ID: 1117068880

View in Genome Browser
Species Human (GRCh38)
Location 14:52038539-52038561
Sequence ACAGTGTCCCTGCCAAAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117068880_1117068888 27 Left 1117068880 14:52038539-52038561 CCTGACTTTGGCAGGGACACTGT 0: 1
1: 0
2: 1
3: 9
4: 137
Right 1117068888 14:52038589-52038611 CTGTTTCCAACTCAAGGGCAAGG 0: 1
1: 0
2: 2
3: 19
4: 203
1117068880_1117068886 22 Left 1117068880 14:52038539-52038561 CCTGACTTTGGCAGGGACACTGT 0: 1
1: 0
2: 1
3: 9
4: 137
Right 1117068886 14:52038584-52038606 TGCCTCTGTTTCCAACTCAAGGG 0: 1
1: 0
2: 0
3: 17
4: 203
1117068880_1117068885 21 Left 1117068880 14:52038539-52038561 CCTGACTTTGGCAGGGACACTGT 0: 1
1: 0
2: 1
3: 9
4: 137
Right 1117068885 14:52038583-52038605 CTGCCTCTGTTTCCAACTCAAGG 0: 1
1: 0
2: 2
3: 22
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117068880 Original CRISPR ACAGTGTCCCTGCCAAAGTC AGG (reversed) Intronic
902333460 1:15742259-15742281 TCTCTGTCCCTGCTAAAGTCTGG - Intergenic
906797201 1:48707751-48707773 AGTGTGTCACTGCCAGAGTCTGG - Intronic
907107405 1:51896382-51896404 ACAGTGTCACTCCTAAAGTAGGG + Intergenic
913045222 1:115068358-115068380 ACAATTTCCCTTACAAAGTCTGG + Intronic
916465994 1:165075291-165075313 ACCCTCTCCCTGCCAAAGCCTGG - Intergenic
918038790 1:180899539-180899561 ACTTTGTCCCTGCCACAGTGGGG - Intergenic
920790137 1:209082204-209082226 AGTGTGTCCCTTCCAAATTCAGG - Intergenic
923736692 1:236616143-236616165 ATAGAGTCCCTGCCAAATGCTGG + Intergenic
923879856 1:238091825-238091847 GTAGTATCCCTGCCCAAGTCAGG + Intergenic
1066095170 10:32065385-32065407 ACATTGCCCCTACCAATGTCAGG + Intergenic
1067744377 10:48924223-48924245 GAAGGGTCCCTGCCAAGGTCGGG - Intronic
1068638510 10:59374870-59374892 ACAGTGTTCATTCCAAAGCCCGG - Intergenic
1070272348 10:74968556-74968578 ACAATGAGCCTGCCAAAGTCAGG + Intronic
1070685643 10:78478384-78478406 CCAGTCTCCCAGCCTAAGTCTGG - Intergenic
1071060436 10:81564307-81564329 ATAGTGTCCATGCCTAAGTTGGG - Intergenic
1077500619 11:2908317-2908339 ACACTGTACCTGCCAAATACCGG - Exonic
1078455132 11:11469021-11469043 ACACTGTCCCTACCAAACCCTGG - Intronic
1078566306 11:12417709-12417731 ACAGAGTCCCTCCCAATGTTGGG + Intronic
1079012510 11:16841024-16841046 AGAGTGGCCCTGAAAAAGTCTGG - Intronic
1080651306 11:34224735-34224757 ACATAGTCCCTGGCAAAGACTGG + Intronic
1083409221 11:62480372-62480394 TCACTGTGCCTGGCAAAGTCAGG - Intronic
1083839171 11:65293697-65293719 ACAGTGTCCCTGCCACACCTTGG - Intronic
1090221798 11:125032972-125032994 ACAGTTACCCTGGTAAAGTCCGG + Intronic
1095528453 12:43156127-43156149 AAAGTGTCACTGACAAACTCTGG - Intergenic
1099529758 12:83763425-83763447 ACATTGTCCCTGCCTAGTTCTGG + Intergenic
1101941532 12:109102716-109102738 CCAGTGTCCCTTCCAAGGGCTGG + Intronic
1102575585 12:113854242-113854264 ACACCATCCCTGCCAAAGACGGG + Intronic
1102660375 12:114522007-114522029 TCCATGTCCCTGCCAAAGACAGG - Intergenic
1103827373 12:123750520-123750542 ACAGTGTCCCGTCCAAACCCTGG + Intronic
1104879581 12:132061266-132061288 CCAATGTCCCTGCCACAGTTGGG - Intronic
1106039408 13:26075374-26075396 GCACTGCCCCTGCCCAAGTCAGG - Intergenic
1106606453 13:31233795-31233817 TCGATGTCTCTGCCAAAGTCAGG + Intronic
1106950497 13:34878622-34878644 ACAGTTTCATTGCCAAAGTCAGG + Intergenic
1107165283 13:37276304-37276326 AGAGTTTCCATGCCAAGGTCAGG + Intergenic
1110132261 13:72022568-72022590 CCTGTATCCATGCCAAAGTCAGG - Intergenic
1111818696 13:93187552-93187574 ACAGTGAGCCTGACAGAGTCTGG + Intergenic
1113924386 13:113932378-113932400 AAAGTGGCCCTGCCAAGGGCTGG - Intergenic
1117068880 14:52038539-52038561 ACAGTGTCCCTGCCAAAGTCAGG - Intronic
1118329605 14:64805121-64805143 ACACTGACCCTGCCAACCTCAGG - Intronic
1119519258 14:75273706-75273728 ACAGTGGCAGTGCCAAAGACAGG - Intergenic
1122789721 14:104179120-104179142 ACTGTGTGCCTGCCAAGGCCTGG + Intronic
1125415477 15:39447947-39447969 GCAGTGCCCCTGCCAAAGGCAGG - Intergenic
1128757738 15:70194854-70194876 ACATGGTCCCTGCCAAAAACAGG - Intergenic
1129389638 15:75214120-75214142 CCAGGGTCCCTGCCAAGGCCAGG - Intergenic
1130845283 15:87738381-87738403 AGACTGACCCTGCCAATGTCAGG + Intergenic
1133925141 16:10186189-10186211 ACAGTGTCCCTTCCAATGAAGGG - Intergenic
1134756822 16:16674565-16674587 CCACTTTCCCTGCCAACGTCAGG - Intergenic
1134989246 16:18684598-18684620 CCACTTTCCCTGCCAACGTCAGG + Intergenic
1136361126 16:29780424-29780446 ACAGTGCCCCTGCCAAGGAGAGG - Exonic
1138585805 16:57969905-57969927 ACAGACTCTCTGCCAAAGCCCGG - Intronic
1140270482 16:73461057-73461079 ACAGTGACAATGCCAAATTCTGG - Intergenic
1142430239 16:90022572-90022594 GCAGCGGCCCTGCCAAAGGCGGG - Intronic
1150601841 17:66657788-66657810 ACAGAGTCCCTGCCATATTGGGG - Intronic
1150956956 17:69869746-69869768 CCAGAGTCCCTGCAGAAGTCTGG + Intergenic
1153756370 18:8287666-8287688 ACAGGCTCACTGTCAAAGTCAGG + Intronic
1154389061 18:13920952-13920974 ACAGTGTCTCTGCCACAGCTAGG - Intergenic
1156440546 18:37182972-37182994 ACAGTGCCTCTGCCAAAATGTGG + Intronic
1157549524 18:48571729-48571751 ACAGTGTCCAAGCAAAAGACTGG - Intronic
1159256026 18:65946799-65946821 GCAGTGTCAATGCCAAAGACAGG - Intergenic
1160411610 18:78678794-78678816 ACAGTATCCCCTCCAAATTCAGG - Intergenic
1161251818 19:3284909-3284931 GCAGTGTCTCGGCCACAGTCGGG - Exonic
1162158439 19:8695624-8695646 ACCCTGTCCCTGCCAGGGTCGGG - Intergenic
1166538575 19:43591471-43591493 ACATAGTCCCTGCTAGAGTCTGG + Exonic
925854886 2:8119657-8119679 ACAGAGTCCCTGCCTGATTCAGG + Intergenic
925971068 2:9107033-9107055 TCCGTCTCCCTGCCAAAGGCAGG + Intergenic
926890582 2:17635914-17635936 ACAGTGACCATGTCAAACTCTGG - Intronic
928294250 2:30069211-30069233 ACACTTTCACTGCCAAAGCCAGG + Intergenic
930441112 2:51407537-51407559 AAAGTTTCCCTGTAAAAGTCTGG + Intergenic
933993595 2:87651260-87651282 AGAGGGTCCCTGCCAGAATCCGG + Intergenic
935073420 2:99716134-99716156 ACAGTGATCCTGCCAAATTGTGG + Intronic
935385823 2:102499156-102499178 TCAGTGTCCCTGCCAAGCTCAGG + Intronic
936300268 2:111299623-111299645 AGAGGGTCCCTGCCAGAATCCGG - Intergenic
940908767 2:159191896-159191918 TCACTGCCCCTGCCAAAGCCTGG - Intronic
942323470 2:174755746-174755768 CCACTGTACCTGGCAAAGTCTGG - Intronic
943488819 2:188523245-188523267 ACAGTGTCACTGCAAAATTCTGG - Intronic
948348861 2:237322045-237322067 ACAGAGTCCTTGGCATAGTCTGG + Intergenic
948781683 2:240325378-240325400 GCAGTGTCACTGTCAGAGTCAGG - Intergenic
948902344 2:240963031-240963053 ACAGTGACTCTGCCACAGTGGGG - Intronic
1174587270 20:51618881-51618903 GCAGTGCCCCTGCCGAAGCCGGG + Intronic
1175608142 20:60328304-60328326 ACAGTGTCCCTGCCACACTCTGG - Intergenic
1176348849 21:5774059-5774081 ACATTGGCCCTCCCAAAGTTTGG + Intergenic
1176355663 21:5894643-5894665 ACATTGGCCCTCCCAAAGTTTGG + Intergenic
1176543170 21:8172129-8172151 ACATTGGCCCTCCCAAAGTTTGG + Intergenic
1176562121 21:8355174-8355196 ACATTGGCCCTCCCAAAGTTTGG + Intergenic
1177367021 21:20152191-20152213 ACAGTGTGGCTGCCACATTCCGG - Intergenic
1177460733 21:21406326-21406348 ACAGGGTCCTTGCTAAAGACAGG + Intronic
1178633780 21:34284791-34284813 ACATTGTTCCTGGCAGAGTCCGG + Intergenic
1180074928 21:45457456-45457478 ACAGCCTCCCTGCCACAGTGGGG + Intronic
1183929978 22:41230326-41230348 TCAGTCTCCAAGCCAAAGTCAGG - Exonic
1184216203 22:43068955-43068977 AGTGTGTCCCTGTCCAAGTCCGG - Intronic
1184322212 22:43751072-43751094 ACCGTGTCACTACCCAAGTCAGG - Intronic
1203248041 22_KI270733v1_random:88367-88389 ACATTGGCCCTCCCAAAGTTTGG + Intergenic
950172765 3:10851026-10851048 GCAGTGTCCAGGCCAAAGGCCGG - Intronic
954715371 3:52524175-52524197 AAGGTGTCGCTGCCAAAGACAGG - Exonic
955199658 3:56839479-56839501 ACAGTGTATCTGTCAAAATCAGG - Intronic
958079707 3:88731109-88731131 AGACTGTCCCTGCCAAAACCTGG - Intergenic
961059516 3:123816692-123816714 ACAATGCCCCTGCCAAATCCAGG + Intronic
961497850 3:127307089-127307111 CCAGTCTCCCTCCCACAGTCAGG + Intergenic
962406778 3:135107275-135107297 GCAGTCTCCCTGCCAAAAACGGG + Intronic
964157887 3:153607960-153607982 AAATTGTCTCTTCCAAAGTCAGG + Intergenic
964338058 3:155678561-155678583 TCAGTGTCTCTGCCAACTTCAGG - Intronic
968000751 3:195204603-195204625 ACAGTGGCCGTGCCGAAGCCTGG + Intronic
970193304 4:13534579-13534601 AGAGTATTCCTGCCAAAGTCAGG - Intergenic
976000164 4:80364759-80364781 ACAGTGAGCCTGTCAAAGTGGGG - Intronic
980548193 4:134297363-134297385 TCAGTGTCCCTGCAAAAGACAGG - Intergenic
981082354 4:140647939-140647961 GCAGAGCCCCTCCCAAAGTCGGG - Intronic
983466200 4:168095090-168095112 ACAGTGTACTTGCCCAAGTCAGG + Intronic
984508529 4:180651904-180651926 AAAGTGTTTCTGCCAATGTCAGG - Intergenic
995416721 5:111921318-111921340 ATAGTGGTCCTGCCAAAGACAGG + Intronic
999325058 5:150638729-150638751 ACAGTGCCTCTGCCAGGGTCAGG - Intronic
1003095138 6:3136573-3136595 ACAGAGTCCCGGACAACGTCAGG - Intronic
1004341514 6:14812208-14812230 AACGTTTCCCTGCCAAAATCTGG + Intergenic
1004748365 6:18535795-18535817 ACAGTGAACCTGTCAAAGTGTGG + Intergenic
1006390496 6:33755363-33755385 ACACTGTCACTGCCCCAGTCTGG - Intergenic
1008307289 6:49918794-49918816 ACAGTGTCCCATCCAAAGACTGG + Intergenic
1008543874 6:52568845-52568867 ACTCTGTCCCTGCAAAATTCAGG + Intronic
1016876710 6:148872850-148872872 ACAGTGTCCTTGTCAGAGCCAGG - Intronic
1017758182 6:157547409-157547431 ACTGTGTCCCTGACAAATCCAGG - Intronic
1019003598 6:168777653-168777675 AATGTGTCCCTGCAAAACTCCGG + Intergenic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1019831719 7:3336774-3336796 ACACTTTCCCAGCCAAAGTGTGG - Intronic
1020594628 7:10190480-10190502 TCAGTTTCCCTTCAAAAGTCAGG + Intergenic
1022336706 7:29428538-29428560 ACTGTGTCTCTGCAAAAGCCTGG + Intronic
1025095623 7:56093318-56093340 ACACTGTCCCTGCGACAGCCCGG - Intergenic
1026323785 7:69290591-69290613 ACACTCTCCCTGCCAAAGGTAGG - Intergenic
1026803259 7:73413109-73413131 ACAGTGTCTCTGCCAGCATCCGG - Intergenic
1036510759 8:9397950-9397972 ACAGTGCTTTTGCCAAAGTCTGG + Intergenic
1043008504 8:74851574-74851596 ACAGAGTTCCTGCCAAAGAGGGG - Exonic
1045085326 8:98676983-98677005 CCACTGGCCCTGCCTAAGTCTGG + Intronic
1045721015 8:105111112-105111134 ACAGTGTCCTGGCCAAGGTTGGG + Intronic
1046830953 8:118745352-118745374 TCAGTGTTCCAGCCAAGGTCTGG + Intergenic
1048332258 8:133478844-133478866 ACAGGGTCACTGCCATAGTGAGG - Intronic
1048456456 8:134583068-134583090 ACAGTCTCCCTGGCACAGGCTGG - Intronic
1048638691 8:136328465-136328487 ACAGGGTCCCTCACAAAGACTGG + Intergenic
1048781043 8:138001511-138001533 TCAATGTCCCTGCAAAAGACAGG - Intergenic
1049190981 8:141287430-141287452 ACTGTGCCCCTGCCACAGACCGG + Intronic
1051502228 9:17790405-17790427 ACACTTCCCCTGCCACAGTCAGG - Intronic
1058901889 9:109449234-109449256 ACAGTGGCCCTGCCAGTGTGTGG - Intronic
1061542043 9:131282823-131282845 ACAGTCTCCCAGCCCAGGTCCGG + Intergenic
1203464441 Un_GL000220v1:71599-71621 ACATTGGCCCTCCCAAAGTTTGG + Intergenic
1189931148 X:46012461-46012483 ACAGTGTAGATGCCAAAGTAGGG - Intergenic
1189994159 X:46623230-46623252 ACAGTGACCCTTCCTCAGTCCGG - Intronic
1191827218 X:65378752-65378774 ACCGTGTGCCTGCCAAAGCAGGG + Intronic
1193222272 X:78939789-78939811 ACAGTGTCTCTGCCAGATTTTGG + Intergenic
1196980741 X:121210441-121210463 ACACTGTCACTGCCAAGGTATGG + Intergenic
1197717993 X:129723828-129723850 ATAGAGTCCATGCCACAGTCAGG + Intergenic
1200841544 Y:7786350-7786372 ACTCTGCCCCTGCCCAAGTCAGG - Intergenic
1200922603 Y:8626733-8626755 ACAAGGTCCCTGCCAAACTTTGG + Intergenic