ID: 1117058064

View in Genome Browser
Species Human (GRCh38)
Location 14:51933082-51933104
Sequence CAGAGCCATGCTCCTGCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 1, 2: 2, 3: 57, 4: 374}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117058064_1117058066 -5 Left 1117058064 14:51933082-51933104 CCTCTGGCAGGAGCATGGCTCTG 0: 1
1: 1
2: 2
3: 57
4: 374
Right 1117058066 14:51933100-51933122 CTCTGCTGGCACCTTGATTTTGG 0: 2
1: 82
2: 594
3: 1800
4: 3788

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117058064 Original CRISPR CAGAGCCATGCTCCTGCCAG AGG (reversed) Intronic
900291910 1:1927280-1927302 GAGAGCCATGTTCCTTCCCGGGG + Intronic
900934411 1:5756154-5756176 CAGAGCCACGCTTCTTCCAGAGG + Intergenic
901602011 1:10429939-10429961 CAGAACTATACTCCTGCCAATGG + Intergenic
901664731 1:10819794-10819816 CAGAGTCAAGCTCCTTCCAGGGG + Intergenic
902446125 1:16465744-16465766 TAGGGCCATGCTCCTTCCAGAGG + Intergenic
902612204 1:17603802-17603824 CAGGGCCATGCTCCGGCTATGGG + Intronic
902804483 1:18852359-18852381 CAAAGCCATGTGCCTGCCACAGG + Intronic
904366263 1:30012753-30012775 GAGTGCCAAGCACCTGCCAGGGG + Intergenic
904593467 1:31628228-31628250 CAGAGCCCTGGTGCTGCCAGGGG + Intronic
905033379 1:34902318-34902340 AAGAGCCCTGCTCCTGCCCGTGG - Intronic
905235564 1:36543718-36543740 CAGAGCCATCCACCAGTCAGAGG - Intergenic
905396238 1:37668555-37668577 CAGAGCAATCCTCTTGGCAGAGG + Intergenic
905871130 1:41405184-41405206 CAGAGCAGCGCTCCTTCCAGGGG - Intergenic
906166104 1:43687494-43687516 GAGAGCCAGTCTCCTGTCAGGGG + Intronic
906265215 1:44423803-44423825 CTGAGCAATGCACCTCCCAGAGG - Intronic
906518882 1:46455854-46455876 CTGAGTCTTGGTCCTGCCAGGGG - Intergenic
907045327 1:51296954-51296976 CAGAGCCAGGCTCCTGTCTCAGG - Intronic
910202481 1:84713865-84713887 CAGGGCCATACTCCCTCCAGGGG + Intergenic
910502324 1:87907051-87907073 CAGAGCCATGCTTCCTCCAGAGG + Intergenic
911709566 1:101054408-101054430 CAGGGTCATGCTCCTTCCAAAGG - Intergenic
913073674 1:115323225-115323247 CAGACCCATACTCATCCCAGGGG - Intronic
915830256 1:159122442-159122464 CACAGCCATGCCCATGCCATTGG + Intronic
916374170 1:164133841-164133863 CAGAGCCATGCTCCCTCTGGAGG - Intergenic
916579143 1:166092289-166092311 CACAGCCCTCCTCCTTCCAGTGG + Intronic
919755387 1:201062964-201062986 CACCTCCATCCTCCTGCCAGTGG + Intronic
920224219 1:204426365-204426387 CAGAGCCAGGAGCCTGCCAGGGG - Intronic
920939163 1:210464693-210464715 CCCAGCCATGCTCCTCCCACTGG - Intronic
922619608 1:226981705-226981727 CAGGGCCATGGTGCTGCCTGTGG - Intronic
923312390 1:232747594-232747616 CAGAGCCACGCTCCCTCCAGAGG + Intergenic
923313025 1:232754565-232754587 CAGGGCCAGGCTCCCTCCAGAGG - Intergenic
923556867 1:235007973-235007995 CAGGGCCAAGCTCCCTCCAGAGG + Intergenic
1063498993 10:6536284-6536306 CACATCCATGTTCCAGCCAGTGG - Intronic
1064165251 10:12980221-12980243 CAGAGCCATGCTTCCCCCAGGGG - Intronic
1066317141 10:34259344-34259366 CAGAGCCAAGTTCCTTCCGGAGG + Intronic
1067203666 10:44195843-44195865 TAGAGTCATGCTCCTTACAGTGG + Intergenic
1069005869 10:63316908-63316930 CCAAGCCAAGATCCTGCCAGTGG - Intronic
1069770306 10:70894329-70894351 CAGGGCCATGCTTCTCCCAAGGG + Intergenic
1069794058 10:71041219-71041241 CTGAGCCATGCTCAGGGCAGAGG + Intergenic
1070529180 10:77321418-77321440 TGGAGCCATGCTTCTGTCAGTGG - Intronic
1070547304 10:77462927-77462949 CTGATCCATGCCTCTGCCAGAGG + Intronic
1071168975 10:82841210-82841232 CAGGGCCATACTCCTTCCAATGG - Intronic
1071713375 10:88071558-88071580 CAGAGCCATTCTCATTCCACTGG + Intergenic
1071966512 10:90857794-90857816 CAGAGCCAGGCGCCCCCCAGCGG - Intergenic
1072291152 10:93966131-93966153 CTGAGCCATGGTCATGCCACTGG + Intergenic
1073590124 10:104749009-104749031 CATAGCCATGCTCCTGCTTCAGG - Intronic
1074942889 10:118252124-118252146 CAGAGCCATGCTCCAGCCCTGGG + Intergenic
1075028139 10:119002145-119002167 CACAGCTCTGCTCCTGCCACAGG - Intergenic
1076444309 10:130501487-130501509 CAGAGCCATGCTCCCTCTGGAGG + Intergenic
1076919670 10:133445098-133445120 CAGAGCCATACACCTGCCCCCGG - Intergenic
1077895992 11:6453950-6453972 CTGAGCCAGGCTCCTAGCAGTGG + Intronic
1078259306 11:9689812-9689834 CAGAGCCAAGTTAGTGCCAGTGG - Intronic
1078928459 11:15894918-15894940 CAGGGCCATGCTCCCTCCAAAGG + Intergenic
1081783046 11:45726786-45726808 CAGAGCCCTGCTCCAGCCACCGG - Intergenic
1082958792 11:58899635-58899657 CAGAGCCAAGCACATACCAGCGG + Intronic
1083276368 11:61599283-61599305 CAGAGCCAGGGCGCTGCCAGGGG - Intergenic
1084085348 11:66852619-66852641 CAGAGACATCCTGCTGCGAGAGG - Exonic
1084209792 11:67615623-67615645 CAAAGCCAATCTGCTGCCAGGGG - Intergenic
1087250716 11:95896116-95896138 CAGAACCATGCTCCCTGCAGAGG - Intronic
1088358610 11:108968523-108968545 CAGAGCCATGCTCCCTCCGAAGG - Intergenic
1089520738 11:119061389-119061411 CAGAACCATGCTCCCACCAGGGG - Intergenic
1089643190 11:119860982-119861004 CAAAGCCATGGACTTGCCAGAGG + Intergenic
1091134550 11:133177014-133177036 CTGTGCCATCATCCTGCCAGCGG + Intronic
1091235664 11:134020582-134020604 CAGAGGAATGCTCGTGCAAGCGG - Intergenic
1092293218 12:7177752-7177774 CAGAGCTATGCTCCTTCTGGAGG - Intergenic
1093084209 12:14848567-14848589 CAGAGAATTGCTGCTGCCAGTGG - Intronic
1093466842 12:19458257-19458279 CAGACCCATGCTGCCACCAGTGG - Intronic
1094045159 12:26159080-26159102 TAGAGCCAGGCTCCAGCCATGGG - Intronic
1096312405 12:50532778-50532800 CAGCGCCCTGCTCCTTCTAGAGG - Intronic
1096474716 12:51901269-51901291 CAAAGCCAAGCTCAAGCCAGGGG + Intergenic
1096657741 12:53102194-53102216 CAGCTCCATGTTCCTTCCAGTGG - Exonic
1096673009 12:53211317-53211339 GAGAGCCAAGCACCTGGCAGAGG + Exonic
1099864230 12:88258813-88258835 GAGAGCAAAGCTCCTGCCATAGG - Intergenic
1101505320 12:105340950-105340972 CAGATCCAAACTCCTTCCAGAGG - Intronic
1102551708 12:113696227-113696249 GGGAGCCATGCTCCATCCAGGGG - Intergenic
1104371640 12:128228749-128228771 CTGAGCCCTGTTCCTGCCAAAGG + Intergenic
1104481440 12:129111303-129111325 CAGGGCCATACTCCTTCCAGAGG - Intronic
1104930454 12:132336727-132336749 CAGAGGCCCGCTCCTGGCAGTGG + Intergenic
1106029835 13:25990085-25990107 CAAGGCCTTTCTCCTGCCAGAGG - Intronic
1106478539 13:30118758-30118780 CAGGGCTATGCTCCCTCCAGAGG - Intergenic
1108464432 13:50700563-50700585 CACAGCCATGCCGCTGTCAGGGG - Intronic
1109956926 13:69580923-69580945 CTGAGCCATCCTCCTGGCATAGG - Intergenic
1111912548 13:94328602-94328624 CAGGGCCATGCTGCTGGCTGTGG - Intronic
1112002341 13:95222465-95222487 CAGGGCCATGCAGATGCCAGTGG - Intronic
1112143569 13:96673023-96673045 CAGGGCCATGCTCCTTCCAGGGG + Intronic
1112598774 13:100834130-100834152 CAGGGCCATGCCCCCTCCAGAGG + Intergenic
1112889971 13:104217694-104217716 CAGAGCCACACTCCTGAGAGTGG - Intergenic
1112901616 13:104363898-104363920 CTGCACCATGCTACTGCCAGGGG + Intergenic
1113470513 13:110541665-110541687 CAGAGCCCTTCGCCTGCCTGGGG + Intronic
1114724439 14:24920641-24920663 TAGAGCCATACTGCTCCCAGAGG + Intronic
1115467153 14:33728040-33728062 CAGAGTCAAGCTGCTACCAGTGG - Intronic
1115671204 14:35613530-35613552 CAGGGCCATGCACCTTCCAAAGG + Intronic
1115768362 14:36646813-36646835 CAGAGCAAGGTTCCTTCCAGAGG + Intergenic
1116669805 14:47826940-47826962 CTGAGCCATGATCATGCCACTGG - Intergenic
1116914272 14:50507232-50507254 CAAGGCCATCCTGCTGCCAGGGG + Intronic
1116944495 14:50823578-50823600 CAGGGCCACGATCTTGCCAGGGG + Intronic
1117012812 14:51488180-51488202 CAGAGACGGGCTCCTGCCAATGG - Intergenic
1117058064 14:51933082-51933104 CAGAGCCATGCTCCTGCCAGAGG - Intronic
1117381964 14:55173324-55173346 TCAAGCCATCCTCCTGCCAGTGG - Intronic
1117859239 14:60072989-60073011 CAGTGCCATGCTGCTGCCACAGG + Intergenic
1118434534 14:65757477-65757499 AACAGCCATGCTCCTGCCTCAGG - Intergenic
1119473852 14:74915901-74915923 CAGAGCCTGGCTCCTGCACGAGG + Intronic
1120247415 14:82023481-82023503 CAGGGCTATGCTCCCTCCAGAGG - Intergenic
1120287786 14:82526685-82526707 CAGTGCCAAGCTACTGCCAGAGG + Intergenic
1120980399 14:90284126-90284148 CAGTGCCTGGCTCCTTCCAGAGG + Intronic
1121171138 14:91855357-91855379 CAGGGCCATGCTCCCTCCAGAGG + Intronic
1121211752 14:92212542-92212564 CAGAGCCAGGCTCCCTCCAAAGG - Intergenic
1121913113 14:97810418-97810440 CAGAGCCGTGCTCCCTCCAGAGG + Intergenic
1122326760 14:100885308-100885330 CAGAGCCCTGAGCCTGCCAGGGG - Intergenic
1122982636 14:105198535-105198557 CAGAGCCTTGCTCCTGTCCCTGG - Intergenic
1123457901 15:20442742-20442764 CAGGGCCATGCTTCTTCCACAGG - Intergenic
1123660168 15:22557667-22557689 CAGGGCCATGCTTCTTCCACAGG + Intergenic
1124264049 15:28217895-28217917 CAGGGCCATGCTTCTTCCACAGG - Intronic
1124291507 15:28456751-28456773 CAGAGCCAGGGTGGTGCCAGGGG + Intergenic
1124314027 15:28652162-28652184 CAGGGCCATGCTTCTTCCACAGG + Intergenic
1124370241 15:29100566-29100588 AAGAGTCATGGGCCTGCCAGAGG + Intronic
1125159747 15:36629076-36629098 CAAGGCCATGCTCCCTCCAGAGG - Intronic
1126713062 15:51483284-51483306 CAGAGCAGTGCGCATGCCAGAGG - Intronic
1127427143 15:58867648-58867670 CAGAGCCACGTTCCTTCCTGAGG + Intronic
1128879301 15:71228368-71228390 CAGGGCCATGCTCCTTTCAGAGG - Intronic
1129118960 15:73383358-73383380 CAGAGCCACGCTCCCTCCAGAGG - Intergenic
1129667061 15:77585190-77585212 CAGGGCCATCCCCCTGCAAGTGG + Intergenic
1129738255 15:77977486-77977508 CAGAGCCAAGCTCCTGCAATCGG - Intergenic
1129847819 15:78776107-78776129 CAGAGCCAAGCTCCTGCAATCGG + Intronic
1130000580 15:80043234-80043256 CAAAGCCATTCTCCTGTCAATGG - Intergenic
1130154865 15:81341585-81341607 CAGAACCATGTTCCTGCATGGGG - Intronic
1130254088 15:82317808-82317830 CAGAGCCAAGCTCCTGCAATCGG - Intergenic
1130330746 15:82920449-82920471 CAGGGCCATGCTGCCTCCAGAGG + Intronic
1130600884 15:85272163-85272185 CAGAGCCAAGCTCCTGCAATCGG + Intergenic
1130882107 15:88064205-88064227 CAGAGCCATGCTCCTGCCAAAGG - Intronic
1130907876 15:88252791-88252813 CAGAGCCACGCTCCTCCAAAGGG - Intronic
1130962874 15:88675740-88675762 ATGAGCCATGATCCTGCCACTGG - Intergenic
1131647244 15:94358631-94358653 CAGAAACATGCTCCCGCCACTGG - Intronic
1133025685 16:2988115-2988137 CAGAGCTAGACTCCTGCCACAGG + Intergenic
1133460607 16:5983571-5983593 CTGAGCCATCCTCCTGCCCAGGG - Intergenic
1134625473 16:15719831-15719853 GAGAGCCATGCTCGTGCAATGGG - Intronic
1135901594 16:26464933-26464955 CCTAGCCCTGCCCCTGCCAGAGG + Intergenic
1136271885 16:29153494-29153516 CCGAGCCATACTCCCTCCAGAGG + Intergenic
1136298686 16:29318758-29318780 GAGAGCCCAGCTGCTGCCAGAGG - Intergenic
1136702381 16:32156143-32156165 CAGGGCCATGCTCCCTCCACAGG - Intergenic
1136707269 16:32200918-32200940 CAGAGCCAGGGTGGTGCCAGGGG - Intergenic
1136760641 16:32728499-32728521 CAGAGCCAGGGTGGTGCCAGGGG + Intergenic
1136765286 16:32771345-32771367 CAGGGCCATGCTCCCTCCACAGG + Intergenic
1136802813 16:33099039-33099061 CAGGGCCATGCTCCCTCCACAGG - Intergenic
1136807462 16:33141887-33141909 CAGAGCCAGGGTGGTGCCAGGGG - Intergenic
1141672653 16:85500811-85500833 CAGAGCCATGCTCCCTCTAAAGG + Intergenic
1141747170 16:85933519-85933541 CAGAGCCGTACTCTTCCCAGAGG + Intergenic
1141897283 16:86966189-86966211 CAGGGCCGTGCTCCCTCCAGAGG + Intergenic
1141996000 16:87636687-87636709 CAGAGCTATGTTCCCACCAGGGG + Intronic
1142060347 16:88025255-88025277 GAGAGCCCAGCTGCTGCCAGAGG - Intronic
1142151326 16:88513758-88513780 CAGCACCAGGCTCCTTCCAGAGG + Intronic
1203062793 16_KI270728v1_random:988813-988835 CAGAGCCAGGGTGGTGCCAGGGG + Intergenic
1203067674 16_KI270728v1_random:1033578-1033600 CAGGGCCATGCTCCCTCCACAGG + Intergenic
1142887480 17:2921767-2921789 CAGGGCCATGTTCCCGCCAGAGG + Intronic
1142970716 17:3609733-3609755 CACAGACATGCTCCTGGCAAGGG + Exonic
1143384973 17:6523735-6523757 CATAGCCATGTATCTGCCAGTGG - Intronic
1143513115 17:7406587-7406609 CAGAGCCAGGCGCCAGCCCGCGG - Intronic
1143885989 17:10065417-10065439 TAGGGCCATACTCCTCCCAGAGG + Intronic
1144095601 17:11897933-11897955 CAGGGCCGTGCTCCCTCCAGAGG + Intronic
1144520623 17:15950286-15950308 GTGGGCCACGCTCCTGCCAGAGG - Intronic
1144579276 17:16449051-16449073 CAAAAGCGTGCTCCTGCCAGTGG + Intronic
1144592225 17:16534355-16534377 CAGGGCCATGCTCCCTCCAAAGG + Intergenic
1145191041 17:20842352-20842374 CAGAGCCAGGGTGGTGCCAGGGG - Intronic
1145780058 17:27556997-27557019 GAGTGCCAAGGTCCTGCCAGTGG + Intronic
1146559373 17:33854964-33854986 CTGACCCAGGCTCCTGCTAGGGG + Intronic
1146677965 17:34786281-34786303 CAGAGCCAAGCCCCTGCCAGCGG - Intergenic
1146691105 17:34876760-34876782 CACAGCAATGCCCCTGCCAAAGG + Intergenic
1148208941 17:45796554-45796576 TGGAGCCATGCTCCTGCCCCTGG - Intronic
1148386806 17:47239953-47239975 CAGAGGAGCGCTCCTGCCAGGGG + Intergenic
1148893922 17:50829006-50829028 CAGGGCCACGCTCCCTCCAGAGG + Intergenic
1149949596 17:60971668-60971690 CAGTGGCATGCTTCTGACAGTGG + Intronic
1151551067 17:74822835-74822857 CTGAGCCACGCTGCTGCCCGGGG - Intronic
1151915589 17:77115545-77115567 CAGACCCTTGCTCCTGACTGTGG + Intronic
1151954902 17:77375299-77375321 CAGAGCTCTCCTCCTGCCTGCGG + Intronic
1152000528 17:77642467-77642489 CAGGGTCGTGCTCCTGGCAGAGG + Intergenic
1152565424 17:81098111-81098133 GGGAGGCATGCTCCTCCCAGAGG + Intronic
1152706290 17:81845271-81845293 CAGAGCCAATCTCCTGGCATTGG + Intronic
1154528105 18:15313552-15313574 AAGAGCCTTGATCCTCCCAGTGG + Intergenic
1155472306 18:26203944-26203966 CTGAGGCATGCTCCTGCCCCAGG + Intergenic
1156851906 18:41738190-41738212 CAAGACCATGCTCCTTCCAGTGG - Intergenic
1157430493 18:47620432-47620454 CAGGGCCATGCTCCCTCCAAAGG + Intergenic
1157441359 18:47714220-47714242 GAAAGCCAAGCTCCAGCCAGTGG - Intergenic
1158916006 18:62130125-62130147 CAGAACCATGCTCCCTCCAAAGG - Intronic
1158957119 18:62550881-62550903 TGGAGCCATGGTGCTGCCAGAGG + Intronic
1159118039 18:64137273-64137295 CAGGGCCATGCTCCATCCAAAGG - Intergenic
1159808754 18:72990352-72990374 CAGAGCCATCCTCCCCACAGAGG - Intergenic
1159880625 18:73855334-73855356 CACAGACAAGCTCCTGCCAGAGG - Intergenic
1160113564 18:76056621-76056643 CCGAGCCATGCTCCGGCCCCTGG - Intergenic
1160243132 18:77137039-77137061 CAGCGCTGTGCTCCTGCCAGGGG - Intergenic
1160552905 18:79706374-79706396 CAGTGCCAGGCACCTCCCAGAGG + Intronic
1160865292 19:1253440-1253462 CAGAGCCCTGCTCTCCCCAGTGG - Intronic
1160993972 19:1873395-1873417 CACAGCCATGCTCCAGCCACTGG + Intergenic
1160995160 19:1879071-1879093 CAGAGCCAGGGTGGTGCCAGGGG + Intronic
1161143029 19:2660021-2660043 CAGAGCCATCCTCCTCACCGAGG + Intronic
1161371310 19:3913514-3913536 CAGGGCCATGCACCTGACATGGG - Intronic
1161654168 19:5503474-5503496 CAGGGCCATGCTCCCTCCAAAGG + Intergenic
1161749304 19:6082846-6082868 CAGAGCCATGCTAGAGCCTGGGG + Intronic
1161802238 19:6422785-6422807 CAGACACTTCCTCCTGCCAGTGG + Intronic
1162473380 19:10885735-10885757 CAGAGCCAGGCTCCTGCAGAGGG - Intronic
1163821083 19:19496912-19496934 CAGAGCCTTGCTCTTGTCTGAGG - Intronic
1163919620 19:20276377-20276399 CACAGCCATTTTCCTGCCAAGGG + Intergenic
1164606252 19:29600358-29600380 CAAAGCCATGCTGCGGGCAGGGG - Intergenic
1165079828 19:33300893-33300915 CTGAGCCCTCCTCCTGCCACGGG + Exonic
1165132093 19:33639366-33639388 CAGTGCCATGCCCCTGCCCCTGG - Intronic
1165661659 19:37586013-37586035 CAGAGCCATGTTCCTTCTGGAGG - Intronic
1166417516 19:42606988-42607010 CAGAGTCAGGCTCCTCCCTGGGG - Intronic
1166545479 19:43632381-43632403 CAGGGCCATTCTCCACCCAGTGG + Intronic
1167026310 19:46921586-46921608 CAGAGCGGTGATCCTGCCCGGGG - Exonic
1167142826 19:47664040-47664062 CAGAGTCAGGCTTCTGCGAGCGG + Intronic
1167548806 19:50145337-50145359 CACGGCCATGCTCCCTCCAGAGG - Intergenic
925472580 2:4178571-4178593 CAGATCTATGCTCCTGACACGGG - Intergenic
925742682 2:7019608-7019630 CAGAGCCTTGCTGCTCCCTGGGG + Intronic
926147541 2:10405747-10405769 CAGGGCGCTGCTCCTGCCCGAGG - Intronic
926759190 2:16262238-16262260 CAGAGCCCTGCTCCTCCCCAAGG - Intergenic
927872444 2:26632165-26632187 GAGAGCCAGCCTCCTTCCAGTGG + Intronic
927949339 2:27156786-27156808 CCTAGCCAGGCTCCTCCCAGAGG - Exonic
928180005 2:29062294-29062316 CAGGGCGAGGCTCCTGCCATAGG - Exonic
928246663 2:29635533-29635555 CAGAGCCATTCTCCCTCAAGAGG - Intronic
928366962 2:30710216-30710238 CAAAGCCATGCTCTTTCCATTGG - Intergenic
928375248 2:30768504-30768526 CAGAGCCTTGCTCCAGCCCCTGG + Intronic
929122439 2:38494551-38494573 CAGAGGCATGATTCAGCCAGAGG - Intergenic
929999940 2:46854527-46854549 CAGAGACATGCCATTGCCAGTGG + Intronic
930040831 2:47121710-47121732 CAGGGCCATGCTCCCTCCAGAGG + Intronic
933190506 2:79328842-79328864 CAGGGCCAAGCTCCCTCCAGAGG + Intronic
933992645 2:87644453-87644475 CAGGAGCATGGTCCTGCCAGGGG - Intergenic
934220921 2:90081991-90082013 CAGAGACATGCTCCGTGCAGTGG + Intergenic
935072427 2:99706489-99706511 CAAAGCCAGGCTCTTTCCAGAGG - Intronic
935586443 2:104803998-104804020 CACAACCATGCTCATCCCAGAGG + Intergenic
936301208 2:111306388-111306410 CAGGAGCATGGTCCTGCCAGGGG + Intergenic
936475310 2:112834580-112834602 CAGAGCCAAGCTGCTGGAAGAGG + Intronic
937017979 2:118623665-118623687 CAGAGCCATGCTCCCTCGGGAGG + Intergenic
937205911 2:120237082-120237104 CAGAGCCAGGCGCCTGGCAGAGG + Intergenic
937310323 2:120898496-120898518 CAGAGCCATGCTTCAGGGAGGGG + Intronic
937898867 2:127000777-127000799 CAGGGCCATGCTCCCTCCAAAGG + Intergenic
938407083 2:131038698-131038720 GAAAGCCCTGCTCCTGTCAGAGG + Intronic
938738340 2:134206845-134206867 CAGGGCCGTGCTCCCTCCAGAGG - Intronic
939886540 2:147686992-147687014 CAGAGCCATGCTCTCTCCAAAGG - Intergenic
941080887 2:161059295-161059317 CAGCGCCAGGCTACTGCCACAGG + Intergenic
941548067 2:166878678-166878700 CAGAGCCATTCCCCTTCTAGAGG - Intergenic
944329733 2:198451549-198451571 CACTGCCATTCTTCTGCCAGTGG + Intronic
945529285 2:210930590-210930612 CAGGGCTAAGCTCCTTCCAGTGG + Intergenic
945792806 2:214326351-214326373 CAGGGCCATGCTCCCTTCAGAGG - Intronic
946397421 2:219449919-219449941 CAGAGCCATTCTCCTGTTGGTGG - Intronic
947823906 2:233091429-233091451 CAGAGCTGAGCTCCTTCCAGAGG + Intronic
948126255 2:235566881-235566903 CAGAGCTGTGCTCCCTCCAGAGG + Intronic
948525903 2:238570621-238570643 CAGAGTCTTGCTCCCTCCAGAGG - Intergenic
948805182 2:240450868-240450890 ACAAGCCATGCTCCTTCCAGAGG - Exonic
948942908 2:241204872-241204894 CACAGGCTGGCTCCTGCCAGCGG + Exonic
1171062640 20:21981262-21981284 CAGAGCCATGCATCAGACAGTGG + Intergenic
1171101262 20:22385498-22385520 CACAGCCAGGCTCCCTCCAGGGG - Intergenic
1171837070 20:30167332-30167354 CAGAACCATGCCACTGCCACGGG + Intergenic
1172637861 20:36422120-36422142 CAGGGCCTTGCTGCTGCCTGGGG - Intronic
1173034533 20:39395929-39395951 CAGAGGCCAGCTGCTGCCAGAGG + Intergenic
1173035008 20:39400401-39400423 CAGAACCATGCTCCTTCTAACGG - Intergenic
1173064021 20:39692199-39692221 CAGGGTCCTGCTCCTACCAGAGG - Intergenic
1173257431 20:41404833-41404855 CAGAGCCATGCCCATACCAGGGG + Exonic
1175269456 20:57723569-57723591 CAGGGCCAGGCTCCCTCCAGAGG - Intergenic
1175408265 20:58749312-58749334 CAGGACCCAGCTCCTGCCAGTGG - Intergenic
1175488862 20:59365243-59365265 CAGAGTCAGGCCCCTGTCAGAGG - Intergenic
1175630772 20:60534637-60534659 CAGGGCCACACTCCTACCAGAGG - Intergenic
1175764348 20:61582386-61582408 CAGGGCCATCCCCCTGCCTGGGG + Intronic
1175962711 20:62645262-62645284 CTGAGCCTTGGCCCTGCCAGGGG + Intronic
1175986345 20:62765859-62765881 CAGAGCCAAGCTGCTGCCCCAGG + Intergenic
1176960993 21:15158576-15158598 CAGAGCCATCCTGCCCCCAGAGG - Intergenic
1177289066 21:19086614-19086636 CAGTGCCATAATCCTTCCAGGGG - Intergenic
1177772167 21:25529279-25529301 CAGGGCCATTCGCCTTCCAGAGG + Intergenic
1178454075 21:32730500-32730522 CAGGGCCATGCTCCTTCCAAAGG - Intergenic
1179176872 21:39014246-39014268 CAGTGCCAGGCACCTGACAGTGG - Intergenic
1179288727 21:39999954-39999976 CAGAGCCATGCTCCCTCCGAAGG + Intergenic
1181256590 22:21566873-21566895 CAGAGCCAGGCTCCTGTCACAGG - Intronic
1181334186 22:22116634-22116656 CAGAGCCAGGGTGGTGCCAGGGG + Intergenic
1181571658 22:23771246-23771268 CAGAGCCACGATCCAGGCAGTGG - Intronic
1181577003 22:23801564-23801586 CAGGGCCATGCTCCCTCCAGAGG + Intronic
1181626423 22:24125205-24125227 TAGAGACAGACTCCTGCCAGGGG + Intronic
1181631311 22:24153060-24153082 CAGAGCTAGGCTGCTGCCAAAGG - Intronic
1182555175 22:31125284-31125306 CAGGGCCAGGCTCAGGCCAGAGG - Exonic
1183182343 22:36268545-36268567 GTGAGCCATGCTCATGCCACGGG - Intergenic
1183240775 22:36656757-36656779 AAGAGCCATGCTCATGTCTGGGG - Intronic
1183442894 22:37833266-37833288 CACAGCCCTGCTCCCTCCAGTGG - Intronic
1183609789 22:38891955-38891977 CAGTGCTTTGGTCCTGCCAGAGG - Intergenic
1184294003 22:43512480-43512502 CAAGGCCATCCCCCTGCCAGTGG + Intergenic
1184435134 22:44468629-44468651 CGGGGCCATGCTCCCTCCAGAGG + Intergenic
1184743577 22:46443281-46443303 CAGAGCCAGGCACAGGCCAGGGG + Intronic
1185220531 22:49627232-49627254 CAGACCCATGCTCCATGCAGGGG + Intronic
949369827 3:3322589-3322611 CAGGGCCAGGCTCCCTCCAGGGG - Intergenic
949939020 3:9139554-9139576 CAGAGCCACACTCCCTCCAGCGG - Intronic
953542867 3:43837725-43837747 AAAGGCCATGCTCCTTCCAGAGG + Intergenic
954644795 3:52124565-52124587 CAGAGTCATTCTCCTGCCCTGGG - Intronic
954653473 3:52179298-52179320 CAGAGCCATTCTCCTTCCAAAGG + Intergenic
954924172 3:54217714-54217736 CAGGGCCATGTTCCTTCCAAAGG - Intronic
956455603 3:69417819-69417841 CAGAGCCATACTTCCTCCAGAGG + Intronic
957271334 3:78033841-78033863 CAGGGCCAAGCTCCTTCCTGAGG - Intergenic
958537975 3:95428837-95428859 CAGAAACATGTTCCAGCCAGAGG + Intergenic
960332408 3:116377956-116377978 AAGAGCCATGCTGATGCCTGGGG - Intronic
962686824 3:137856006-137856028 CAGGGCCATGCTCTTGCCAAAGG + Intergenic
962862879 3:139420747-139420769 CAGAGCCATGATCCTACCACAGG - Intergenic
963274568 3:143317302-143317324 CAGAGACAAGCTCCTGCCCGAGG + Intronic
964032202 3:152151714-152151736 GAGAGCCCTAATCCTGCCAGAGG - Intergenic
965156825 3:165070873-165070895 CAGAGCCATGCTGCCTCCAAAGG + Intronic
966321631 3:178707425-178707447 AAGTGCCATGCTCTTGGCAGGGG + Intronic
966644289 3:182226068-182226090 CAGAGCCATGTTCCTTCTGGAGG + Intergenic
967136334 3:186515839-186515861 CAGAGTCATCAGCCTGCCAGTGG - Intergenic
967571420 3:191033101-191033123 CAGAGCCATTCTCCCTCCAGAGG - Intergenic
968185152 3:196627963-196627985 CACAGCCATGGTCATGCCAGGGG + Intergenic
968359384 3:198136785-198136807 GAGAGCCAAGCACCTTCCAGGGG + Intergenic
968899642 4:3425281-3425303 CTGAGCCATGCTCCTGACATGGG - Intronic
969317571 4:6391197-6391219 GGGACCCAGGCTCCTGCCAGAGG - Intronic
969579431 4:8055502-8055524 CACAGCCATGCACCTAGCAGAGG - Intronic
969607395 4:8209423-8209445 CAGGGCCCTGTTCCTCCCAGGGG - Intronic
969623843 4:8292590-8292612 CAGGGCCATGTGCCTGTCAGGGG + Intronic
970363830 4:15337834-15337856 TACAGCCAGCCTCCTGCCAGTGG + Intergenic
970695355 4:18670373-18670395 CAGGGCTGTGCTCCTTCCAGAGG - Intergenic
972829647 4:42800615-42800637 CAGAGCCATGTTCCTTCTAGAGG + Intergenic
973706794 4:53588990-53589012 CAGGGGCTTCCTCCTGCCAGAGG + Intronic
976339711 4:83933617-83933639 CAGAGCCATGCTCTTGCTGAAGG + Intergenic
976628502 4:87212523-87212545 GTGAGCCATGATCTTGCCAGTGG + Intronic
978649535 4:110983917-110983939 CAGAGCCAGGCTCAAGCCTGAGG + Intergenic
980225926 4:129985664-129985686 CAGTTTCATGCTCCTGCCACAGG + Intergenic
980554982 4:134391959-134391981 CAGGGCCATCCTCCTTCCAAAGG - Intergenic
982356382 4:154474018-154474040 CAGGGCCATGCTCCCTCCAAGGG + Intronic
983489251 4:168368747-168368769 CCGAGCCATGCTGATGCAAGAGG - Intronic
983987651 4:174079615-174079637 CAGAGCCACACTACTTCCAGAGG + Intergenic
984450894 4:179900014-179900036 CATAGCCATGTTCCTTCCAAAGG + Intergenic
984460865 4:180034841-180034863 CAGTTCCCTGATCCTGCCAGAGG - Intergenic
984595976 4:181668458-181668480 CAGGGCCATGCTCCATCCAAAGG + Intergenic
985971283 5:3380652-3380674 CAGAGCCACTCTCCCTCCAGGGG - Intergenic
986283914 5:6346124-6346146 AAGAGCCATGGTCCTGCTTGTGG - Intergenic
986778738 5:11045072-11045094 CAGGGCCATGCTCCCGCCTAAGG + Intronic
987976186 5:25018132-25018154 GTGAGCCATGGTCCTGCCACTGG - Intergenic
988556574 5:32241269-32241291 CAGAGCCCTGCACATGGCAGAGG + Intronic
988994585 5:36702714-36702736 CAGGGCCATTCTCCCTCCAGAGG + Intergenic
990165377 5:52988937-52988959 CAGCGCCCGGCTCCTGGCAGCGG - Intergenic
990310138 5:54529996-54530018 CAGTGCCATGCTCCCTTCAGAGG + Intronic
992366272 5:76093329-76093351 CAGAGTCTTGCTTCTGCCAGTGG + Intronic
993806013 5:92410307-92410329 CTGAGCCATGATCATGCCACTGG + Intergenic
994101891 5:95902835-95902857 GTGAGCCATGTTCCTGCCACTGG - Intronic
994166909 5:96618054-96618076 CTAAGCCAAGCTCCTGCCACTGG - Intronic
996416987 5:123221241-123221263 CAAAGCCATGCTGCTACCTGAGG + Intergenic
997378876 5:133421114-133421136 CACACCCAGGCCCCTGCCAGGGG - Intronic
997426382 5:133805394-133805416 TTGTGCCATGCTCCAGCCAGAGG + Intergenic
997846116 5:137287364-137287386 CAGAGGCATGCTCCTGCCTCAGG + Intronic
999804548 5:155069675-155069697 CAGGGCCGTGTTCCTTCCAGGGG - Intergenic
1000828210 5:166072464-166072486 CAGAGCCAAGATCCTAACAGAGG + Intergenic
1001096473 5:168779389-168779411 AAGAGCCATGCTCCCATCAGAGG + Intronic
1001250041 5:170140132-170140154 CAGAGCCAAGCTCCCTCCTGAGG + Intergenic
1002164941 5:177338309-177338331 CAGAGCCAGGCTCCTTCCGGAGG + Intronic
1002309984 5:178308585-178308607 CAGGCCCATGCTCCTGGCCGAGG + Intronic
1004279485 6:14268922-14268944 CAGGGCCATGCTCCTTCCAAAGG + Intergenic
1005087510 6:22022110-22022132 CAGGGCTGAGCTCCTGCCAGAGG + Intergenic
1005886176 6:30099448-30099470 CAGAGCCATGCTCTCTCCAAAGG - Intergenic
1006271432 6:32969514-32969536 CACAGCAATGCTCCCTCCAGAGG - Intronic
1006326746 6:33360072-33360094 GAGAGCCATGGGCCTGCCATGGG + Intergenic
1006937685 6:37729771-37729793 CAGGGCCATGCTCCCTCCAAAGG + Intergenic
1007136210 6:39524581-39524603 TAAAGCCATGCTCCTTACAGGGG + Intronic
1009427252 6:63528036-63528058 CATAGCCATGCTCTTGGCTGGGG - Intronic
1013094883 6:106935675-106935697 CAGGGCCATGCTCTCTCCAGGGG + Intergenic
1014563519 6:122919272-122919294 CAGAGCTATACTGCTTCCAGAGG - Intergenic
1014713531 6:124837961-124837983 CTGTGCCATCCTCCTGCCAAGGG + Intergenic
1015048814 6:128813897-128813919 TAGGGCCATACTCCTTCCAGAGG + Intergenic
1015860473 6:137673357-137673379 CTGAGCCATGTTCATGGCAGAGG + Intergenic
1015950685 6:138549532-138549554 CAGAGTCCTGCTCCCACCAGAGG - Intronic
1016149435 6:140721205-140721227 ATGAGCCATGATCCTGCCACTGG + Intergenic
1017064431 6:150516400-150516422 AAGAGCCATGCTTCTCCCAGGGG - Intergenic
1017331940 6:153209541-153209563 CAGGGCCATGCCCCCTCCAGAGG + Intergenic
1017729929 6:157306159-157306181 AAGGTCCATGCTGCTGCCAGAGG - Intronic
1017818477 6:158031797-158031819 ATGAGTCATCCTCCTGCCAGAGG + Intronic
1018995726 6:168709143-168709165 CAAAGCAATGCTATTGCCAGTGG - Intergenic
1019260613 7:79891-79913 GAGAGCCAAGCACCTTCCAGAGG - Intergenic
1019713428 7:2527674-2527696 CTGAGCCATGCTCATTGCAGGGG + Exonic
1020920103 7:14252771-14252793 CAGAACCATGCCAATGCCAGTGG - Intronic
1024353665 7:48393310-48393332 CAGAGCCATGCATCTTCCTGAGG - Intronic
1024582091 7:50808648-50808670 CAGGGCCACGCTCCTTCCAGGGG - Intergenic
1026975057 7:74492744-74492766 CAGTGCCATGCTCCCTCCAGAGG + Intronic
1027942641 7:84704541-84704563 CAGGGCCATGCTCCCTCCAGAGG + Intergenic
1031221173 7:118967739-118967761 TAGAGCCACGCTGTTGCCAGGGG + Intergenic
1031337640 7:120555429-120555451 CAGGGACATGCTCCTGCAATTGG + Intronic
1031914943 7:127554196-127554218 CAGAGCCATGCTCCCTCTAAAGG + Intergenic
1032457006 7:132080721-132080743 CAAAACCAACCTCCTGCCAGAGG - Intergenic
1033535926 7:142312324-142312346 CAGAGCACAGCTCCTGCCTGTGG - Intergenic
1034324672 7:150220019-150220041 CAGAGCCCTGCTGCTGGCCGCGG + Intergenic
1034768520 7:153749212-153749234 CAGAGCCCTGCTGCTGGCCGCGG - Intergenic
1034882495 7:154773186-154773208 CCCAGCCATGCCCCTCCCAGAGG - Intronic
1035017128 7:155776383-155776405 TAGCGCCATGCTCCCTCCAGGGG - Exonic
1035469168 7:159098653-159098675 CAGAGCCCTTCTCCTCCCAGGGG + Intronic
1035685872 8:1523185-1523207 CGGGCCCATGGTCCTGCCAGGGG + Intronic
1035712687 8:1730604-1730626 CAGTGCCATCCTCCTATCAGAGG + Intergenic
1036795933 8:11756949-11756971 GAGAGCCTTCCTCCCGCCAGCGG + Exonic
1037567300 8:20128628-20128650 CAGGGCCATACTACTGCCAAGGG - Intergenic
1039428701 8:37507999-37508021 CTGAGCAAGGCACCTGCCAGGGG - Intergenic
1039808744 8:41026187-41026209 TAGAACAATGCTCCTGGCAGAGG - Intergenic
1041858593 8:62485068-62485090 CAGAGCCCTGCCCCTCTCAGGGG + Intronic
1042591743 8:70403566-70403588 CAGAGCCGTGCGCCTCCGAGAGG - Intronic
1043927957 8:86059422-86059444 CAGAGCTGTGTTCCTTCCAGAGG + Intronic
1044351225 8:91168625-91168647 CTGTGCAATGCTGCTGCCAGAGG - Intronic
1046412196 8:113859988-113860010 CAGAGGCAGGCTCCAGCAAGTGG - Intergenic
1046754181 8:117956224-117956246 CAGAGCCAGGCCCGTGCCAAGGG - Intronic
1046754345 8:117957520-117957542 CAGAGCCAGGCCCGTGCCAAGGG - Intronic
1047194871 8:122712442-122712464 CAGAGGCCTCCTCCTCCCAGAGG + Intergenic
1047200413 8:122760519-122760541 CTCAGCCATCCTCCTGCCAAGGG + Intergenic
1047887197 8:129264958-129264980 TAACGCCCTGCTCCTGCCAGAGG - Intergenic
1048047486 8:130786491-130786513 CAGGGCTGTGCTCCTTCCAGAGG - Intronic
1048993134 8:139773097-139773119 CAGAGGCGTGGTCCTGCCACGGG - Intronic
1049237509 8:141519439-141519461 CAGAGCCAGGCCTCTGGCAGGGG - Intergenic
1049368037 8:142250215-142250237 TACAGCCATTCTCCTGCCAGCGG + Intronic
1049416002 8:142495534-142495556 TAGGGCCATGCTCCTTCCAAAGG + Intronic
1049539033 8:143198263-143198285 CAGAGACAAGCGCCTGCTAGAGG + Intergenic
1049603344 8:143518162-143518184 CAGAGTCAGGCTCCTGTCTGGGG + Intronic
1055385397 9:75756810-75756832 CAGAGCCAGGCTTCCTCCAGAGG - Intergenic
1056846023 9:90039024-90039046 CAGAGCCATGCCCCTCCCCTTGG - Intergenic
1056920468 9:90783684-90783706 CAGAGCCAGTCTACGGCCAGTGG + Intergenic
1059445615 9:114336264-114336286 CAGAGGTATGCTGCTGCCACGGG + Exonic
1061012893 9:127965853-127965875 CAGCGTCTGGCTCCTGCCAGGGG + Intronic
1061044433 9:128157179-128157201 CAGAGCTATGATCCTGCCCAGGG - Intergenic
1061940752 9:133882594-133882616 CAGGGCCACGCTCCTTCCAGAGG - Intronic
1062389718 9:136329137-136329159 CTGAGCACTGCCCCTGCCAGGGG - Intronic
1062445541 9:136592610-136592632 CAGGGCCACGCTCCCTCCAGAGG - Intergenic
1062680516 9:137776788-137776810 CCGAGCCCTTCTCCTGCCCGGGG - Exonic
1062744071 9:138200499-138200521 GAGAGCCAAGCACCTTCCAGGGG + Intergenic
1185511241 X:666561-666583 CAGGGCCATGCTCCCTCCAGAGG - Intergenic
1185511262 X:666650-666672 CAGGGCCATGCTCCCTCCAGAGG - Intergenic
1185511280 X:666739-666761 CAGGGCCATGCTCCCTCCAGAGG - Intergenic
1185764598 X:2715352-2715374 CAGACCCATGCTCCCTCTAGGGG + Intronic
1185822665 X:3220035-3220057 CAGGGCCAAGCTCCCTCCAGAGG + Intergenic
1189435283 X:40987522-40987544 CAAAGACATGCTCCTGGCTGGGG - Intergenic
1192201574 X:69069662-69069684 CAGAGCCATGATCTTTCCATTGG + Intergenic
1192222939 X:69209814-69209836 TGGGGCCATGCTCCTTCCAGAGG - Intergenic
1193492480 X:82166297-82166319 CAGGGACATGCTTCTGGCAGAGG - Intergenic
1194157981 X:90416416-90416438 CTGCACCATGCTGCTGCCAGTGG + Intergenic
1194743288 X:97601837-97601859 CAAAGCCATGCTCCCTCCAGAGG + Exonic
1195253845 X:103074719-103074741 TAGAGCCATGCTCCATCCAAAGG - Intergenic
1195702233 X:107714325-107714347 CAGAGACCTGCTCTTGTCAGGGG + Exonic
1196691472 X:118563342-118563364 CCAAGCAATGCTCCTGCCACAGG - Intronic
1196963849 X:121033705-121033727 CAGGGCCATGCTCCTTCTAAAGG - Intergenic
1200088831 X:153624993-153625015 CACAGCCATGCTCGTGCTAAGGG + Intergenic
1200094320 X:153650197-153650219 CACTGCCCTGCTCCTGCGAGTGG - Exonic
1200504306 Y:3993385-3993407 CTGCACCATGCTGCTGCCAGTGG + Intergenic