATTCTCCTGCCTCAGCCTCTCGG + Intergenic
901816283 1:11795202-11795224 AAGCTCCTGGCACAGGCTCACGG + Exonic
902306463 1:15543379-15543401 ATGCTCCTGCCTCAGGGCCTTGG - Intronic
902416719 1:16244133-16244155 ATGCTCCTGCCCGAGGACATGGG - Intergenic
902446128 1:16465751-16465773 ATGCTCCTTCCAGAGGGTCTAGG + Intergenic
902601695 1:17544051-17544073 ATTCTCCTGCCTCAGCCTCTGGG + Intronic
902753256 1:18532187-18532209 GTGCTCCTTCCAGAAGCTCGAGG - Intergenic
903222155 1:21874985-21875007 ATGCTGATGCCAGAGACCCTGGG + Exonic
903270203 1:22183452-22183474 ATACTCCTCCCTGAGGCTCTGGG + Intergenic
903428202 1:23270557-23270579 ATTTTCCTTCCAGAGGCTCCAGG - Intergenic
903861444 1:26367157-26367179 ATTCTCCTGCCTCAGCCTCTCGG - Intronic
904122255 1:28207548-28207570 ATTCTCCTGCCTCAGCCTCTCGG + Intronic
904689623 1:32283985-32284007 ATTCTCCTGCCTCAGTCTCTCGG + Intronic
904914670 1:33961182-33961204 ATGCACCTGCAGGGGGCTCTGGG - Intronic
905020246 1:34805633-34805655 ATTCTCCTGCCTCAGCCTCTTGG - Intronic
905336131 1:37245769-37245791 ATGTTCCTTCTGGAGGCTCTAGG - Intergenic
905503669 1:38459410-38459432 CTCCTCCTGCCAGAGGTTCTTGG - Intergenic
905703030 1:40033158-40033180 GTGCTCCTTCTGGAGGCTCTAGG + Intergenic
905948454 1:41924252-41924274 ATGCTCCCTCCGGAGGCTCAGGG - Intronic
906932285 1:50181788-50181810 ATTCTCCTGCCTCAGCCTCTGGG + Intronic
906955705 1:50371889-50371911 ATGCTCCTGCCAACGGCTCTAGG + Intergenic
907081622 1:51628788-51628810 ATTCTCCTGCCTCAGGCTCCTGG + Intronic
907163450 1:52388766-52388788 ATGCTCCTAACAGAGTGTCTCGG - Intronic
907389773 1:54150695-54150717 ATGCCACAGCCAGAGCCTCTGGG - Intronic
908282399 1:62554363-62554385 ATTCTCCTGCCTCAGCCTCTCGG - Intronic
910202483 1:84713872-84713894 ATACTCCCTCCAGGGGCTCTAGG + Intergenic
910310974 1:85824276-85824298 ACGCTCCCTCTAGAGGCTCTAGG - Intronic
910498149 1:87856581-87856603 AGCCTCCTTCCAGAGGCTCCAGG + Intergenic
911036577 1:93556447-93556469 GAGCTCCTGCCACTGGCTCTTGG + Intergenic
911385380 1:97168951-97168973 ATTCTCCTGCCTCAGTCTCTTGG + Intronic
911709564 1:101054401-101054423 ATGCTCCTTCCAAAGGCTCTGGG - Intergenic
912123803 1:106507682-106507704 ATTCTCCTGCCTCAGCCTCTCGG - Intergenic
913077830 1:115356270-115356292 ATGCTCCACCCACAGGCTCAGGG + Intergenic
913345937 1:117811271-117811293 ATGCTCCTGACATGGGCTATGGG - Intergenic
913365589 1:118034511-118034533 ATGCTACTGCCACTTGCTCTGGG + Intronic
914243720 1:145870824-145870846 ATTCTCCTGCCTCAGCCTCTTGG + Intronic
914254937 1:145954200-145954222 GTGCTCCCTCCAGAAGCTCTAGG - Intronic
914428006 1:147596518-147596540 ATTCTCCTGCCTCAGGCTCCCGG + Intronic
914798938 1:150945828-150945850 ATTCTCCTGCCTCAGCCTCTCGG + Intronic
915254406 1:154615097-154615119 GTGCTCCCTCCAGAGGCTGTAGG - Intronic
915537937 1:156548739-156548761 ATGCCCCTGTCAGTGGCTCTTGG - Exonic
915540539 1:156563190-156563212 AGACGGCTGCCAGAGGCTCTCGG + Exonic
915742705 1:158131432-158131454 AGGCTCCCTCCAGAGGCTATAGG - Intergenic
916153053 1:161815296-161815318 ATCCTCCTGCCTCAGCCTCTAGG + Intronic
916801864 1:168223422-168223444 ATGCTCCCTCTGGAGGCTCTAGG + Intergenic
916922872 1:169486923-169486945 CAGATCCTGCCAGAAGCTCTTGG + Intergenic
917292301 1:173483442-173483464 ATTCTCCTGCCTCAGGCTCCCGG - Intronic
917531702 1:175841810-175841832 CTACTCCTGCCTGAGGCTCCTGG + Intergenic
917582349 1:176391763-176391785 AAACTCCAGCCAGAGGCTCAAGG - Intergenic
917656435 1:177130757-177130779 AGGCTCATGCCAAAGTCTCTAGG - Intronic
918009046 1:180569471-180569493 ACACTCCCTCCAGAGGCTCTAGG - Intergenic
918061890 1:181068986-181069008 ATTCTCCTGCCTCAGTCTCTGGG + Intergenic
919184389 1:194125972-194125994 ATTCTCCTGCCTCAGGCTCCTGG - Intergenic
919683109 1:200455385-200455407 ATTCTCCTGCCTCAGCCTCTGGG + Intergenic
920075525 1:203333689-203333711 ATGCTTCTTCCAAAGGCTCTAGG - Intergenic
920861028 1:209706870-209706892 ATTCTCCTCCCAAAAGCTCTTGG - Intronic
921399709 1:214707816-214707838 ATGTTCCTGCCAGCAGTTCTTGG + Intergenic
921445942 1:215247810-215247832 ATGCTCCCTCCAGGGCCTCTAGG + Intergenic
921648631 1:217650044-217650066 ATTCTCCTGCCTCAGCCTCTCGG + Intronic
921736393 1:218633470-218633492 TAGCTCCAGCCAGAGGCTCAAGG - Intergenic
921826688 1:219679795-219679817 ATGCTCCTTCCAAAGGCTCTAGG - Intergenic
922752285 1:228075928-228075950 ATGCTCCCTCCAAAGGTTCTGGG + Exonic
923033223 1:230266085-230266107 ATTCTCCTGCCTCAGCCTCTCGG - Intronic
923118656 1:230969153-230969175 ATTCTCCTGCCTCAGCCTCTCGG - Intronic
923190594 1:231616659-231616681 ATCCTACTCACAGAGGCTCTTGG + Intronic
923312392 1:232747601-232747623 ACGCTCCCTCCAGAGGCTCTAGG + Intergenic
923316964 1:232789853-232789875 ATGCTCTTGCCAGATGTCCTTGG - Intergenic
923532746 1:234824532-234824554 ATTCTCCTGCCTCAGCCTCTTGG + Intergenic
923751790 1:236753633-236753655 CTCCTCCAGCCAGAGGCTCTAGG - Intronic
923982150 1:239337180-239337202 GTGCTCCCTCCAGAGACTCTAGG + Intergenic
924030878 1:239884400-239884422 ACACTCCCTCCAGAGGCTCTAGG - Intronic
924238736 1:242021403-242021425 ATGCCCCTTCGGGAGGCTCTAGG + Intergenic
924413538 1:243833143-243833165 ATTCTCCTGCCTCAGCCTCTGGG - Intronic
924534596 1:244924069-244924091 ATTCTCCTGCCTCAGGCTCCCGG + Intergenic
924698352 1:246423592-246423614 ATCCTCCTGCCTCAGGCTCCTGG - Intronic
1062933358 10:1367251-1367273 GTTCTCCTGCCGAAGGCTCTGGG + Intronic
1062978540 10:1702687-1702709 ATGCTCCTGCCGGCCTCTCTGGG + Intronic
1063868961 10:10397713-10397735 ACACTCCCTCCAGAGGCTCTAGG - Intergenic
1064434442 10:15299025-15299047 ATGCTCCTGCCTCAGACTCCTGG + Intronic
1065271589 10:24038856-24038878 ATCCTCCTGCCTCAGCCTCTTGG + Intronic
1065804029 10:29378585-29378607 CTGCTTCTGCCTGCGGCTCTCGG - Intergenic
1066078142 10:31901735-31901757 ATGTGCATACCAGAGGCTCTAGG + Intronic
1066132205 10:32405129-32405151 ATCCTCCTGCCTCAGGCTCATGG - Intergenic
1066293325 10:34033523-34033545 ATTCTCCTGCCTGAGCCTCTGGG + Intergenic
1066558964 10:36647473-36647495 ATGCTCAGTCCAGAAGCTCTAGG - Intergenic
1066675774 10:37885356-37885378 ATTCTCCTGCCACAGCCTCCTGG - Intergenic
1067211890 10:44266355-44266377 GTGCTCTTGCCTGAGGCTCTAGG - Intergenic
1068130403 10:52889160-52889182 ATTCTCCTGCCTCAGCCTCTCGG + Intergenic
1068441242 10:57057318-57057340 ATTCTCCTGCCTCAGCCTCTCGG - Intergenic
1068635016 10:59338990-59339012 ATGCTCTCTCCAAAGGCTCTGGG + Intronic
1069383947 10:67867303-67867325 ATTCTCCTGCCACAGCCTCCCGG + Intergenic
1069485711 10:68821746-68821768 ATTCTCCTGCCTCAGGCTCCCGG + Intergenic
1069508727 10:69024237-69024259 ATTCTCCTGCCTCAGCCTCTTGG + Intergenic
1069512276 10:69051351-69051373 ATGCTGCTGCTGAAGGCTCTGGG + Intergenic
1069770308 10:70894336-70894358 ATGCTTCTCCCAAGGGCTCTAGG + Intergenic
1069886825 10:71629030-71629052 TTGTTCCTGCCAGAGGCCCGTGG - Intronic
1071421699 10:85506488-85506510 GTGCTCCTTCTGGAGGCTCTAGG - Intergenic
1071713030 10:88068287-88068309 GTGCTCCTTCTAGAGGCTCAAGG + Intergenic
1072788950 10:98303629-98303651 ATGATCCTGTCAGATGCTCCAGG + Intergenic
1072937426 10:99726777-99726799 ATTCTCCTGCCTCAGCCTCTCGG - Intronic
1073243912 10:102075988-102076010 ATCCTCCTGCCTTAGCCTCTTGG - Intergenic
1073340449 10:102740351-102740373 ATCCTCCTGCCTCAGCCTCTGGG + Exonic
1073452840 10:103619747-103619769 CTGCTCCTGCAAAAGGTTCTTGG + Intronic
1074100600 10:110351888-110351910 ATGCTCCCTCCAAAGGATCTAGG - Intergenic
1074105511 10:110386705-110386727 ATTCTCCTGCCTCAGCCTCTGGG - Intergenic
1074125830 10:110528186-110528208 CTGCTCCTGCCATTTGCTCTGGG + Intergenic
1074311071 10:112323816-112323838 CTGCTCCCTCCAGAAGCTCTAGG - Intergenic
1074664621 10:115706150-115706172 AAGCCCCTGCTAGAGGCTGTAGG + Intronic
1075245485 10:120818506-120818528 GCGCTCCCTCCAGAGGCTCTAGG - Intergenic
1075318066 10:121467956-121467978 ATGCTCCTTCTGAAGGCTCTGGG - Intergenic
1076103734 10:127803627-127803649 AGGCTCCCTCCAAAGGCTCTAGG + Intergenic
1076318122 10:129557367-129557389 CTGCTTCTGCCCGAGACTCTGGG + Intronic
1076402329 10:130192392-130192414 ATGGTCCTAACAGAGGCTCCTGG + Intergenic
1076435108 10:130435222-130435244 ATGTTCCCACCAGAAGCTCTGGG - Intergenic
1076444311 10:130501494-130501516 ATGCTCCCTCTGGAGGCTCTAGG + Intergenic
1076899802 10:133332907-133332929 ATGCTCCCTCCAAAGCCTCTAGG - Intronic
1078441943 11:11375616-11375638 ATGGCCCTGCCAAAGGCTCTGGG - Intronic
1078916416 11:15782882-15782904 ACGCACCTTCCAGAGGTTCTGGG - Intergenic
1079001879 11:16764519-16764541 ATCCTCCTGCCTCAGTCTCTTGG - Intergenic
1079142455 11:17821154-17821176 ATGCTCCCTCTGGAGGCTCTAGG - Intronic
1079582177 11:22079384-22079406 ATGCTTGTTACAGAGGCTCTTGG - Intergenic
1081464200 11:43301213-43301235 ACGTTGCTTCCAGAGGCTCTGGG - Intergenic
1081941045 11:46942301-46942323 AAGCTTCTGCCAGAGGCTGAAGG + Intronic
1083050801 11:59774722-59774744 ATTCTCCTGCCTCAGCCTCTCGG - Intronic
1083479859 11:62936821-62936843 GTCCTCCTGCCAGAGACCCTTGG - Intronic
1083484926 11:62977223-62977245 GTCCTCCTGCCAGAGACCCTGGG - Exonic
1083730044 11:64647996-64648018 TTGCTGCTGCCTGAAGCTCTGGG - Intronic
1084137355 11:67195260-67195282 ATTCTCCTGCCTTAGCCTCTCGG - Intronic
1084190593 11:67497029-67497051 AAGCTCCTCCCAGTGGCTTTGGG + Intronic
1084245949 11:67857101-67857123 ATGCTCCTTTCAGAGGTTCTAGG - Intergenic
1084404313 11:68962168-68962190 GTGCTCCTTCCAGAGGCTGTAGG - Intergenic
1084423599 11:69072476-69072498 ATGCTCGTTACAGGGGCTCTTGG + Intronic
1084826727 11:71737405-71737427 ATGCTCCTTTCAGAGGTTCTAGG + Intergenic
1084958650 11:72704501-72704523 ATGCTCCTGCCACCAGCACTGGG + Intronic
1085019025 11:73193454-73193476 GGGCTCCTGGCAGAGGCTGTGGG - Intergenic
1085388950 11:76172464-76172486 ATGCTGTGGCCAGAGGCTCCAGG - Intergenic
1085424053 11:76387327-76387349 ATTCTCCTGCCTCAGCCTCTCGG - Intronic
1086974727 11:93118740-93118762 ATCCTCCTGCCTCAGGCACTAGG + Intergenic
1088156836 11:106815930-106815952 ATGCTATCTCCAGAGGCTCTGGG - Intronic
1088332340 11:108666594-108666616 TTGCTCCCTCCAGAGGTTCTAGG + Intronic
1088669573 11:112128232-112128254 ATTCTCCTGCCTCAGCCTCTGGG - Intronic
1088670679 11:112137551-112137573 ATTCTCCTGCCTCAGCCTCTCGG + Intronic
1089435891 11:118466221-118466243 ATGCTCCTGCCTTAGCCTCCTGG - Intronic
1089653542 11:119930993-119931015 ATGCTCCTTCCAAAGACTCTAGG + Intergenic
1089689858 11:120180582-120180604 AGGCTCCTGCCCCAAGCTCTGGG - Intronic
1089746706 11:120622729-120622751 GTGCTCCCGCCAAAGGCCCTAGG + Intronic
1090085044 11:123643084-123643106 GTTCTCTTGCCAGCGGCTCTGGG - Intronic
1090230910 11:125103054-125103076 GTGCTCCCTCCAAAGGCTCTAGG + Intronic
1090303426 11:125668658-125668680 ATTCTCCTGCCTTAGTCTCTGGG + Intronic
1090513414 11:127399266-127399288 ACCAGCCTGCCAGAGGCTCTGGG - Intergenic
1090693838 11:129216073-129216095 GTGCTCGCTCCAGAGGCTCTAGG - Intronic
1090912552 11:131134112-131134134 GTGCTCCTTCCAGAGGCTTTAGG + Intergenic
1091114452 11:133000161-133000183 ATTCTCCTGCCTCAGCCTCTTGG + Intronic
1091215543 11:133899205-133899227 AGGCTCCTGGCAGTGGCTGTGGG + Intergenic
1091272553 11:134327821-134327843 ATGCTCCTTCCTGAGGGCCTTGG + Intergenic
1091399274 12:172645-172667 AAGCACCTGCCAGAGGGGCTTGG - Intronic
1091508878 12:1101255-1101277 CTAGTCCTCCCAGAGGCTCTGGG - Intronic
1091652859 12:2322778-2322800 ATGCTCATGCAACAGGCTATGGG - Intronic
1091849356 12:3682887-3682909 ATTCTCCTGCCACAGCCTCCTGG + Intronic
1092062762 12:5564569-5564591 CTGCTGCTTCCAGAGGCTCCTGG + Intronic
1092128826 12:6094115-6094137 TTGCTCCTTCCAGAGGCTCTAGG - Intronic
1092364551 12:7866116-7866138 ATTCTCCTGCCACAGCCTCCTGG - Intronic
1092443151 12:8527376-8527398 AAACTCCAGCCAGAGGCTCGGGG - Intergenic
1092759848 12:11799870-11799892 ATCCTCCTGCCTTAGCCTCTGGG + Intronic
1092852782 12:12646234-12646256 ATGCTCCTGCCTCAGCCTCCTGG + Intergenic
1093025117 12:14238826-14238848 ATCCTCCTGCCTCAGCCTCTGGG + Intergenic
1093246789 12:16748522-16748544 ATGCTCCTTAAAGAGGCTCCAGG - Intergenic
1093533386 12:20194352-20194374 GTGCTCCCTCCAGAGGCTGTAGG + Intergenic
1093621264 12:21292700-21292722 ATTCTCCTGCCCTAGCCTCTGGG + Intronic
1095399904 12:41802020-41802042 ATGCTACCTCCGGAGGCTCTGGG - Intergenic
1095569622 12:43669571-43669593 ATGCTGCCTCCAGAGGCTCTAGG - Intergenic
1096657171 12:53098846-53098868 CTGCGCATCCCAGAGGCTCTGGG + Intronic
1097157689 12:57024935-57024957 ATCCTCCTGCCTCAGCCTCTGGG - Intronic
1097721761 12:63029530-63029552 ATTCTCCTGCCTCAGCCTCTAGG + Intergenic
1098006673 12:66004547-66004569 ATTCTCCTGCCTCAGCCTCTTGG - Intergenic
1098862038 12:75721059-75721081 GTCCTGCTGCCTGAGGCTCTTGG - Intergenic
1098932643 12:76438091-76438113 ATTCTCCTGCCTCAGCCTCTCGG + Intronic
1098965537 12:76783951-76783973 CTGCTCCCTCCAGAGGCTCTAGG - Intronic
1099199468 12:79658768-79658790 ATTCTCCTGCCTCAGCCTCTTGG + Intronic
1099913121 12:88858377-88858399 ATGCTCCTACCTGAGACTTTCGG + Intergenic
1100175212 12:92022664-92022686 ATGCTCCTGCCTCAGTCTCTCGG - Intronic
1100462934 12:94818748-94818770 ATTCTCCTGCCTCAGGCTCCCGG - Intergenic
1100930122 12:99598932-99598954 ACGCTCCCTCCAGAGGCTCTAGG + Intronic
1101258724 12:103007013-103007035 AGCCACCTGACAGAGGCTCTCGG - Intergenic
1101907785 12:108840424-108840446 ATTCTCCTGCCTCAGCCTCTTGG - Intronic
1102590548 12:113953379-113953401 ATTCTCCTGCCTCAGCCTCTCGG - Intronic
1102698447 12:114818011-114818033 ATGCCCCTGCCAGCTGCTCCAGG - Intergenic
1102935244 12:116891048-116891070 ATGCTCCCTCCAAAGGCCCTAGG - Intergenic
1103037787 12:117670568-117670590 ATGCTCAGGTCAGAGGCACTGGG + Intronic
1103041787 12:117701850-117701872 ATGCTCCTTCCGAAGGCTCTAGG - Intronic
1103166127 12:118772193-118772215 ACGCTCCCTCCAAAGGCTCTAGG - Intergenic
1103881792 12:124171998-124172020 CTGCTCCTTCTGGAGGCTCTAGG + Intronic
1103989683 12:124790486-124790508 TTGTTCCTTCCAGAGGCTCCAGG - Intronic
1104028084 12:125043747-125043769 ATTCTCCTGCCTCAGCCTCTGGG - Intergenic
1104052714 12:125206931-125206953 ATGCTTCTCGCAGAGGCTCCTGG + Intronic
1104056067 12:125231071-125231093 GTGCTCCCTCCGGAGGCTCTAGG + Intronic
1104288021 12:127443178-127443200 ACGTTTCTGCCGGAGGCTCTAGG - Intergenic
1104288070 12:127443485-127443507 ATGCTCCCTCCGAAGGCTCTAGG - Intergenic
1104467182 12:128999993-129000015 GTGCTCCCTTCAGAGGCTCTAGG + Intergenic
1104481437 12:129111296-129111318 ATACTCCTTCCAGAGGCTCTGGG - Intronic
1104493661 12:129216570-129216592 ATGCTCCCTCTGGAGGCTCTAGG - Intronic
1104587700 12:130060803-130060825 ATGCTCCCTGCAGAGGCTCTAGG - Intergenic
1104651208 12:130535405-130535427 ATCCTCCTGCCTCAGCCTCTTGG - Intronic
1104881142 12:132071411-132071433 CTGCTCCTACCAGAGGCTTCCGG + Intronic
1105423066 13:20270297-20270319 CTGCTTCTGCCAGCTGCTCTCGG + Intergenic
1105512651 13:21063208-21063230 ATCCTCCTGCCTCAGCCTCTAGG + Intergenic
1106029833 13:25990078-25990100 TTTCTCCTGCCAGAGGCTCCTGG - Intronic
1106049138 13:26174554-26174576 ATTCTCCTGCCTCAGCCTCTGGG - Intronic
1106166925 13:27255676-27255698 ATTCTCCTGCCTCAGCCTCTGGG + Intronic
1106179889 13:27361613-27361635 ATTCTCCTGCCTGAGCTTCTGGG + Intergenic
1106361477 13:29035349-29035371 GATCACCTGCCAGAGGCTCTGGG + Intronic
1106478538 13:30118751-30118773 ATGCTCCCTCCAGAGGCTCCAGG - Intergenic
1106813389 13:33381631-33381653 ATTCTCCTGCCTCAGGCTCCTGG - Intergenic
1107039784 13:35936664-35936686 AGTTTTCTGCCAGAGGCTCTCGG - Intronic
1107702878 13:43066284-43066306 GTGCCCCTTCCAGAGGCTCTGGG + Intronic
1107707159 13:43119474-43119496 ATGGTCCTGCCTGCAGCTCTTGG - Intergenic
1108497155 13:51036204-51036226 GTCCTCCTGGCAGAGGTTCTTGG - Intergenic
1108637934 13:52354464-52354486 ATTCTCCTGCCTCAGGCTCCTGG + Intergenic
1108647987 13:52449889-52449911 ATGCCCTTGCCAAAGGCTATTGG - Intronic
1110141268 13:72132227-72132249 ATCCTCCTGCCTCAGGCTCATGG - Intergenic
1110147829 13:72214353-72214375 ATGCTCTCTCCAAAGGCTCTAGG + Intergenic
1110897361 13:80771591-80771613 ATTCTCCTGCCTCAGCCTCTTGG - Intergenic
1111083244 13:83340098-83340120 ATGTTCATGCCACAGGCTCTAGG - Intergenic
1111367451 13:87268504-87268526 ATTCTCCTGCCTCAGCCTCTTGG + Intergenic
1111514218 13:89306712-89306734 ATGATCCCTCCAGAGGCTCTGGG + Intergenic
1111651562 13:91097073-91097095 ATTCTCCTGCCTCAGGCTCCTGG - Intergenic
1111867863 13:93792415-93792437 ATTCTCCTGCCTCAGCCTCTGGG + Intronic
1112364220 13:98742880-98742902 ATCCTCCCGCCTGAGCCTCTTGG + Intronic
1112366160 13:98757238-98757260 ATGCTCCCTCCAGAGGCTCTGGG + Intergenic
1114572105 14:23678346-23678368 GTGCTCTCTCCAGAGGCTCTGGG - Intergenic
1114582242 14:23772717-23772739 ATGCTGCAGCCTGAGGCACTTGG - Intergenic
1115209945 14:30957049-30957071 ATTCTCCTGCCTCAGGCTTTCGG - Intronic
1115538893 14:34400280-34400302 ATTCTCCTGCCTCAGCCTCTTGG - Intronic
1115671206 14:35613537-35613559 ATGCACCTTCCAAAGGTTCTAGG + Intronic
1115746673 14:36444842-36444864 ATTCTCCTGCCTCAGCCTCTCGG - Intergenic
1115987923 14:39121818-39121840 ATTCTCCTGCCTCAGCCTCTGGG + Intronic
1116455556 14:45117076-45117098 ATTCTCCTGCCACAGCCTCCAGG + Intronic
1117022342 14:51584255-51584277 ATTCTCCTGGCAGAGGCATTTGG + Intronic
1117058062 14:51933075-51933097 ATGCTCCTGCCAGAGGCTCTAGG - Intronic
1117291805 14:54341818-54341840 GTGCTCCTTCTGGAGGCTCTAGG - Intergenic
1118387728 14:65270287-65270309 ATCCTCCTGCCTCAGCCTCTTGG - Intergenic
1118530700 14:66702106-66702128 AAACTCCAGCCAGAGGCTCAGGG + Intronic
1118660553 14:68005158-68005180 ATTCTCCTGCCTCAGGCTCCTGG + Intronic
1119009861 14:70973144-70973166 ATCCTCCTGCCTCAGCCTCTTGG - Intronic
1119030312 14:71187213-71187235 ATGTTCCTTCTAGAGGCTCTAGG - Intergenic
1119042244 14:71285554-71285576 AGGCTCCCTCCAGAGGTTCTAGG + Intergenic
1119165325 14:72487700-72487722 ATGTTCCTTCTGGAGGCTCTAGG - Intronic
1119319269 14:73719754-73719776 ATGCGCCTGACAGGGGATCTTGG + Intronic
1119561413 14:75592845-75592867 TTTCTCCTGCCAGATGCCCTAGG + Intronic
1119689588 14:76661103-76661125 ATGATCCCTCCAGAGACTCTAGG + Intergenic
1120078328 14:80186060-80186082 ATTCTCCTGCCTCAGCCTCTGGG - Intergenic
1120245711 14:82003781-82003803 ATGCTCCTGTCTGTGGCTTTGGG + Intergenic
1120978115 14:90267234-90267256 ATTCTCCTGCCTTAGCCTCTCGG + Intronic
1121171140 14:91855364-91855386 ATGCTCCCTCCAGAGGCTCTAGG + Intronic
1121245677 14:92459484-92459506 TTCCTCAAGCCAGAGGCTCTAGG + Intronic
1121249912 14:92491836-92491858 CAGTTCCAGCCAGAGGCTCTAGG + Intronic
1121913115 14:97810425-97810447 GTGCTCCCTCCAGAGGCTCTTGG + Intergenic
1122240000 14:100357566-100357588 ATTCTCCTGCCTTAGCCTCTTGG + Intronic
1122294930 14:100700078-100700100 GTGCTCTCTCCAGAGGCTCTAGG - Intergenic
1122557154 14:102587187-102587209 ATGCTCCTGCCTCAGCCTCCAGG + Intergenic
1122895578 14:104755124-104755146 GTGCTCTGGCCAGAGGCTGTAGG + Intronic
1123457899 15:20442735-20442757 ATGCTTCTTCCACAGGCTCTAGG - Intergenic
1123660170 15:22557674-22557696 ATGCTTCTTCCACAGGCTCTAGG + Intergenic
1124050897 15:26196857-26196879 ATTCTCCCTCCAGAGGCTCCAGG - Intergenic
1124264047 15:28217888-28217910 ATGCTTCTTCCACAGGCTCTAGG - Intronic
1124314029 15:28652169-28652191 ATGCTTCTTCCACAGGCTCTAGG + Intergenic
1124333028 15:28836727-28836749 ATTCTCCTGCCTCAGCCTCTCGG + Intergenic
1124627331 15:31315777-31315799 ATGCTCCTGCCATCGAGTCTGGG - Intergenic
1124865440 15:33486267-33486289 ATGCTCCTTCCAAAGTCTCTAGG + Intronic
1125538763 15:40457904-40457926 ATTCTCCTGCCTCAGCCTCTCGG - Intronic
1125555830 15:40583886-40583908 ATTCTCCTGCCTCAGCCTCTCGG + Intergenic
1125809040 15:42520599-42520621 ATTCTCCTGCCTCAGCCTCTCGG + Intronic
1126033312 15:44522138-44522160 ATCCTCCTGCCTCAGCCTCTTGG + Intronic
1126075051 15:44901011-44901033 GAGCTCCCTCCAGAGGCTCTAGG + Intergenic
1126083313 15:44986810-44986832 GAGCTCCCTCCAGAGGCTCTAGG - Intergenic
1126142084 15:45447040-45447062 ATGCTCCTGCCTCAGCCTCCTGG + Intronic
1126147406 15:45488958-45488980 ATTCCCCTACCAGAGGTTCTGGG - Exonic
1126348362 15:47718838-47718860 ATGCCCCTGCCAGCGGCTGCCGG - Exonic
1126451671 15:48815236-48815258 ATGCTCCCTCCAAAGGCTCTAGG - Intergenic
1126811521 15:52410691-52410713 ATTCTCCTGCCTCAGCCTCTGGG + Intronic
1126910726 15:53414681-53414703 GTGCTCCCTCCGGAGGCTCTAGG + Intergenic
1127067282 15:55253338-55253360 ATTCTCCTGCCTTAGCCTCTGGG - Intronic
1127658301 15:61076127-61076149 ATGCTCCTGTCAGAGAATCACGG - Intronic
1127681669 15:61303838-61303860 TTGCTCCTGCCAGAAACCCTTGG + Intergenic
1127699434 15:61483795-61483817 ACGCTCCCTCCAGAGGCTCCAGG - Intergenic
1127811486 15:62568998-62569020 ATGCTCCCTCCAAAGGCTCTGGG + Intronic
1127953010 15:63828444-63828466 ATTCTCCTGCCTCAGACTCTTGG + Intronic
1128879298 15:71228361-71228383 ATGCTCCTTTCAGAGGCTCTGGG - Intronic
1129065558 15:72901174-72901196 GTCCTCCTGCCTCAGGCTCTTGG - Intergenic
1129125600 15:73438253-73438275 ATTCTCCTGCCTCAGCCTCTGGG - Intergenic
1129181984 15:73883402-73883424 TGGCTCCTTCCAAAGGCTCTAGG + Intronic
1129187934 15:73921982-73922004 ATCCTCCTGCCTCAGCCTCTGGG - Intergenic
1129280915 15:74484320-74484342 ATCCTCCTGCCACAGCCTCCTGG - Intergenic
1129523570 15:76200503-76200525 CTCCTCCTGCAAGTGGCTCTTGG + Intronic
1129663248 15:77565051-77565073 TGGCTGCTGCCAGAGGCTCTGGG - Intergenic
1129923838 15:79344396-79344418 TGGCTCCTTCCAGATGCTCTGGG + Intronic
1130284303 15:82542309-82542331 ATTCTCCTGCCTGAGCCTCTTGG + Intronic
1130330748 15:82920456-82920478 ATGCTGCCTCCAGAGGCTCTAGG + Intronic
1130545980 15:84857902-84857924 TTGCTGCTGCCCGAGGCTCCTGG + Exonic
1130938110 15:88487257-88487279 ATGCTTCCTTCAGAGGCTCTAGG - Intergenic
1131048310 15:89330144-89330166 CTGCTCCTGCCAGTCTCTCTGGG + Exonic
1132534826 16:473007-473029 TGGCTCCTGCCTAAGGCTCTCGG - Intronic
1133271394 16:4612489-4612511 CTGCTGCTGACAGAGGGTCTTGG - Intronic
1133388666 16:5391315-5391337 ATGTTCCTCCTAGAGGCTTTAGG + Intergenic
1134058464 16:11184532-11184554 TAGCACCTGCCACAGGCTCTGGG + Intergenic
1134077489 16:11302166-11302188 TGGTTCCTCCCAGAGGCTCTAGG + Intronic
1134123233 16:11599223-11599245 ATTCTCCTGCCTCAGCCTCTGGG + Intronic
1134315787 16:13117676-13117698 ATGCCCCTTCCCAAGGCTCTAGG - Intronic
1134475082 16:14566447-14566469 GAGCTCCCTCCAGAGGCTCTGGG - Intronic
1135179307 16:20259086-20259108 GTGCTCCCTCCAGAGGCTCCAGG + Intergenic
1135527022 16:23221381-23221403 GTGCTCCCTCCAGAGGCTCTAGG + Intergenic
1135615415 16:23907380-23907402 ATCCTCCTGCCTCAGCCTCTGGG + Intronic
1135760522 16:25134446-25134468 ATCCTGCAGCCAGAGGCTCTGGG + Intronic
1136271888 16:29153501-29153523 ATACTCCCTCCAGAGGCTCTGGG + Intergenic
1136271987 16:29153807-29153829 ATACTCCTTCCAGAGGCTCTGGG + Intergenic
1136297806 16:29313594-29313616 CTGCTCTTGACAGAGGCTCACGG - Intergenic
1136625800 16:31461612-31461634 ATTCTCCTGCCACAGCCTCCCGG + Intronic
1136641652 16:31569903-31569925 ATTCTCCTGCCTCAGCCTCTTGG + Intergenic
1136702379 16:32156136-32156158 ATGCTCCCTCCACAGGCTCTAGG - Intergenic
1136765288 16:32771352-32771374 ATGCTCCCTCCACAGGCTCTAGG + Intergenic
1136802811 16:33099032-33099054 ATGCTCCCTCCACAGGCTCTAGG - Intergenic
1137737411 16:50735281-50735303 ATGCTGCTTGCAGAGGTTCTAGG - Intergenic
1137801412 16:51265545-51265567 ATAGTCCCTCCAGAGGCTCTAGG + Intergenic
1138211459 16:55166666-55166688 ATGATCCTCTAAGAGGCTCTAGG - Intergenic
1138237985 16:55401594-55401616 ATACTCCTGCCTCAGGGTCTTGG + Intronic
1138600873 16:58053280-58053302 ATTCTCCTGCCTCAGCCTCTGGG + Intergenic
1138825191 16:60310191-60310213 ATGTTCCTTCTAGAGGCTGTAGG - Intergenic
1139064135 16:63291582-63291604 ATTCTCCTGCCTCAGCCTCTGGG - Intergenic
1139254363 16:65527161-65527183 ATTCTCCTCCCCAAGGCTCTAGG - Intergenic
1139429878 16:66905386-66905408 AGGCCCCTTCCAGAGGCACTGGG - Intergenic
1140407326 16:74719397-74719419 ATCCTCCTTACAGAGGCTGTGGG + Intronic
1140408876 16:74729381-74729403 ATCCTCCTGCCTCAGCCTCTTGG + Intronic
1140511427 16:75511441-75511463 ATGTTCCTTCTAGAGGCTCTAGG - Intergenic
1140719693 16:77760255-77760277 GTGCTCCCTCCGGAGGCTCTGGG + Intergenic
1140721333 16:77775023-77775045 ATGCTCCTGTTAGGGGCTTTGGG - Intergenic
1140740164 16:77934484-77934506 ATGTTCCTTCTGGAGGCTCTAGG - Intronic
1141159265 16:81618228-81618250 ATGTTCCTTCTGGAGGCTCTCGG + Intronic
1141192659 16:81835774-81835796 GTGCTCCCGCTGGAGGCTCTAGG + Intronic
1141222096 16:82080519-82080541 ATGCTCCTTCTGGAGGCTCTAGG - Intronic
1141223040 16:82089649-82089671 GTGCTCCTTCTCGAGGCTCTGGG + Intronic
1141240304 16:82259760-82259782 ATGCTTCCTCCAAAGGCTCTGGG + Intergenic
1141406056 16:83794100-83794122 GTGCTCCTTCTGGAGGCTCTAGG - Intronic
1141584291 16:85023065-85023087 GTGTTCCTTTCAGAGGCTCTAGG - Intergenic
1141820927 16:86445074-86445096 ATGTTCCTGCCAATGGCTTTAGG + Intergenic
1142059398 16:88019794-88019816 CTGCTCCTGACAGAGGCTCACGG - Intronic
1142075584 16:88115759-88115781 ATACTCCCTCCGGAGGCTCTGGG + Intronic
1142075591 16:88115793-88115815 GTATTCCTTCCAGAGGCTCTGGG + Intronic
1142161327 16:88559097-88559119 TTGCTCCTCCCAAAGGCGCTGGG - Intergenic
1203067676 16_KI270728v1_random:1033585-1033607 ATGCTCCCTCCACAGGCTCTAGG + Intergenic
1142784968 17:2214059-2214081 ATGTTCCTGCTAGTGACTCTAGG - Intronic
1142791409 17:2269111-2269133 ATTCTCCTGCCGCAGCCTCTCGG - Intronic
1142887482 17:2921774-2921796 ATGTTCCCGCCAGAGGCTCGAGG + Intronic
1142889886 17:2936384-2936406 ATGACCCTGCCAGGGGCTGTGGG + Intronic
1142993721 17:3748755-3748777 GTGTTCCTGCCACAGGCCCTTGG - Intronic
1143248700 17:5506175-5506197 ATTCTCCTGCCTCAGCCTCTCGG - Intronic
1143336120 17:6172825-6172847 ATGCTCCTGCCAGCTTCACTGGG - Intergenic
1143519859 17:7438968-7438990 ATTATCCAGCCAGAGGGTCTGGG + Intronic
1143885992 17:10065424-10065446 ATACTCCTCCCAGAGGGTCAAGG + Intronic
1143948723 17:10616549-10616571 ATCCTCCTGCCTCAGCCTCTGGG - Intergenic
1144095603 17:11897940-11897962 GTGCTCCCTCCAGAGGCTCTAGG + Intronic
1144592227 17:16534362-16534384 ATGCTCCCTCCAAAGGCTCTAGG + Intergenic
1144739728 17:17575115-17575137 GTGCTTCCACCAGAGGCTCTGGG + Intronic
1145191176 17:20842934-20842956 ACTCTCCTCCCACAGGCTCTAGG - Intronic
1145817873 17:27808600-27808622 ATGCTCCTCCCAGAAGCATTTGG - Intronic
1146026866 17:29329237-29329259 ATCCTCCTGCCTCAGCCTCTGGG - Intergenic
1146040312 17:29447155-29447177 ATTCTCCTGCCTGAGCCTCCTGG + Intronic
1146149950 17:30458757-30458779 ATTCTCCTGCCACAGCCTCCCGG - Intronic
1146192755 17:30784863-30784885 GTTCTCCTGCCTGAGCCTCTCGG + Intronic
1146406099 17:32539508-32539530 ATGTTCCCTCCAGAGCCTCTAGG + Intronic
1147199796 17:38793033-38793055 ATTCTCCTGCCTCAGCCTCTTGG + Intronic
1147311459 17:39598377-39598399 CTGCCCCTGCCAGCGGCTGTGGG + Intergenic
1147712659 17:42481026-42481048 ATTCTCCTGCCTCAGCCTCTAGG + Intronic
1147840067 17:43365063-43365085 ATTCTCCTGCCTCAGGCTCCTGG + Intergenic
1147935371 17:44007684-44007706 AGGCTCCGGCCAGATGCTGTGGG + Exonic
1148068323 17:44890112-44890134 ATTCTCCTGCCTTAGCCTCTGGG + Intronic
1148090139 17:45018540-45018562 CAGCCCCTGCCAGAGACTCTGGG + Intergenic
1148353549 17:46958501-46958523 ATCCTACTTCCAGTGGCTCTTGG - Intronic
1148559095 17:48595944-48595966 GTGCTCCTTCCAGTGGCTTTGGG + Exonic
1148893924 17:50829013-50829035 ACGCTCCCTCCAGAGGCTTTAGG + Intergenic
1149716078 17:58791678-58791700 ATTTTCCTGCCAGAGGTTATAGG + Intronic
1149948277 17:60955492-60955514 ATTCTCCTGCCTCAGCCTCTGGG + Intronic
1150069657 17:62140093-62140115 CTGCTCCTCCCAGGGGCTCTCGG + Intergenic
1150103387 17:62443505-62443527 ATCCTCCTGCCTCAGTCTCTAGG - Intronic
1150154914 17:62844859-62844881 ATTCTCCTGCCTCAGCCTCTGGG - Intergenic
1150419634 17:65020755-65020777 ATTCTCCTGCCTCAGCCTCTGGG + Intronic
1150751268 17:67864909-67864931 ATTCTCCTGCCTCAGGCTCCCGG + Intronic
1150789387 17:68189428-68189450 ATTCTCCTGCCTGAGCCTCCCGG + Intergenic
1150837763 17:68579937-68579959 ATGCCTCTGCCACAGCCTCTTGG + Intronic
1150921879 17:69492570-69492592 AGGCTCCCTCCAGAGGCTCTGGG + Intronic
1151271823 17:73002805-73002827 ATGCTCCCTCTGGAGGCTCTAGG + Intronic
1151390353 17:73782888-73782910 ATCCTGCTTCCAGAGGCTGTGGG - Intergenic
1151400949 17:73855681-73855703 ACGTGCCTTCCAGAGGCTCTAGG - Intergenic
1151648493 17:75450585-75450607 ATTCTCCTGCCTGAGCCTCCTGG + Intronic
1151854727 17:76712632-76712654 ATCCTCCTGCCTTAGCCTCTTGG + Intergenic
1151874479 17:76859089-76859111 GCGTTCCTTCCAGAGGCTCTAGG + Intergenic
1151889232 17:76942418-76942440 ATTCTCCTGCCTCAGCCTCTTGG - Intronic
1151912085 17:77090183-77090205 ATTCTCCTGCCTCAGCCTCTTGG - Intronic
1152000529 17:77642474-77642496 GTGCTCCTGGCAGAGGCCCTAGG + Intergenic
1152094465 17:78265127-78265149 ATCCTCCTGCCTCAGCCTCTAGG + Intergenic
1152482224 17:80562127-80562149 ATTCTGCTTCCAGGGGCTCTTGG - Intronic
1152608794 17:81305753-81305775 CTGCTGCCCCCAGAGGCTCTGGG - Intergenic
1152832411 17:82505999-82506021 ATTCTCCTGCCTCAGCCTCTGGG + Intergenic
1153619335 18:6962303-6962325 ATCCTCCTGCCTCAGTCTCTGGG - Intronic
1153685934 18:7545401-7545423 ACGCTCCCTCCAGGGGCTCTAGG + Intergenic
1154247636 18:12713865-12713887 ATCCTCCTGCCTCAGCCTCTGGG + Intronic
1155136881 18:23004596-23004618 ATCCTCCTGCCTCAGCCTCTTGG - Intronic
1155189182 18:23414146-23414168 ATTCTCCTGCCTCAGCCTCTTGG - Intronic
1155348191 18:24879400-24879422 CAGCTCCTGTCACAGGCTCTAGG - Intergenic
1155472308 18:26203951-26203973 ATGCTCCTGCCCCAGGGCCTTGG + Intergenic
1155751452 18:29427682-29427704 ATCCTCCTGCCTCAGCCTCTGGG + Intergenic
1156011207 18:32500005-32500027 ATTCTCCTGCCTCAGCCTCTTGG - Intergenic
1156737462 18:40277894-40277916 ATGCTCCCTCCAAAGCCTCTGGG - Intergenic
1156865100 18:41880159-41880181 ATCCTCCTGCCTCAGCCTCTAGG - Intergenic
1157888047 18:51387926-51387948 GTGCTCCCTCCAAAGGCTCTAGG + Intergenic
1157900817 18:51515026-51515048 GTGTTCCTGCTAGAGGCTCTGGG - Intergenic
1157976522 18:52333991-52334013 GTGCTCCTTCTAGAGGCTCCAGG + Intergenic
1158283070 18:55849036-55849058 ATTCTCCTGCCTCAGCCTCTTGG - Intergenic
1158444403 18:57506714-57506736 AGGTACCTGCCAGTGGCTCTAGG - Intergenic
1158513835 18:58114731-58114753 GTGTTCCTCCCGGAGGCTCTAGG + Intronic
1158711205 18:59839721-59839743 ATGCACCAGCCACAGGTTCTAGG + Intergenic
1158774303 18:60557670-60557692 GTGCTCCTTCCGAAGGCTCTTGG + Intergenic
1158868285 18:61659169-61659191 GTGCTCCTTCTGGAGGCTCTAGG - Intergenic
1159252387 18:65896471-65896493 TTCCTGCTGCCAGAGGTTCTAGG - Intergenic
1159925219 18:74263039-74263061 ATCCTCCTGCCTCAGCCTCTTGG - Intronic
1160243131 18:77137032-77137054 GTGCTCCTGCCAGGGGCTGCAGG - Intergenic
1160299678 18:77668527-77668549 ACGCTCCCGCCAGAGGCGCTGGG - Intergenic
1160408546 18:78659570-78659592 TGGCTCTTGCCAAAGGCTCTTGG - Intergenic
1160463280 18:79055424-79055446 ATGCTCCTTTCCCAGGCTCTAGG + Intergenic
1160728527 19:629792-629814 CTGCTCCTCCCAGGGGCTCTCGG + Exonic
1160798898 19:958319-958341 ATTCTCCTGCCTCAGCCTCTTGG - Intronic
1160993975 19:1873402-1873424 ATGCTCCAGCCACTGGCCCTGGG + Intergenic
1161134683 19:2612797-2612819 ATTCTCCTGCCTGAGCCTCCTGG + Intronic
1161256715 19:3313926-3313948 ATTCTCCTGCCACAGCCTCCCGG - Intergenic
1161277703 19:3428061-3428083 ATTCTCCTGCCTCAGCCTCTCGG - Intronic
1161480389 19:4507439-4507461 ATCCTCCTGCCTCAGCCTCTGGG - Intronic
1161654170 19:5503481-5503503 ATGCTCCCTCCAAAGGCTCTAGG + Intergenic
1161917327 19:7238512-7238534 ATTCTCCTGCCTCAGCCTCTCGG - Intronic
1161929098 19:7324097-7324119 ATGCTTCTGCCTCAGCCTCTTGG - Intergenic
1162147044 19:8619075-8619097 ATCCTCCTGCCTCAGCCTCTTGG + Intergenic
1162224585 19:9209759-9209781 ATTCTCCTGCCTCAGCCTCTTGG + Intergenic
1162457785 19:10796341-10796363 ATGCTCCTGCCCCAGCCTCTGGG - Intronic
1162522327 19:11188999-11189021 ATGCTCCTTTGAGAGGCTATAGG + Intronic
1162661194 19:12170262-12170284 ATGCTGCTGTCTGAGGCTGTGGG + Intronic
1162987987 19:14284073-14284095 ACGCTCCCCACAGAGGCTCTAGG + Intergenic
1163047839 19:14657868-14657890 ATTCTCCTGCCTCAGCCTCTGGG + Intronic
1163272976 19:16265406-16265428 ATGGTCCTGCCTCAGGGTCTTGG - Intergenic
1163311571 19:16518168-16518190 CTGCTCCTGCCAGAAGCTGGTGG - Exonic
1163339019 19:16692370-16692392 ATTCTCCTGCCTCAGCCTCTGGG + Intergenic
1163366175 19:16877248-16877270 GTGCTCCTGCCAAAGGCTCTGGG + Intronic
1163472716 19:17506649-17506671 ATTCTCCTGCCCCAGCCTCTGGG - Intergenic
1163682564 19:18691675-18691697 ATGCTTCCTCCAGAGGCTCTAGG - Intronic
1163724868 19:18917032-18917054 ACACTCCTTCCAAAGGCTCTAGG + Intronic
1164450016 19:28352443-28352465 ATGCCACTGCCACAGGCCCTGGG + Intergenic
1164605933 19:29598146-29598168 ATCCTCCATCCAGAGGCTCACGG + Intergenic
1165291776 19:34891422-34891444 ATGCTACTGGCAGAGGACCTGGG + Intergenic
1165564765 19:36715265-36715287 ATTCTCCTGCCTCAGCCTCTGGG + Intronic
1165880029 19:39035887-39035909 ATCCTCCTGCCTTAGCCTCTGGG + Intergenic
1166521398 19:43482642-43482664 ATTCTCCTGCCTCAGCCTCTCGG + Intronic
1166949942 19:46420325-46420347 GAGCTCCTTCCAGAGGCTCCAGG - Intergenic
1166971916 19:46574596-46574618 GTGCTCCTTCTGGAGGCTCTAGG + Intronic
1167165149 19:47794201-47794223 ATTCTCCTGCCTCAGCCTCTCGG + Intergenic
1167191165 19:47991267-47991289 ATGCTCCTGTCAGACACTCGTGG + Intronic
1167370897 19:49081196-49081218 ATTCTCCTGCCACAGCCTCCTGG - Intergenic
1167548804 19:50145330-50145352 ATGCTCCCTCCAGAGGCTCCAGG - Intergenic
1167626683 19:50594713-50594735 ATTCTCCTGCCTCAGCCTCTAGG + Intergenic
1168039256 19:53744842-53744864 ATTCTCCTGCCTCAGCCTCTGGG - Intergenic
1168057720 19:53872749-53872771 ATCCTCCTGCCTCAGCCTCTTGG + Intronic
925264807 2:2559571-2559593 ATGCTCCTGGAAGAGGTACTTGG - Intergenic
925491598 2:4401100-4401122 ATGCTCCCTCTAAAGGCTCTAGG - Intergenic
925929734 2:8697384-8697406 GTGCTCCTCCTGGAGGCTCTAGG - Intergenic
926349929 2:11985169-11985191 GTGCTCCCTCCAGAGGTTCTAGG + Intergenic
926757000 2:16244433-16244455 CTGCTCCTGCCAGTGACTCATGG + Intergenic
926763325 2:16299176-16299198 TTGTTCCTTCCAGAGGATCTAGG - Intergenic
926764660 2:16313768-16313790 GGGCTCCCTCCAGAGGCTCTAGG + Intergenic
926875145 2:17467734-17467756 ATTCTCCTGCCTCAGCCTCTTGG - Intergenic
927898420 2:26800988-26801010 ATTCTCCTGCCTCAGCCTCTCGG + Intronic
928246661 2:29635526-29635548 ATTCTCCCTCAAGAGGCTCTCGG - Intronic
928678944 2:33679650-33679672 ATTCTCCTGCCTCAGCCTCTTGG + Intergenic
928956424 2:36873834-36873856 ATTCTCCTGCCTCAGCCTCTCGG - Intronic
929029546 2:37637679-37637701 GTACTCCCTCCAGAGGCTCTAGG + Intergenic
929044903 2:37779871-37779893 CTGGCCCTGCCACAGGCTCTGGG - Intergenic
929178846 2:39011000-39011022 ATTCTCCTGCCTGAGCCTCTTGG + Intronic
929612458 2:43281546-43281568 ATTCTCCTGCCTGAGCCTCCCGG + Intronic
930647547 2:53927838-53927860 ATTCTCCTGCCTCAGCCTCTTGG - Intronic
931816166 2:65903066-65903088 ATTCTCCTGCCTCAGCCTCTCGG + Intergenic
932412356 2:71554898-71554920 ATGGTCCTGGCAGTGGCTGTAGG + Intronic
932756610 2:74414231-74414253 TTACTACTGCCAGAGGCTCAGGG + Exonic
933190508 2:79328849-79328871 AAGCTCCCTCCAGAGGCTCAAGG + Intronic
933992641 2:87644446-87644468 ATGGTCCTGCCAGGGGCTGGGGG - Intergenic
934121585 2:88845505-88845527 ATGCTTCTGTCATGGGCTCTAGG + Intergenic
935245523 2:101215869-101215891 ATCCTCCTGCCTCAGCCTCTGGG - Intronic
935586489 2:104804328-104804350 GTGCTCCCTCCAGAGGCTCTAGG + Intergenic
935685066 2:105675797-105675819 TTTCTCCTGTCAGAGGCTGTTGG + Intergenic
935966297 2:108479873-108479895 ATTCTCCTGCCTCAGCCTCTGGG - Intronic
936301212 2:111306395-111306417 ATGGTCCTGCCAGGGGCTGGGGG + Intergenic
937017981 2:118623672-118623694 ATGCTCCCTCGGGAGGCTCTAGG + Intergenic
937431533 2:121842815-121842837 GTGTTCCTTCTAGAGGCTCTAGG - Intergenic
937898869 2:127000784-127000806 ATGCTCCCTCCAAAGGCTCTAGG + Intergenic
938113198 2:128583729-128583751 TGGTTCCTTCCAGAGGCTCTGGG + Intergenic
938571849 2:132568597-132568619 ATTCTCCTGCCTCAGGCTCCTGG - Intronic
938620968 2:133052609-133052631 ATTCTCCTGCCTGAGTCTCTTGG - Intronic
938672424 2:133598862-133598884 ATGCTCCTACTGAAGGCTCTAGG + Intergenic
938738338 2:134206838-134206860 GTGCTCCCTCCAGAGGCTCTAGG - Intronic
938960238 2:136334312-136334334 GTGTTCCCTCCAGAGGCTCTAGG + Intergenic
938960508 2:136336341-136336363 CTGCTGCTGCAAGAGGCGCTGGG - Intergenic
939808993 2:146808328-146808350 AAACTCCAGCCAGAGGCTCACGG + Intergenic
939884515 2:147666299-147666321 ATTCTCCTGCCTCAGCCTCTTGG - Intergenic
939886538 2:147686985-147687007 ATGCTCTCTCCAAAGGCTCTAGG - Intergenic
940162297 2:150726450-150726472 ATGCTGCTTCCAGAGGGTCATGG + Intergenic
940319188 2:152357762-152357784 ATGTTGCAACCAGAGGCTCTGGG + Intronic
940781653 2:157939783-157939805 ATGCTCCCCCTAAAGGCTCTAGG - Intronic
940783179 2:157954698-157954720 ATTCTCCTGCCCCAGCCTCTCGG - Intronic
940882120 2:158957188-158957210 ATCCTCCCTCCAGAGGCTCTGGG - Intergenic
941063803 2:160878286-160878308 ATGGTCCTTCTAGAGGGTCTAGG + Intergenic
941648353 2:168066460-168066482 ATTAACCAGCCAGAGGCTCTGGG + Intronic
941720991 2:168812721-168812743 ATGGTGGTGCCAGAGGATCTAGG - Intronic
942176442 2:173339181-173339203 GTGCTCCCTCCACAGGCTCTAGG - Intergenic
942291841 2:174480874-174480896 ATCCTCCTGCCTCAGCCTCTTGG + Intronic
942889167 2:180965832-180965854 ATGCTCTTCCCAGAAGCTCTAGG - Intergenic
943763131 2:191631566-191631588 ATGCCCATGGCTGAGGCTCTTGG + Intergenic
944135216 2:196391792-196391814 ATCCTCCCTCCAAAGGCTCTAGG + Intronic
944738813 2:202591879-202591901 ATTCTCCTGCCTCAGCCTCTCGG - Intergenic
945060883 2:205907808-205907830 ATACTCCCTCCAAAGGCTCTGGG + Intergenic
945292910 2:208143607-208143629 ATTCTCCTGCCTGAGCCTCCCGG + Intronic
945451838 2:210002930-210002952 CTGCTCCTGCTAGAGCCTCCAGG - Intronic
945529286 2:210930597-210930619 AAGCTCCTTCCAGTGGATCTAGG + Intergenic
945792804 2:214326344-214326366 ATGCTCCCTTCAGAGGCTCTAGG - Intronic
947945114 2:234094376-234094398 ATGCTCCCTCCCGAGACTCTAGG - Intergenic
948265902 2:236635171-236635193 CTGCTCCCTCCAGGGGCTCTAGG - Intergenic
948552654 2:238784754-238784776 AGGCTCCATCCAGAGCCTCTTGG - Intergenic
948759387 2:240181200-240181222 ATGCTCCCTCCAGCGGCTCTAGG + Intergenic
948794893 2:240397475-240397497 GTGCTCCTGGCAGACCCTCTAGG + Intergenic
948906630 2:240982774-240982796 ACGGTCCTGCCAGACGGTCTAGG + Intronic
948944984 2:241214949-241214971 CTGCTACTGCCAGGTGCTCTGGG - Intronic
1168955385 20:1830707-1830729 GTGCTCCTGCCAGTGTCTCCTGG - Intergenic
1169074861 20:2754291-2754313 CTGCCCCAGCCAGAGGCTCAGGG + Intronic
1169271298 20:4201480-4201502 ATTCTCCTGCCTTAGCCTCTGGG + Intergenic
1169519459 20:6355533-6355555 TTGTTCCTGCCAGAGGCTGTAGG - Intergenic
1169578265 20:6990432-6990454 ACCCTCCTTCCGGAGGCTCTGGG - Intergenic
1169729531 20:8771986-8772008 ATCCTCCTGCCACAGACTCCCGG + Intronic
1169813820 20:9635531-9635553 TTGTTCCTGCCACAGGGTCTTGG + Intronic
1169886081 20:10399188-10399210 ATGCTCCCTCCGGAGGCTCTAGG - Intergenic
1170037893 20:12009288-12009310 ATGCTTGTGCTGGAGGCTCTAGG + Intergenic
1170344367 20:15367132-15367154 ATTCTCCTGCCACAGCCTCCTGG + Intronic
1170402418 20:16002655-16002677 ATGTTCCTTCTTGAGGCTCTGGG - Intronic
1170863850 20:20135214-20135236 ATGCTCACTCCAGAGGCTCTAGG - Intronic
1170879281 20:20280334-20280356 ATGCTCCCTCCAGAGGCTCTAGG - Intronic
1171880116 20:30612369-30612391 ATGCCTGTGCCAGAGGCTCATGG - Intergenic
1172084855 20:32373268-32373290 ATTCTCCTGCCTCAGCCTCTTGG - Intronic
1172205106 20:33157745-33157767 ATCCTCCTGCCTCAGGCTCCTGG - Intergenic
1173003956 20:39125456-39125478 ATGCTCCACCTGGAGGCTCTAGG + Intergenic
1173251925 20:41368181-41368203 ATGCCCCCTCCAGTGGCTCTGGG + Intergenic
1174186863 20:48712350-48712372 ATTCTCCAGCCTGAGGCCCTGGG + Intronic
1174326238 20:49781128-49781150 ATTCTCCTGCCTCAGGCTCCTGG + Intergenic
1174383706 20:50173722-50173744 ATTCTCCTGCCTCAGCCTCTTGG + Intergenic
1174457879 20:50662424-50662446 ACTCTCCAGCCAGTGGCTCTGGG - Intronic
1174728873 20:52894572-52894594 ATGTTCCTTCCAAAGGCTCTAGG - Intergenic
1175132141 20:56797351-56797373 ATGTTCCTCCTGGAGGCTCTAGG + Intergenic
1175341818 20:58236759-58236781 ATGCTCCTGCTCGCGGCTCTTGG + Intergenic
1175783298 20:61697034-61697056 ATGCTCCCTCCGAAGGCTCTAGG - Intronic
1175997946 20:62819747-62819769 CTGCTGTAGCCAGAGGCTCTGGG - Intronic
1177388780 21:20440611-20440633 ATGCTTCTTCCAAAGGCTCCGGG - Intergenic
1177545857 21:22558623-22558645 ATTCTCCTGCCTCAGGCTCCTGG + Intergenic
1177552447 21:22643034-22643056 ATGCTCTTGTCAGTGCCTCTAGG - Intergenic
1177582945 21:23051251-23051273 ATGTTCCTTCTGGAGGCTCTAGG - Intergenic
1177598212 21:23274797-23274819 ATTCTCCTGCCTCAGCCTCTAGG - Intergenic
1177653366 21:23985768-23985790 ATGCTCCTTCCAGAGGCTCTAGG + Intergenic
1177725393 21:24960364-24960386 ATTCTCCTGCCTCAGCCTCTGGG + Intergenic
1178164787 21:29961611-29961633 ATGCTCCCTCCAGAGCCTGTAGG + Intergenic
1178278397 21:31259502-31259524 ATCCTCCTGCCTCAGCCTCTTGG - Intronic
1178357347 21:31920039-31920061 ACGCTCCCTCCAGAGACTCTAGG + Intronic
1178454073 21:32730493-32730515 ATGCTCCTTCCAAAGGCTCTAGG - Intergenic
1178533415 21:33393505-33393527 GTGGTCCTTCCAGAGGCTCTGGG - Intergenic
1178804121 21:35824248-35824270 GTGTTCCTTCTAGAGGCTCTGGG - Intronic
1178897172 21:36568476-36568498 ATCCCCATGCCAGGGGCTCTAGG - Intronic
1178904540 21:36625483-36625505 ATTCTCCTGCCTCAGCCTCTCGG - Intergenic
1179003362 21:37484433-37484455 ATTCTCCTGCCTCAGCCTCTTGG + Intronic
1180044661 21:45299675-45299697 GTGCTCCTGCCGGAGCCGCTGGG + Intergenic
1180052496 21:45337756-45337778 GTGCCCCCTCCAGAGGCTCTGGG - Intergenic
1181236329 22:21449788-21449810 ATGGTCCGGCCAGAGGGCCTTGG - Exonic
1181302066 22:21887572-21887594 ATTCTCCTGCCTGAGCCTCCTGG - Intergenic
1182106333 22:27692477-27692499 GTGTTCCATCCAGAGGCTCTAGG - Intergenic
1182768511 22:32776184-32776206 GTGCTCCCTCTAGAGGCTCTAGG - Intronic
1183036933 22:35147626-35147648 GTGCTCCCTCCGGAGGCTCTGGG - Intergenic
1183098998 22:35571864-35571886 ATTCTCCTGCCTCAGCCTCTCGG - Intergenic
1183215840 22:36479436-36479458 ATTCTCCTGCCTCAGCCTCTTGG + Intronic
1183369495 22:37424530-37424552 CTCCTCCAGCCAGAGACTCTTGG + Intronic
1183418910 22:37698733-37698755 ATTCTCCTGCCTCAGTCTCTGGG - Intronic
1183514923 22:38259627-38259649 ATACTCCTTCTGGAGGCTCTGGG - Intronic
1183697929 22:39433708-39433730 ATGTTCCTGCCAGTGGCAGTGGG + Intronic
1184063387 22:42099749-42099771 ATTCTCCTGCCTCAGGCTCCCGG + Intergenic
1184113295 22:42408007-42408029 ATTCTCCTGCCTCAGCCTCTGGG + Intronic
1184240179 22:43207703-43207725 GTGCTCCAGCCACGGGCTCTGGG + Intronic
1184428828 22:44429092-44429114 TCGCTCCTGCCCGAGGCTCAGGG - Intergenic
1184472802 22:44705187-44705209 TCGCTCCCACCAGAGGCTCTAGG + Intronic
1184476985 22:44727273-44727295 CTGCTGCTGCCCGAGGCTCTCGG - Intronic
1184498928 22:44860337-44860359 GTGCTCCTTCCAGAGGCTCTAGG + Intronic
1184544089 22:45153993-45154015 ACGCTCCCTCCAAAGGCTCTAGG + Intergenic
1184848627 22:47104586-47104608 ATTCTCCTGCCTCAGCCTCTGGG - Intronic
1184893550 22:47393829-47393851 TTGCTCCTGCCAGAGCCTGGTGG - Intergenic
1185164321 22:49251446-49251468 GTCCTCCTGCCATAGGCACTTGG - Intergenic
1185181939 22:49368715-49368737 ACCCTCCTGCCAGAGGCTCTGGG + Intergenic
1185249210 22:49790925-49790947 ATGCCCTTGCCAGAGGCTCCGGG - Intronic
949241582 3:1879525-1879547 ATTCTCCTGCCTCAGTCTCTCGG + Intergenic
949478436 3:4470830-4470852 GTGATGCTGCCTGAGGCTCTTGG + Intergenic
949787465 3:7757690-7757712 ATGTTCCCTTCAGAGGCTCTAGG - Intergenic
950370375 3:12524398-12524420 AGGCTCCCTCCAAAGGCTCTGGG + Intronic
951790803 3:26481977-26481999 ATGCACCTTCTAAAGGCTCTAGG - Intergenic
952383744 3:32823966-32823988 ATGCTCCTGCCTCAGCCTCCTGG - Intronic
952522894 3:34179792-34179814 ATGCTCCCTCCAAAGGCTCTTGG - Intergenic
953542869 3:43837732-43837754 ATGCTCCTTCCAGAGGCTCTAGG + Intergenic
953630482 3:44611896-44611918 ATGCTCCTGCCTCAGCCTCCTGG + Intronic
954169778 3:48791794-48791816 ATTCTCCTGCCTCAGCCTCTCGG - Intronic
954594387 3:51812893-51812915 AAGCTCCTTCCAGAAGCTCTAGG + Intergenic
954674952 3:52310640-52310662 TTGCTGCAGACAGAGGCTCTGGG - Intergenic
955182153 3:56682788-56682810 CTGCTCGTGGCTGAGGCTCTGGG + Exonic
955338012 3:58103086-58103108 ATGCTCCTGCCCCAGCCTGTTGG - Intronic
955516029 3:59727262-59727284 ATGCTCCCTCCAGAGGTTCTGGG - Intergenic
955604314 3:60684170-60684192 AAGATCCCTCCAGAGGCTCTAGG + Intronic
955654407 3:61229372-61229394 ATGCTCCCTCAACAGGCTCTAGG - Intronic
955703142 3:61702083-61702105 ATTCTCCTGCCTCAGCCTCTGGG + Intronic
956365857 3:68501918-68501940 ATTTTCCTGCCAGAGGGCCTTGG - Intronic
956736707 3:72244059-72244081 ATTCTCCCCCCAGAGCCTCTAGG - Intergenic
957055309 3:75438012-75438034 ATTCTCCTGCCTCAGCCTCTCGG + Intergenic
957143464 3:76391626-76391648 ATTCTCCTGCCTCAGGCTCCCGG + Intronic
957151081 3:76487074-76487096 ATCCACCTGCCACAGCCTCTCGG + Intronic
957271332 3:78033834-78033856 AAGCTCCTTCCTGAGGCTCCAGG - Intergenic
958138751 3:89532502-89532524 ATTCTCCTGCCTCAGCCTCTCGG - Intergenic
958432594 3:94059947-94059969 ATTCTCCTGCCTCAGGCTCCTGG - Exonic
958858504 3:99416798-99416820 ATTCTCCTGCCTCAGCCTCTGGG + Intergenic
959792409 3:110378778-110378800 ATGCTCTTTCTAGAAGCTCTGGG - Intergenic
959888885 3:111532180-111532202 ATGCTTCCTCCAAAGGCTCTAGG - Intronic
960879249 3:122328391-122328413 ATTCTCCTGCCTCAGCCTCTGGG - Intronic
961894072 3:130152830-130152852 ATGCTCCTTTCAGAGGTTCTAGG - Intergenic
962326205 3:134434697-134434719 ATCCTCCTGCCTCAGCCTCTTGG + Intergenic
962686827 3:137856013-137856035 ATGCTCTTGCCAAAGGCTCTGGG + Intergenic
963126116 3:141818372-141818394 ATTCTCCTGCCTCAGGCTCCCGG - Exonic
963348665 3:144126435-144126457 GTGCTCCCTTCAGAGGCTCTAGG + Intergenic
963838260 3:150079016-150079038 TTTCTCCTGCCTCAGGCTCTGGG + Intergenic
964670373 3:159218875-159218897 TCGTTCCTTCCAGAGGCTCTAGG + Intronic
964735714 3:159914885-159914907 ATGCTCCTGCCTTAGCCTCCCGG - Intergenic
966278289 3:178201760-178201782 TTGCTCCATCCAAAGGCTCTAGG + Intergenic
966544982 3:181136535-181136557 ATTCTCCTGCCTGAGCCTCCTGG - Intergenic
967001648 3:185341396-185341418 ATGCTCCTGCTGAAGGCTTTGGG - Intronic
967216083 3:187211755-187211777 ATGCTCCTGCCTCAGGGCCTTGG - Intergenic
967571418 3:191033094-191033116 ATTCTCCCTCCAGAGGCTCTTGG - Intergenic
967698807 3:192567603-192567625 GTGCTCCTTCCAAAAGCTCTAGG + Intronic
968047052 3:195630380-195630402 GTGCTCCCTCCAGAGGCTCCAGG + Intergenic
968130633 3:196190964-196190986 ATTCTCCTGCCTCAGCCTCTGGG + Intergenic
968307597 3:197659664-197659686 GTGCTCCCTCCAGAGGCTCCAGG - Intergenic
968658065 4:1787132-1787154 AGGCTGCGGCCAGAGGCCCTTGG - Intergenic
969207333 4:5656700-5656722 ATGCTCCCTTCAAAGGCTCTGGG - Intronic
969256001 4:6002312-6002334 ATGCTTCCTCCTGAGGCTCTAGG - Intergenic
969337251 4:6518814-6518836 ATTCTCCTGCCTCAGCCTCTTGG - Intronic
969474402 4:7412933-7412955 CTGCACCTGGCAGAAGCTCTGGG + Intronic
969604838 4:8197251-8197273 ATGCTCCCTCCAGAAGCTCCAGG - Intronic
969607391 4:8209416-8209438 CTGTTCCTCCCAGGGGCTCTGGG - Intronic
970287969 4:14539462-14539484 AAACTCCAGCCAGAGGCTCAGGG + Intergenic
970440777 4:16079581-16079603 ATGCTACTCTCAGTGGCTCTCGG - Intronic
970695354 4:18670366-18670388 GTGCTCCTTCCAGAGGCTCCAGG - Intergenic
970858499 4:20675370-20675392 ATGCTCCATCTGGAGGCTCTAGG - Intergenic
971284241 4:25272033-25272055 ATCCTCCTGCCTCAGGCTCCTGG - Intronic
971507992 4:27387173-27387195 GTGCTCCAGCTACAGGCTCTTGG + Intergenic
972224544 4:36997378-36997400 ATCCTCCTGCCTCAGCCTCTGGG + Intergenic
972767662 4:42166701-42166723 ATTCTCCTGCCTCAGCCTCTCGG + Intergenic
973054437 4:45637563-45637585 ATGCTCCTGTCAAAAGCTGTAGG - Intergenic
973320648 4:48807008-48807030 ATTCTCCTGCCTCAGCCTCTGGG + Intronic
973611344 4:52638370-52638392 GTACACCTTCCAGAGGCTCTAGG - Intronic
973863353 4:55087438-55087460 ATGCTCCTGGAAGAGGGCCTGGG - Intronic
973949228 4:55994438-55994460 ATCCTCCTGCCTCAGCCTCTCGG - Intronic
974029903 4:56767159-56767181 ATTCTCCTGCCTCAGCCTCTGGG - Intergenic
974093304 4:57335084-57335106 ATGCTCCTTCCAGAGACTCTAGG - Intergenic
975436648 4:74361276-74361298 ATTCTCCTGCCTGAGCCTCTAGG - Intergenic
975572571 4:75832813-75832835 ATGCTCCCTCCGAAGGCTCTAGG - Intergenic
976339713 4:83933624-83933646 ATGCTCTTGCTGAAGGCTCTAGG + Intergenic
977100335 4:92803900-92803922 ATGCTCTCTCCAAAGGCTCTAGG + Intronic
978644934 4:110918985-110919007 ACGCTCCTTCTGGAGGCTCTAGG + Intergenic
978906902 4:114016019-114016041 ATTCTCCTGCCTCAGCCTCTCGG - Intergenic
979150115 4:117301409-117301431 ATTCTCCTGCCTCAGCCTCTCGG + Intergenic
979381487 4:120011665-120011687 ATGCTCCTGCCACAGGAACCAGG - Intergenic
979735067 4:124073034-124073056 AAACTCCAGCCAGAGGCTCAGGG + Intergenic
980031339 4:127835594-127835616 ATTCTCCTGCCTGAGCCTCCCGG - Exonic
980254502 4:130360814-130360836 ATTCTCCTGCCTCAGTCTCTGGG - Intergenic
980508169 4:133750614-133750636 ATGCTCCTGCCCAAAGTTCTGGG - Intergenic
980554979 4:134391952-134391974 ATCCTCCTTCCAAAGGCTCTGGG - Intergenic
980938868 4:139253553-139253575 ATTCTCCTGCCTCAGCCTCTCGG + Intergenic
981541504 4:145851131-145851153 GCACTCCTTCCAGAGGCTCTAGG - Intronic
982288029 4:153754859-153754881 ATGCTCCCTCCAAAGACTCTAGG - Intronic
983625521 4:169798096-169798118 ATTCTACTGCCAGAGGGCCTGGG + Intergenic
984450896 4:179900021-179900043 ATGTTCCTTCCAAAGGCTCTAGG + Intergenic
984552998 4:181182800-181182822 GTGTTCCTGCCGGAGACTCTAGG - Intergenic
984679382 4:182590017-182590039 ATGCTTCTGCCTGAGGCACCCGG - Intronic
984704535 4:182838174-182838196 ATTCTCCTGCCTTAGCCTCTCGG + Intergenic
985049796 4:185977988-185978010 ATTCTCCTGCCTGAGCCTCCTGG - Intergenic
985201619 4:187490102-187490124 ATTCTCCTGCCTCAGCCTCTTGG - Intergenic
985726970 5:1521802-1521824 AAGCTGCTCCCAGTGGCTCTTGG - Intronic
985744563 5:1638761-1638783 GTGCTCCCTCCAGAGGCTCCAGG - Intergenic
985762822 5:1759957-1759979 AGGCTCCTCCCTGAGACTCTCGG - Intergenic
985891108 5:2715735-2715757 ATTCTCCTGCCTCAGCCTCTTGG - Intergenic
986139186 5:5013716-5013738 CTGCTCCCTCCAGAGGCTCTGGG - Intergenic
986304332 5:6504375-6504397 ATGCTCCCTCCAAAAGCTCTAGG + Intergenic
986729467 5:10624554-10624576 AGGCTGCTGCCTGAGGCTTTGGG + Intronic
986778740 5:11045079-11045101 ATGCTCCCGCCTAAGGCTCTAGG + Intronic
987139640 5:14932031-14932053 ATTCTCCTGCCTTAGCCTCTTGG + Intergenic
988883307 5:35528983-35529005 ATTCTCCTGCCTTAGCCTCTCGG - Intergenic
988955390 5:36311203-36311225 GTGCTCCCTCCATAGGCTCTAGG - Intergenic
988990239 5:36663320-36663342 ATTCTCCTGCCTCAGCCTCTCGG + Intronic
989016043 5:36935765-36935787 ATTCACCTTCCAAAGGCTCTAGG + Intronic
989271125 5:39534082-39534104 CTGCTTCTGCCAAATGCTCTGGG + Intergenic
989332430 5:40275558-40275580 ATGCTTCTTCCAAAAGCTCTAGG + Intergenic
989387754 5:40870030-40870052 ATTCTCCTGCCTCAGCCTCTGGG - Intergenic
990073511 5:51815123-51815145 ATTCTCCTGCCTCAGGCTCCTGG + Intergenic
990096423 5:52119962-52119984 ATACTCCCTCCAGAGGCTCTAGG + Intergenic
990310140 5:54530003-54530025 ATGCTCCCTTCAGAGGCTCTAGG + Intronic
990564199 5:57012593-57012615 ATGCACCTGCGAAAGACTCTTGG + Intergenic
990917840 5:60930617-60930639 ATTCTCCTGCCTCAGCCTCTGGG - Intronic
991104262 5:62826357-62826379 ATTCTCCTGCCTCAGCCTCTAGG + Intergenic
991188311 5:63837623-63837645 ATCAGCCTGCAAGAGGCTCTTGG - Intergenic
992121517 5:73598228-73598250 ATTCTCCTGCCTCAGACTCTGGG - Intergenic
992759960 5:79942853-79942875 ATGCTCCCTCCAGAACCTCTAGG + Intergenic
992914154 5:81431689-81431711 ATGCTTCTGCCAAAGCCTCCTGG + Intronic
992958169 5:81931737-81931759 TTGCTTCTGTCAGATGCTCTGGG + Intergenic
992970963 5:82057381-82057403 CTGCTCCCACCAGAGGCTTTAGG + Intronic
993493228 5:88577546-88577568 GTGTTTCTTCCAGAGGCTCTAGG + Intergenic
993845077 5:92931235-92931257 ATTTTCCTTCCAGAAGCTCTAGG - Intergenic
994806797 5:104458660-104458682 ATTCTCCTGCCTCAGCCTCTCGG + Intergenic
995127948 5:108598708-108598730 ATTCTCCTGCCTCAGCCTCTGGG + Intergenic
995168174 5:109072825-109072847 ATGCTCCCTCCAAAAGCTCTGGG + Intronic
995594190 5:113730914-113730936 TAGCTCCAGCCAGAGGCTCAAGG - Intergenic
995602284 5:113810608-113810630 GTGCTCCTTCCGGAGGCGCTAGG - Intergenic
996064685 5:119067923-119067945 ATTCTCCTGCCTTAGCCTCTTGG + Intronic
997298736 5:132786516-132786538 ATGCTCCTTCTAGAGGCTGTAGG - Intronic
997501631 5:134379537-134379559 ATTCTCCTGCCTCAGCCTCTGGG - Intronic
998177232 5:139909373-139909395 ATTCTCCTGCAAGGGGGTCTTGG + Intronic
998338976 5:141399600-141399622 AGGCCAGTGCCAGAGGCTCTAGG - Exonic
998379991 5:141717527-141717549 TTGCTCCTCCCAGAGGGTCCTGG + Intergenic
999155231 5:149453151-149453173 ACGCTCCCCCGAGAGGCTCTGGG - Intergenic
999292103 5:150432526-150432548 ATTCTCCTGCCTCAGGCTCCTGG - Intergenic
999694175 5:154173622-154173644 AGGCACCTGCCAGCAGCTCTAGG - Intronic
999804546 5:155069668-155069690 GTGTTCCTTCCAGGGGCTCTAGG - Intergenic
1000624916 5:163527912-163527934 ATGCTCTCTCCAGAGGATCTAGG - Intergenic
1000988547 5:167887848-167887870 ATGCTCCTTCCAAATGCCCTAGG + Intronic
1001312685 5:170622764-170622786 GTGCTCCCTCCAAAGGCTCTAGG - Intronic
1002348170 5:178562446-178562468 ATTCTCCTGCCTCAGCCTCTGGG - Intronic
1002372749 5:178768163-178768185 ATGCTCTTGCCCGTAGCTCTAGG - Intergenic
1002441996 5:179269202-179269224 GTGCTCCCTCCAGAGGCTCCAGG - Intronic
1002664748 5:180814831-180814853 ATTCTCCTGCCTCAGCCTCTGGG - Intronic
1003271324 6:4610444-4610466 CTGCTCTTGCCAGAGTCTCGAGG + Intergenic
1004029552 6:11852897-11852919 AAGCTCCTGCCAGAAGTTCAAGG - Intergenic
1004139925 6:13008973-13008995 AAGATCCCTCCAGAGGCTCTTGG + Intronic
1004265259 6:14143853-14143875 CTGCTGCTGCCAGGAGCTCTCGG - Intergenic
1004279487 6:14268929-14268951 ATGCTCCTTCCAAAGGCTCCAGG + Intergenic
1004923423 6:20398017-20398039 CTGCTCCCTCCAGAGGCTCTAGG + Intergenic
1005087512 6:22022117-22022139 GAGCTCCTGCCAGAGGCTCTGGG + Intergenic
1005276885 6:24229208-24229230 ATGTTCCTTCTGGAGGCTCTAGG + Intronic
1005375554 6:25178928-25178950 TGGCTCCTTCCAGAGGCTCTGGG + Intergenic
1005708115 6:28477275-28477297 ATGCTCCCTCCGGAGGCTCTAGG + Intergenic
1005886174 6:30099441-30099463 ATGCTCTCTCCAAAGGCTCTAGG - Intergenic
1005917131 6:30362669-30362691 ATGCCCCTTCCAGAGGATCTAGG - Intergenic
1006210257 6:32387349-32387371 AGGCTCCTGACAGAGTCTCTGGG - Intergenic
1006271430 6:32969507-32969529 ATGCTCCCTCCAGAGGCTCTGGG - Intronic
1006476724 6:34260289-34260311 ATTCTCCTGCCTCAGCCTCTGGG + Intergenic
1006545773 6:34780044-34780066 ATTCTCCTGCCTCAGCCTCTGGG - Intergenic
1006705425 6:36016098-36016120 ATTCTCCTGCCTCAGCCTCTCGG + Intronic
1006763067 6:36480666-36480688 ATTCTCCTGCCAGAGCAGCTGGG + Intronic
1006937687 6:37729778-37729800 ATGCTCCCTCCAAAGGCTCCAGG + Intergenic
1007737924 6:43993356-43993378 ATGCTTCTGCCATAGACTCAGGG + Intergenic
1008132778 6:47737834-47737856 ATTCTCCTGCCTTAGCCTCTCGG + Intergenic
1008309596 6:49950246-49950268 ATTCTCCTGCCTCAGCCTCTGGG - Intergenic
1008315642 6:50036845-50036867 GTGCTCCTTCTGGAGGCTCTAGG - Intergenic
1008932593 6:56955363-56955385 AGGCTCCTGTCAGCGCCTCTCGG - Exonic
1009612526 6:65964514-65964536 ATACTCTCTCCAGAGGCTCTAGG - Intergenic
1012164612 6:95932810-95932832 GTGCTCCCTCCAAAGGCTCTAGG + Intergenic
1012861776 6:104569020-104569042 ATCCTCCTGCCTCAGCCTCTAGG + Intergenic
1013090062 6:106892258-106892280 ATTCTCCTGCCTCAGCCTCTCGG - Intergenic
1013245668 6:108284717-108284739 ATTCTCCTGCCTCAGCCTCTCGG - Intergenic
1013387056 6:109642139-109642161 ATGCTCCTTCCAAAGTCTCTTGG - Intronic
1013480043 6:110545186-110545208 ATGCTTCCTCCAAAGGCTCTAGG + Intergenic
1013494533 6:110685029-110685051 ATTCTCCTGCCTCAGCCTCTTGG - Intronic
1014563518 6:122919265-122919287 ATACTGCTTCCAGAGGCTCTAGG - Intergenic
1014821307 6:125991137-125991159 ATTCTCCTGCCTCAGCCTCTTGG - Intronic
1015048817 6:128813904-128813926 ATACTCCTTCCAGAGGGTTTAGG + Intergenic
1015214700 6:130736046-130736068 ATGCTTCTGCTCCAGGCTCTTGG - Intergenic
1015736680 6:136407828-136407850 ATGCTTCTGCTAGAGACCCTAGG - Intronic
1016247592 6:142002363-142002385 ATTCTCCTGCCTCAGCCTCTGGG - Intergenic
1016743842 6:147557434-147557456 ATGCTGCCTCCAGAGCCTCTAGG + Intronic
1016810584 6:148257537-148257559 ATGCTTCTCCCACAAGCTCTGGG + Intergenic
1017137463 6:151161002-151161024 GTGCTCCTTCCATTGGCTCTAGG + Intergenic
1017225370 6:152014958-152014980 ATTCTCCTGCCTCAGCCTCTCGG - Intronic
1017331942 6:153209548-153209570 ATGCCCCCTCCAGAGGCTTTAGG + Intergenic
1017492331 6:154955573-154955595 ATTCTCCTGCCTGAGCCTCCCGG + Intronic
1017788038 6:157772563-157772585 ATGCTCTCCCCAGAGGCTCTGGG - Intronic
1018415846 6:163601576-163601598 GAGTTCCTTCCAGAGGCTCTGGG + Intergenic
1018619275 6:165714764-165714786 CTCCTCCTGCCTGAGACTCTGGG - Intronic
1018634521 6:165848902-165848924 TGGCTCCTTCCAGAGACTCTGGG - Intronic
1018729085 6:166635680-166635702 ATCCTCCTGCCAAAGCCTCCCGG - Intronic
1018741733 6:166734166-166734188 AAGCTCCTGCCAGGAGCCCTCGG - Intronic
1018836788 6:167491221-167491243 GCGTTCCTTCCAGAGGCTCTAGG + Intergenic
1019064718 6:169287729-169287751 ATGCTCCCTCCAGAGTCTCCTGG + Intergenic
1019196680 6:170287274-170287296 CAGCTCCTGCCAGAGGTTCTGGG + Intronic
1019303024 7:318510-318532 TTACTCCTGCCAGAGCCGCTGGG - Intergenic
1019978759 7:4605616-4605638 ATCCTCCTGCCTCAGCCTCTTGG - Intergenic
1020073567 7:5243153-5243175 TTGCTCCTGGCAGAGGCTGAGGG + Intergenic
1020794855 7:12666883-12666905 ATGCTCCCTACAAAGGCTCTAGG + Intergenic
1021767691 7:23966045-23966067 ATGCTCATGCCCGAGGGTTTAGG + Intergenic
1021915378 7:25426323-25426345 ATGCTCCCTCCAAAGCCTCTAGG + Intergenic
1022241872 7:28520295-28520317 ATCCTCCTGCCTCAGGCTTTTGG + Intronic
1022445696 7:30468975-30468997 TGGCTCCTGCCAGATGCTGTTGG - Intronic
1022733184 7:33051268-33051290 ATTCTCCTGCCTCAGCCTCTTGG + Intronic
1022990553 7:35703055-35703077 ATTCTCCTGCCTCAGCCTCTGGG + Intergenic
1023403149 7:39805329-39805351 ATTCTCCTGCCTCAGCCTCTGGG + Intergenic
1023546127 7:41319205-41319227 AAGCTCCCACCAGAGGATCTAGG - Intergenic
1023623403 7:42094625-42094647 ATTCTCCTGCCTCAGCCTCTCGG - Intronic
1023853426 7:44163814-44163836 CTGCTCCAGCCAGCTGCTCTAGG - Intronic
1024252023 7:47513274-47513296 ATCCTCCTGCCTCAGCCTCTAGG + Intronic
1026166013 7:67910526-67910548 GTACTCCTGGCAGAGGCTCATGG + Intergenic
1026179571 7:68027033-68027055 ATTCTCCTGCCTCAGCCTCTGGG - Intergenic
1026975059 7:74492751-74492773 ATGCTCCCTCCAGAGGCTCTCGG + Intronic
1027253164 7:76411949-76411971 ATCCTCCTGCCACAGCCTCCTGG - Intronic
1028805117 7:95017120-95017142 ATGCTCCCTCCAAAGCCTCTAGG - Intronic
1028943504 7:96551860-96551882 TGGTTCCTTCCAGAGGCTCTAGG - Intronic
1030560476 7:111078835-111078857 ATTCTCCTGCCTCAGCCTCTGGG + Intronic
1030597240 7:111554727-111554749 ATTCTCCTGCCTCAGCCTCTGGG + Intronic
1030939437 7:115628070-115628092 GTGCTCCTTCCAGAGGTTCTGGG - Intergenic
1031029089 7:116715293-116715315 ATGCTCCCTCTGGAGGCTCTAGG + Intronic
1031866973 7:127048255-127048277 ATGCTCCTGCCATGGGCTTGGGG - Intronic
1032168352 7:129563488-129563510 GTATTCCTTCCAGAGGCTCTAGG + Intergenic
1032389603 7:131547264-131547286 ATTCTCCTGCCCCAGCCTCTGGG - Intronic
1032578241 7:133078428-133078450 ATCCTCCTGCCCCAGCCTCTGGG - Intronic
1033189661 7:139265821-139265843 ATGGTCCCTCCAGAGGCTCTAGG - Intronic
1033265013 7:139877527-139877549 ATGCTCCTGCCTCAGCCTCCTGG + Intronic
1033329029 7:140403049-140403071 ATTCTCCTGCCAGAGTAGCTGGG + Intronic
1033466198 7:141592258-141592280 ATGTTCCTTCTGGAGGCTCTAGG + Intronic
1033612833 7:142982686-142982708 ATTCTCCTGCCTCAGCCTCTTGG + Intergenic
1034064513 7:148123488-148123510 ATTCTCCTGCCTCAGCCTCTGGG - Intronic
1034486961 7:151371848-151371870 ATCCTCCTGCCAAGAGCTCTCGG + Intronic
1034509942 7:151525883-151525905 ATTCTCCTGCCTCAGCCTCTCGG + Intergenic
1035852001 8:2929577-2929599 AGACTCCTGCCTGAGGCACTGGG - Intergenic
1035907884 8:3533638-3533660 ATGGGCCTCCCAGAGCCTCTGGG - Intronic
1036943194 8:13070623-13070645 ATGCTCCCTCCAAAGGCTCTGGG + Intergenic
1037798767 8:22019325-22019347 ATTCTCCTGCCTCAGGCTCCCGG - Intergenic
1038145250 8:24889009-24889031 ATGCTCCCTCCAAAGGCTGTTGG + Intergenic
1038160745 8:25035224-25035246 GTCCTCCTGCCACAGCCTCTGGG + Intergenic
1038180215 8:25220717-25220739 ATGCTCCTGCCTCAGACTCCTGG + Intronic
1038541093 8:28390690-28390712 ATCCTCCTGCCTCAGCCTCTGGG + Intronic
1038663814 8:29520227-29520249 GTGTTCCTTCCGGAGGCTCTAGG - Intergenic
1038743306 8:30234344-30234366 ATGTTCCTACCAAAGACTCTTGG - Intergenic
1038753341 8:30317053-30317075 ATCCTCCTGCCTAAGCCTCTTGG + Intergenic
1039157591 8:34579196-34579218 ATTCTCCTGCCTCAGCCTCTTGG + Intergenic
1039965914 8:42283628-42283650 ATGCTCCATCCAGAGGCTCTAGG - Intronic
1040891133 8:52317424-52317446 ATGCTCCCTCCGAAGGCTCTAGG - Intronic
1042781151 8:72492241-72492263 ATGCTTCCTCCAAAGGCTCTAGG - Intergenic
1042931888 8:74022301-74022323 ATTCTCCTGCCTCAGGCTCCCGG - Intronic
1043070774 8:75633201-75633223 ATGTTCCTTCCAAAGTCTCTAGG + Intergenic
1043158395 8:76815606-76815628 ATCCTCCTGCCTCAGCCTCTGGG + Intronic
1043457064 8:80423142-80423164 AGGCTCCTACCTGAGCCTCTTGG - Intergenic
1043566679 8:81556979-81557001 ATTCTCCTGCCTCAGCCTCTTGG + Intergenic
1043927958 8:86059429-86059451 GTGTTCCTTCCAGAGGCTCTAGG + Intronic
1043964903 8:86463411-86463433 ATTCTCCTGCCTCAGCCTCTCGG + Intronic
1044808178 8:96030194-96030216 ATCCTACTGCCTAAGGCTCTAGG + Intergenic
1044822592 8:96165254-96165276 TTATTCTTGCCAGAGGCTCTAGG - Intergenic
1044937662 8:97308730-97308752 ATTCTCCTGCCTCAGCCTCTCGG + Intergenic
1044981411 8:97720176-97720198 ATTCTCCTGCCTCAGCCTCTTGG - Intronic
1045121651 8:99044188-99044210 ATTCTCCTGCCTCAGCCTCTGGG + Intronic
1045598587 8:103686866-103686888 ATCCTCCTGCCTCAGCCTCTTGG + Intronic
1046165693 8:110431981-110432003 ATCCTCCCTCCAGAGGCTCTAGG + Intergenic
1046230185 8:111345644-111345666 ATTCTCCTGCCTCAGCCTCTAGG + Intergenic
1046675389 8:117102600-117102622 ATGCTCACTCCAAAGGCTCTAGG + Intronic
1047770411 8:128026056-128026078 ATTCTCCTGCCAGAGTAGCTGGG + Intergenic
1048035222 8:130671517-130671539 GTGCTCTCTCCAGAGGCTCTAGG - Intergenic
1048941349 8:139403320-139403342 GTGCTCCTGCTGGAGGCTGTGGG - Intergenic
1049149471 8:141025313-141025335 GTGTTCCTTCCAGAGGCTCCAGG + Intergenic
1049235858 8:141511942-141511964 AGGCTCCTGCCAGAACCTCTGGG + Intergenic
1049257610 8:141622314-141622336 TTGCTGCTGCCAGAGGGTCAGGG + Intergenic
1049416004 8:142495541-142495563 ATGCTCCTTCCAAAGGCTCTAGG + Intronic
1049476475 8:142799336-142799358 GTGCGCCTGCCAGAGGCTTTCGG + Intergenic
1049751332 8:144285729-144285751 ATGCCCCTGCCAGTGGTTGTGGG - Intronic
1050767262 9:9150592-9150614 ATTCTCCTGCCTCAGCCTCTGGG + Intronic
1051037841 9:12770391-12770413 ATGCTCCCTCCAAAGCCTCTAGG - Intergenic
1051077168 9:13252740-13252762 ATTCTCCTGCCTCAGCCTCTTGG - Intronic
1051127044 9:13816197-13816219 ATGCTCCATCCAGAGAATCTGGG + Intergenic
1051729546 9:20125930-20125952 CTGCAGCTGCCAGAGGATCTGGG + Intergenic
1051906595 9:22102495-22102517 ATGCTCTCGGCAGAGGCTCTTGG + Intergenic
1051909126 9:22132798-22132820 ATTCTCCTGCCTCAGCCTCTGGG + Intergenic
1052127715 9:24798403-24798425 ATGCTCCCTCCAAAGGCTCTAGG + Intergenic
1053079759 9:35165522-35165544 ATTCTCCTGCCTTAGCCTCTGGG + Intronic
1053218014 9:36288883-36288905 ATGCTCCCTCTGGAGGCTCTTGG + Intronic
1053466155 9:38310177-38310199 CTGCTGCTGCAAAAGGCTCTGGG - Intergenic
1053564727 9:39237092-39237114 ATGCTGCCTCCGGAGGCTCTAGG + Intronic
1054132424 9:61381942-61381964 ATGCTGCCTCCGGAGGCTCTAGG - Intergenic
1054771449 9:69088040-69088062 ATTCTCCTGCCTCAGGCTCCTGG + Intronic
1055028777 9:71750851-71750873 ATCCTCCTGCCTGAGCCTCCCGG + Intronic
1055412269 9:76043227-76043249 ATTCTCCTGCCTCAGCCTCTGGG - Intronic
1055768075 9:79686695-79686717 ATGCTCCCTCCAAAGGCTCCAGG - Intronic
1056107513 9:83361918-83361940 ATGCTCCCTCCGAAGGCTCTAGG - Intronic
1056459212 9:86792896-86792918 ATGCTCCTTCCAAAGCCTCTAGG - Intergenic
1056890210 9:90484670-90484692 ATTCTCCTGCCTCAGCCTCTGGG - Intergenic
1056965925 9:91162889-91162911 ATGCTCCAGGAAGTGGCTCTCGG - Intergenic
1057073254 9:92118698-92118720 ATACTCCCTCCAAAGGCTCTGGG + Intergenic
1057588772 9:96353458-96353480 ATTCTCCTGCCTCAGCCTCTCGG + Intronic
1057967456 9:99517968-99517990 ACACTCCCTCCAGAGGCTCTAGG - Intergenic
1057998243 9:99840173-99840195 AGGCTCCAGCCAGATCCTCTGGG - Intronic
1058273949 9:103016342-103016364 ATGCTCCAGGAAGAAGCTCTGGG + Intronic
1058670626 9:107357916-107357938 ATTCTCCTGCCTCAGCCTCTCGG - Intergenic
1058766296 9:108185750-108185772 GTGCTCTCTCCAGAGGCTCTAGG + Intergenic
1058963052 9:110009605-110009627 ATTCTCCTGCCTCAGCCTCTGGG - Intronic
1059108525 9:111532543-111532565 GTGCTCCCTTCAGAGGCTCTGGG - Intronic
1059746187 9:117204037-117204059 TAACTCCAGCCAGAGGCTCTGGG - Intronic
1060601817 9:124883204-124883226 ATTCTCCTGCCTCAGGCTCTAGG + Intronic
1060663619 9:125419477-125419499 ATTCTCCTGCCTCAGCCTCTAGG - Intergenic
1060762838 9:126270684-126270706 ACGCTCCCTCCAGAGGCTCTAGG - Intergenic
1060764427 9:126283162-126283184 GTGTTCCTTCCAGAGGCTCCAGG - Intergenic
1061195767 9:129106400-129106422 AAGCTTTGGCCAGAGGCTCTGGG - Intronic
1061303863 9:129721684-129721706 ATTCTCCTGCCTCAGCCTCTTGG + Intronic
1061468918 9:130807041-130807063 ATTCTCCTGCCTCAGCCTCTCGG - Intronic
1061784414 9:133017719-133017741 ATTCTCCTGCCACAGCCTCCCGG - Intergenic
1061952763 9:133945554-133945576 ATGGGCCTGCCAGAGGCTGGGGG - Intronic
1062073420 9:134571645-134571667 TGGCTCCTCCCAGAGGCTCTGGG + Intergenic
1062102584 9:134736123-134736145 AGGCTGCTGCCAGAGGTGCTGGG - Intronic
1062151272 9:135020409-135020431 GTGCTCCCTCCAGAAGCTCTAGG - Intergenic
1062154831 9:135041342-135041364 ATGCTTGTGCCAAAGGCACTAGG - Intergenic
1062158627 9:135067655-135067677 GTCCTCCCTCCAGAGGCTCTAGG - Intergenic
1062271364 9:135711222-135711244 CTTCTCCCGCCAAAGGCTCTGGG - Intronic
1062445539 9:136592603-136592625 ACGCTCCCTCCAGAGGCTCCAGG - Intergenic
1062518765 9:136948955-136948977 ATTCTCCTGCCTGAGCCTCCTGG - Intronic
1185510530 X:660781-660803 ATGCTCCCTCCAGAGACTCTTGG - Intergenic
1185626863 X:1488563-1488585 ATGGACCTGCCAGAGCCTCTTGG + Intronic
1185655795 X:1684542-1684564 ATGCTTCCTCCGGAGGCTCTAGG - Intergenic
1185677085 X:1857892-1857914 ATGCTCCCTCCAGAAGCTCTAGG + Intergenic
1185677315 X:1859466-1859488 GTGCTCCCTCCGGAGGCTCTAGG + Intergenic
1185680385 X:1884212-1884234 ATGCTCCCTCCAGAGACTCTAGG + Intergenic
1185691006 X:2155275-2155297 GTGCTCCCTCCGGAGGCTCTAGG + Intergenic
1185764601 X:2715359-2715381 ATGCTCCCTCTAGGGGCTCTAGG + Intronic
1185792696 X:2939318-2939340 ATGTTCCCGCCAGAAGCTCTAGG - Intronic
1185794201 X:2950847-2950869 ATACTCTCTCCAGAGGCTCTAGG + Intronic
1185847997 X:3457780-3457802 ATGCTCACTTCAGAGGCTCTGGG + Intergenic
1186150102 X:6665603-6665625 GTGCTCCTGCTGAAGGCTCTAGG + Intergenic
1186726205 X:12361802-12361824 ATGCTCCTTCTGAAGGCTCTAGG + Intronic
1187563488 X:20425057-20425079 ATGCTCCCTCCAAGGGCTCTAGG + Intergenic
1187628281 X:21141443-21141465 ATGCACCACCCAAAGGCTCTAGG - Intergenic
1187704459 X:21995790-21995812 ATTCTCCTGCCTCAGGCTCCCGG + Intergenic
1188023737 X:25186788-25186810 ATTCTCCTGCCACAGCCTCCCGG - Intergenic
1188255115 X:27952603-27952625 ATGCTCCCTCCGAAGGCTCTAGG - Intergenic
1188434032 X:30139844-30139866 ATGCTGCTGCCAGAGTCTTAAGG + Intergenic
1189561221 X:42193166-42193188 ATGTTCCTTCTAGAGGCTCTAGG - Intergenic
1190175759 X:48148029-48148051 ATTCTCCTGCCTCAGCCTCTTGG + Intergenic
1192416000 X:70981288-70981310 ATTCTCCTGCCTGAGCCTCTGGG - Intergenic
1192456388 X:71279629-71279651 ATATTCCTTCTAGAGGCTCTAGG - Intergenic
1192498432 X:71632336-71632358 ATGCTCCCTCCAGAAGCTCTAGG + Intergenic
1193741624 X:85224164-85224186 ACGCTCCCTCCAGAGGCTCTAGG + Intergenic
1194003117 X:88456594-88456616 ATGCTCCTTACAAAGGCTCTCGG - Intergenic
1195363770 X:104108438-104108460 ATGCTCCTTCTGGATGCTCTCGG + Intronic
1195450827 X:105010661-105010683 ATAATCTTGCCAAAGGCTCTAGG + Intronic
1195652644 X:107301162-107301184 ATGTTCATGCCAGGGACTCTGGG - Intergenic
1195678404 X:107524887-107524909 ATTCTCCTGCCTCAGGCTCCAGG - Intronic
1195958822 X:110364084-110364106 ATGCTCCCTACAAAGGCTCTAGG + Intronic
1196198584 X:112860450-112860472 AAGCTTCCTCCAGAGGCTCTAGG + Intergenic
1196342706 X:114614365-114614387 ATTCTCCTGCCTCAGCCTCTGGG + Intronic
1196342873 X:114616391-114616413 ATTCTCCTGCCTCAGCCTCTTGG + Intronic
1196673636 X:118395913-118395935 ATTCTCCTGCCTCAGCCTCTGGG - Intronic
1196963847 X:121033698-121033720 ATGCTCCTTCTAAAGGCTCTAGG - Intergenic
1197708943 X:129652847-129652869 GTGCTCCCCCCAGAGGCTGTGGG - Intronic
1198830083 X:140741257-140741279 AAGCACCAGCCAGGGGCTCTAGG + Intergenic
1199305142 X:146258883-146258905 ATTCTCCTGCCACAGCCTCCCGG + Intergenic
1199817725 X:151413569-151413591 ACACTCCTCCGAGAGGCTCTGGG - Intergenic
1199982114 X:152926867-152926889 ATGCTCCCTCCAAAGGCTCTGGG + Intronic
1200041661 X:153375313-153375335 ACACTCCCCCCAGAGGCTCTAGG - Intergenic
1200050983 X:153431603-153431625 GCGCTCCCTCCAGAGGCTCTAGG - Intergenic
1200177570 X:154127606-154127628 ATTCTCCTGCCTCAGCCTCTGGG - Intergenic
1200389361 X:155928423-155928445 ACACTCCTTCCAGAGGCTCTAGG + Intronic
1200407077 Y:2823232-2823254 ATGCTCCTTTCAGAGGCTCTAGG - Intergenic
1200427823 Y:3040741-3040763 ATGCTGCAGCTAGAGGCTGTCGG + Intergenic
1200815851 Y:7531588-7531610 ATGCTCACTTCAGAGGCTCTGGG - Intergenic
1201620645 Y:15953311-15953333 AAGTTCCCTCCAGAGGCTCTAGG - Intergenic
1202084243 Y:21118958-21118980 GTGCTCCTTTCAGAGGCTCTAGG - Intergenic