ID: 1117058158

View in Genome Browser
Species Human (GRCh38)
Location 14:51934041-51934063
Sequence GTTTAGAGTTGGATCCGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 31}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117058153_1117058158 27 Left 1117058153 14:51933991-51934013 CCAGCTTTCATGATGTGTGTTTA 0: 1
1: 1
2: 4
3: 20
4: 210
Right 1117058158 14:51934041-51934063 GTTTAGAGTTGGATCCGACCAGG 0: 1
1: 0
2: 0
3: 1
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117058158 Original CRISPR GTTTAGAGTTGGATCCGACC AGG Intronic
918086799 1:181252431-181252453 GTTTCTAGATGGATCCAACCAGG - Intergenic
920813560 1:209309506-209309528 TTTTAGAATTGGATCTGAGCAGG + Intergenic
1067485832 10:46649025-46649047 GTTCAGAGTTGTAGCCGATCAGG + Intergenic
1067608924 10:47692628-47692650 GTTCAGAGTTGTAGCCGATCAGG - Intergenic
1071624511 10:87154270-87154292 GTTCAGAGTTGTAGCCGATCAGG - Intronic
1079284346 11:19116007-19116029 GTTCAGAGATGGATCTGACATGG + Intergenic
1105803667 13:23935777-23935799 GTCCAGAGTTGGTTCCCACCTGG - Intergenic
1109436111 13:62305234-62305256 GTTTAGAGTTTCTTCTGACCTGG + Intergenic
1113580300 13:111423965-111423987 GCTTAGAGTTGGCTCCTTCCAGG + Intergenic
1117058158 14:51934041-51934063 GTTTAGAGTTGGATCCGACCAGG + Intronic
1118006515 14:61568636-61568658 GTTTAGAGTTGGAGTCAGCCCGG - Intronic
1120708115 14:87765644-87765666 GTTGAGAGTTGGAAGCGACCTGG - Intergenic
1121243715 14:92447939-92447961 GTTTTGAGATGGTTCTGACCTGG - Intronic
1134033645 16:11012960-11012982 GTCCAGAGTTGGCTCCCACCTGG - Intronic
1140466341 16:75186052-75186074 GTTTAGAGTGGGATCAGGCAGGG + Intergenic
929212025 2:39367674-39367696 GGTGAGAGTTTGATCCAACCTGG + Intronic
944620875 2:201514982-201515004 GTTTAGGGGTGCATCTGACCTGG - Intronic
949075790 2:242056992-242057014 GTTGAGAGCTGGCTCCGACTCGG + Intergenic
952461009 3:33525989-33526011 TTATAGAGTTTGATCTGACCAGG + Intronic
953365533 3:42341256-42341278 GTTTAGAGATGGCTCACACCAGG + Intergenic
954071916 3:48149260-48149282 GTTTAGAATTAGATCCAACTGGG - Intergenic
962731659 3:138289315-138289337 GTATAGAGTTGGCTCCAACGGGG - Intronic
969254461 4:5992805-5992827 GTTCACGGTTGGATCCGGCCAGG + Intergenic
976441128 4:85076022-85076044 GTTCAGGGTTGGGTCCCACCTGG - Intergenic
978497606 4:109376862-109376884 GTTTAGACTTGCATTCTACCTGG - Intergenic
989217887 5:38923807-38923829 GTTTACAGTTGGCTCAGAGCAGG + Intronic
1002441167 5:179265284-179265306 GTTCAGGGGTGGAGCCGACCAGG - Intronic
1006203681 6:32320300-32320322 GTCCAGAGTTGGATCTGTCCAGG - Intronic
1008826416 6:55699749-55699771 GTATAGAGTTGAATCCAAGCAGG + Intergenic
1017582852 6:155886274-155886296 CTTTTGGGTTGGATCCCACCTGG + Intergenic
1191046381 X:56142420-56142442 GTTTAGAGTTGGATGAGATATGG - Intergenic
1202328556 Y:23720518-23720540 GTTTATAGATGGATACAACCAGG - Intergenic
1202542215 Y:25949536-25949558 GTTTATAGATGGATACAACCAGG + Intergenic