ID: 1117058066

View in Genome Browser
Species Human (GRCh38)
Location 14:51933100-51933122
Sequence CTCTGCTGGCACCTTGATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6266
Summary {0: 2, 1: 82, 2: 594, 3: 1800, 4: 3788}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117058064_1117058066 -5 Left 1117058064 14:51933082-51933104 CCTCTGGCAGGAGCATGGCTCTG 0: 1
1: 1
2: 2
3: 57
4: 374
Right 1117058066 14:51933100-51933122 CTCTGCTGGCACCTTGATTTTGG 0: 2
1: 82
2: 594
3: 1800
4: 3788
1117058061_1117058066 3 Left 1117058061 14:51933074-51933096 CCCTAGAGCCTCTGGCAGGAGCA 0: 1
1: 2
2: 27
3: 177
4: 621
Right 1117058066 14:51933100-51933122 CTCTGCTGGCACCTTGATTTTGG 0: 2
1: 82
2: 594
3: 1800
4: 3788
1117058062_1117058066 2 Left 1117058062 14:51933075-51933097 CCTAGAGCCTCTGGCAGGAGCAT 0: 1
1: 2
2: 23
3: 130
4: 828
Right 1117058066 14:51933100-51933122 CTCTGCTGGCACCTTGATTTTGG 0: 2
1: 82
2: 594
3: 1800
4: 3788

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117058066 Original CRISPR CTCTGCTGGCACCTTGATTT TGG Intronic
Too many off-targets to display for this crispr