ID: 1117071693

View in Genome Browser
Species Human (GRCh38)
Location 14:52063293-52063315
Sequence TCTCCTCTCTGGGATCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 5, 3: 33, 4: 334}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117071693_1117071708 20 Left 1117071693 14:52063293-52063315 CCCCCAGGATCCCAGAGAGGAGA 0: 1
1: 0
2: 5
3: 33
4: 334
Right 1117071708 14:52063336-52063358 GGAGCAGCACAGAGAGGATCAGG 0: 1
1: 0
2: 2
3: 41
4: 439
1117071693_1117071710 28 Left 1117071693 14:52063293-52063315 CCCCCAGGATCCCAGAGAGGAGA 0: 1
1: 0
2: 5
3: 33
4: 334
Right 1117071710 14:52063344-52063366 ACAGAGAGGATCAGGGTGAGTGG 0: 1
1: 0
2: 5
3: 48
4: 430
1117071693_1117071707 14 Left 1117071693 14:52063293-52063315 CCCCCAGGATCCCAGAGAGGAGA 0: 1
1: 0
2: 5
3: 33
4: 334
Right 1117071707 14:52063330-52063352 GGGAGAGGAGCAGCACAGAGAGG 0: 1
1: 0
2: 7
3: 105
4: 1365
1117071693_1117071703 -6 Left 1117071693 14:52063293-52063315 CCCCCAGGATCCCAGAGAGGAGA 0: 1
1: 0
2: 5
3: 33
4: 334
Right 1117071703 14:52063310-52063332 AGGAGAGAGGGGCCTCCACAGGG 0: 1
1: 0
2: 1
3: 40
4: 344
1117071693_1117071704 -1 Left 1117071693 14:52063293-52063315 CCCCCAGGATCCCAGAGAGGAGA 0: 1
1: 0
2: 5
3: 33
4: 334
Right 1117071704 14:52063315-52063337 AGAGGGGCCTCCACAGGGAGAGG 0: 1
1: 0
2: 4
3: 45
4: 343
1117071693_1117071709 21 Left 1117071693 14:52063293-52063315 CCCCCAGGATCCCAGAGAGGAGA 0: 1
1: 0
2: 5
3: 33
4: 334
Right 1117071709 14:52063337-52063359 GAGCAGCACAGAGAGGATCAGGG 0: 1
1: 0
2: 1
3: 25
4: 351
1117071693_1117071702 -7 Left 1117071693 14:52063293-52063315 CCCCCAGGATCCCAGAGAGGAGA 0: 1
1: 0
2: 5
3: 33
4: 334
Right 1117071702 14:52063309-52063331 GAGGAGAGAGGGGCCTCCACAGG 0: 1
1: 0
2: 3
3: 37
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117071693 Original CRISPR TCTCCTCTCTGGGATCCTGG GGG (reversed) Intronic
900191338 1:1353543-1353565 TCTCCTGTCTGTGCTCCTCGGGG - Intronic
900326256 1:2110071-2110093 TCTCACCTCTGGGATCCTCTTGG - Intronic
900326285 1:2110166-2110188 TCTCACCTCTGGGATCCTCTTGG - Intronic
900326314 1:2110261-2110283 TCTCACCTCTGGGATCCTCTTGG - Intronic
900439362 1:2645665-2645687 TCTTCTCCCTGGGGTCCTAGAGG + Intronic
900658435 1:3771653-3771675 TTTCTTCTCTGGGATCCACGCGG + Intergenic
900787402 1:4657364-4657386 TCACCTATTTGGGATCCTGATGG + Intronic
901146964 1:7071699-7071721 TCTACTCTCTGGGCTCCTATTGG + Intronic
902262638 1:15238323-15238345 TCACCTCTCTGGGTTTCTGGAGG - Intergenic
902606748 1:17573370-17573392 TCCCCTCTCTGGCTTCCAGGTGG + Intronic
902659674 1:17892349-17892371 TCTCCTCTCTGGGCTCTGCGGGG + Intergenic
903365449 1:22802889-22802911 TGTCCACTGTGGGCTCCTGGGGG - Intronic
904493473 1:30874200-30874222 TCTCCTTTCTGGGTTCCTAGAGG + Intronic
904833416 1:33320134-33320156 GCTCCTGTCTGAGCTCCTGGAGG + Intronic
905696412 1:39977547-39977569 TCTGCTCTAGGAGATCCTGGAGG - Intergenic
905892337 1:41525263-41525285 TTCCCTCTCTGGGACTCTGGTGG - Intronic
905916675 1:41689423-41689445 TGTGCTTTCTGGGATCCGGGTGG + Intronic
907256912 1:53186303-53186325 ACTCAGCTCTGGGATCCTGATGG - Intergenic
909495965 1:76279080-76279102 TCTCCTCCCTGGGAGCCAAGTGG - Intronic
911002432 1:93180302-93180324 TTTCCTCTCTGGACTCCTCGTGG + Exonic
912278762 1:108290412-108290434 TCTACTCTCTGGACTCATGGTGG + Intergenic
912289464 1:108403945-108403967 TCTACTCTCTGGACTCATGGTGG - Intronic
912446023 1:109737381-109737403 CCTCCACTATGGGATCCTGCAGG + Intronic
912952115 1:114127378-114127400 TTTCCTTTCTGGGTTCTTGGTGG + Intronic
915252849 1:154602806-154602828 TCCCCTCTCTGTGTTCCTGTTGG - Intronic
918307198 1:183258102-183258124 TCTCCTCCATGGGCTCCTGTAGG - Intronic
918457149 1:184732988-184733010 TTTCATCTCTGTGATCCTAGGGG - Exonic
920379123 1:205525755-205525777 TCACCTCTTTGGGCTCCTGGAGG - Intronic
922236439 1:223726172-223726194 TCTCCTTTCTTAGCTCCTGGAGG - Intronic
924102389 1:240618132-240618154 TGTCCTCTCTGGGATCGTTTTGG + Intergenic
1064296772 10:14085720-14085742 CCTCCTCTCTGTGAAACTGGTGG + Intronic
1067079687 10:43205963-43205985 CCTCATCTCTGGGTCCCTGGAGG - Exonic
1069918949 10:71804535-71804557 TCTCCTCTTTGAGGTCCTGCGGG + Intronic
1070719499 10:78746437-78746459 TGTCCTCTCTGTGTGCCTGGTGG + Intergenic
1071428213 10:85580869-85580891 TCTGCTCACTGGGAACCTGTAGG + Intergenic
1073484461 10:103807904-103807926 TCACCGCTCTGGCTTCCTGGTGG + Intronic
1073793566 10:106963653-106963675 ACTCATCTCTTGAATCCTGGGGG + Intronic
1074107592 10:110400129-110400151 TCTCTGCTATGGAATCCTGGTGG - Intergenic
1074743608 10:116508676-116508698 TATCCTCTCTGGGGTCCAGATGG + Intergenic
1076068407 10:127466929-127466951 TCCCCTCTCTGGGATGATTGTGG - Intergenic
1076180634 10:128404693-128404715 TCTCCTCTGTGTGCTCCTGATGG - Intergenic
1076565237 10:131394080-131394102 TCTTCTCTAGGGGATCCAGGAGG - Intergenic
1076607963 10:131701613-131701635 TCTCCTCACTGGTGTCCTGATGG - Intergenic
1076761371 10:132607583-132607605 TCTCTTCCCTGGGAGGCTGGAGG + Intronic
1076860306 10:133136792-133136814 TCTGGTCTCTGGGTCCCTGGGGG + Intergenic
1077037244 11:501354-501376 TCGTCTCTCTGGGTTCTTGGTGG - Intronic
1077416932 11:2428334-2428356 CTTGCTCTCTGGGACCCTGGTGG + Intergenic
1077453567 11:2664920-2664942 TCACCTCTCTGGGGCCCTGCGGG - Intronic
1078073192 11:8132785-8132807 TCACATCTCTGGGTTTCTGGGGG - Intronic
1078456513 11:11480013-11480035 TCTCTTCTCTAGCCTCCTGGTGG - Intronic
1079026931 11:16956423-16956445 TCTCCCCTCTGGGAACCAAGTGG - Intronic
1081696101 11:45110187-45110209 TCTCCTTTCTTGGATCGGGGTGG + Intronic
1083430167 11:62610187-62610209 CCGCCTCTCAGGGATCCGGGAGG + Intronic
1083672483 11:64306923-64306945 TCTCCCCCTTGGGAACCTGGGGG - Intronic
1084531173 11:69728745-69728767 GCCCCTCTTTGGGGTCCTGGGGG - Intergenic
1084756415 11:71241661-71241683 GCTGCTCCCTGGGAACCTGGTGG - Intronic
1085271168 11:75270854-75270876 TCCCCTCATTGGGAACCTGGGGG + Intronic
1086479154 11:87215557-87215579 TTTCCTCTCTTGGAACCTTGAGG - Intronic
1087293386 11:96342582-96342604 TCTCCTCTTTGGGGTACTGTAGG + Exonic
1089247984 11:117136548-117136570 TCTCCACTGTGCGATGCTGGGGG + Intergenic
1089258730 11:117208013-117208035 TCTCCACTGTGCGATGCTGGGGG - Exonic
1089299402 11:117489581-117489603 TCTTCTCTCTGAGACCCTGGGGG + Intronic
1089395928 11:118136318-118136340 TCTGCTCTCTGGGTTACTGAGGG - Exonic
1089518325 11:119047815-119047837 TCTCCTTTCTGGCTTCCAGGGGG - Exonic
1090022114 11:123137453-123137475 TCTCCCCTCTGGGACCCTGTCGG - Intronic
1091132383 11:133157381-133157403 TGTCCCCTCTGGGAGCCTGCAGG - Intronic
1091835521 12:3583039-3583061 TCTCTTCTCTGGGCTGCAGGAGG + Exonic
1092506526 12:9107157-9107179 TCAACTCTCTGGCATCTTGGTGG + Intronic
1093133704 12:15423139-15423161 GCTCCTCTCTTGCATCCTGGGGG - Intronic
1096116635 12:49059248-49059270 TCTCCCCTCAGGGTTCCTTGTGG - Intronic
1096404832 12:51336159-51336181 TCTCCTTTCTTAGATCCTAGTGG + Intronic
1096513608 12:52144957-52144979 GCCCCTGTCTGGGATTCTGGGGG + Intergenic
1096674294 12:53218289-53218311 TTTGGCCTCTGGGATCCTGGTGG - Intronic
1096966644 12:55633219-55633241 TCCCCTCTCTGTGACCCTGCGGG + Intergenic
1097697929 12:62792566-62792588 TGTCCTCTCTGGGATCATGGTGG + Intronic
1099639520 12:85268439-85268461 CATCCACTTTGGGATCCTGGTGG - Intergenic
1099783800 12:87235347-87235369 TATCCTCTCTGTGTTTCTGGAGG + Intergenic
1100217730 12:92469899-92469921 TGACCTCTCTTGGAACCTGGCGG - Intergenic
1100271456 12:93029245-93029267 TCTGCTCTCTGGAGCCCTGGGGG - Intergenic
1101917411 12:108906615-108906637 TCTCTTCTCTGGCATGGTGGGGG + Intergenic
1102183566 12:110931262-110931284 TCCGAGCTCTGGGATCCTGGAGG - Intergenic
1102719517 12:115003901-115003923 TCATCTCTCTGTGTTCCTGGGGG + Intergenic
1103556713 12:121770995-121771017 TCTACTCCCTGGGAGGCTGGAGG - Intronic
1104503568 12:129309581-129309603 TCTCCTCTGAGTGATCCGGGTGG - Intronic
1105439310 13:20402497-20402519 TCGCCTCTCTCGGGTCCTGCGGG + Intergenic
1106467136 13:30023388-30023410 TCTGCTCTCAGCTATCCTGGAGG - Intergenic
1107820469 13:44281270-44281292 TCTTCTCTCTGGGTCCCTAGCGG + Intergenic
1107964401 13:45586443-45586465 TCCTCACTCTGGGACCCTGGGGG - Intronic
1108467502 13:50731497-50731519 TCTCCTCCCTGGGAATCTGTTGG + Intronic
1112463754 13:99625219-99625241 TGTCCCTTCTGGGAACCTGGGGG + Intronic
1112810737 13:103215674-103215696 GCTCCTCTCTTGTATCCTTGAGG - Intergenic
1113215837 13:108039779-108039801 TCTCTGCTCTGTGATGCTGGGGG + Intergenic
1114318089 14:21525377-21525399 TCTCCTCTCTGGGCCCCAGGTGG + Exonic
1115907123 14:38211883-38211905 TCTTTTCTTTGGGACCCTGGGGG + Exonic
1116082940 14:40199388-40199410 TCCCCTCTCTGTGGTTCTGGTGG + Intergenic
1116856428 14:49956247-49956269 TTTCCTCTATGAGCTCCTGGGGG - Intergenic
1117071693 14:52063293-52063315 TCTCCTCTCTGGGATCCTGGGGG - Intronic
1120825192 14:88948731-88948753 TCTCCTCTCTGAGGTCTTGCTGG + Intergenic
1121637530 14:95463750-95463772 GCTCCTCTCTGGGGCCCTGCGGG + Intronic
1121694124 14:95899179-95899201 CCTCCTCTGTGGTATGCTGGAGG + Intergenic
1122298739 14:100719962-100719984 TCTGATCTCTGGGTTCCAGGGGG - Intergenic
1124357144 15:29004107-29004129 CCTGCTCTCAGGGATGCTGGAGG + Intronic
1126454836 15:48849713-48849735 TCTCCTTTCCGTCATCCTGGAGG - Intronic
1127759921 15:62128806-62128828 TCTCCTCTGTGAGAGCCTAGTGG - Intergenic
1128766742 15:70255711-70255733 TGTCCTCCCTGGGCTCCTGCAGG - Intergenic
1129785103 15:78304608-78304630 ACTGCTCTAGGGGATCCTGGCGG - Intergenic
1130031142 15:80315286-80315308 CCTCATCTCTGGGGTCTTGGTGG + Intergenic
1130079728 15:80722033-80722055 AATCCTCTCTGGGATTCAGGTGG + Intronic
1132656720 16:1044558-1044580 TCTCCTCCCTGGGCTCCCAGAGG - Intergenic
1132676561 16:1123590-1123612 TCTCCCTCCTGGGGTCCTGGAGG - Intergenic
1132677029 16:1125095-1125117 GTTCCTCTCTGGGAGCCTGTGGG + Intergenic
1133757428 16:8772761-8772783 TTTCCCCTTTGGGATCCAGGTGG + Exonic
1135997216 16:27259546-27259568 TATCCTCTTTGGCATCATGGAGG + Intronic
1136243728 16:28960931-28960953 TCTCCTCTTTGTGAGCCTGCAGG + Intronic
1136309397 16:29397594-29397616 GCTCCTCTTTGGGCTCCTGCTGG - Intronic
1138597205 16:58035357-58035379 CCTCCACTCTGGGGTCCTGGTGG + Intronic
1139293109 16:65875600-65875622 TCTCCTCTCTGGATTCTTTGGGG - Intergenic
1141196581 16:81865629-81865651 GCTGCTGTCTGGGCTCCTGGGGG + Intronic
1141651874 16:85397127-85397149 TCTCCTCTGTGAAGTCCTGGGGG + Intergenic
1141696430 16:85622020-85622042 GTTCCTCACTGGGATTCTGGAGG + Intronic
1142142342 16:88478210-88478232 ACGACTCTCTGGGACCCTGGAGG + Intronic
1142319470 16:89371751-89371773 TCTCCTCTCCGTCATCCTGAGGG - Intronic
1142326382 16:89417775-89417797 TCTGCTCGTTAGGATCCTGGTGG - Intronic
1142326394 16:89417845-89417867 TCTGCTCGTTAGGATCCTGGTGG - Intronic
1143813683 17:9493534-9493556 TCTGCCCTCTGGGATGCTGGGGG - Intronic
1144611904 17:16726851-16726873 TCTCATCTCAGGGAATCTGGTGG + Intronic
1144900831 17:18588533-18588555 TCTCATCTCAGGGAATCTGGTGG - Intergenic
1145131621 17:20357203-20357225 TCTCATCTCAGGGAATCTGGTGG + Intergenic
1146913423 17:36662834-36662856 TCTGCTCTTTGGGCTCTTGGGGG + Intergenic
1147367671 17:39970103-39970125 TCATCTCTCTGGGATCCCGGGGG - Intronic
1147502405 17:40978143-40978165 TCTCCTTTCTAGGATGCTGCTGG + Exonic
1147573645 17:41586643-41586665 TCTCCTCTGGGGGAGCCTGCGGG - Exonic
1147577764 17:41612500-41612522 TCTCCTCTGGGGGAGCCTGCGGG - Exonic
1147627476 17:41909402-41909424 TCTCCTCTCTGGGAGCCAGGTGG - Intronic
1147648740 17:42050246-42050268 CCTCCTCCCCGGGCTCCTGGGGG + Intronic
1148404019 17:47395856-47395878 TCTCCTTTCTGAGATCGTCGAGG - Exonic
1148475791 17:47927869-47927891 TGTCCTCCCTGGGCCCCTGGTGG + Exonic
1149604687 17:57916393-57916415 TCCCCTCTCTGGGATCAAAGTGG - Intronic
1149939765 17:60851374-60851396 CTTCCTCTCGGGCATCCTGGTGG - Intronic
1151161228 17:72167393-72167415 ACTCCTCTCTGGGTTCTTAGGGG + Intergenic
1151248109 17:72811489-72811511 TCTCCCTTCTGAGATCCAGGTGG - Intronic
1151331353 17:73411073-73411095 TCTCCTAATTGGGACCCTGGGGG - Intronic
1151453661 17:74213897-74213919 CCTCCTGTCTGGGAACCTGGGGG + Intronic
1151649294 17:75456479-75456501 CCGCCCCTCTGGGAGCCTGGCGG - Exonic
1151883874 17:76911961-76911983 GCCTCTCTCTGGGTTCCTGGTGG + Intronic
1152134159 17:78494223-78494245 TCTTCTCGCTGGGAGGCTGGGGG + Intronic
1152284004 17:79402064-79402086 CCTCCACCCTGGGCTCCTGGTGG - Intronic
1152294574 17:79459224-79459246 TCACCTCTATGGGGCCCTGGAGG + Intronic
1152425589 17:80216931-80216953 TCCCATCCCTGGGATCCCGGGGG - Intronic
1152867246 17:82731562-82731584 TCTCATCTTTGGGATCTTGGGGG + Intergenic
1153112879 18:1614275-1614297 TCTCCACTCTGGGATGGTGATGG + Intergenic
1153123594 18:1762705-1762727 TGTCCTCTCTGGGATTCTGGTGG - Intergenic
1154118574 18:11633302-11633324 GCTCCTCTTTGGGCTCCTGCTGG - Intergenic
1155558928 18:27053714-27053736 ACTCCTCTCTGTGATGCTTGAGG - Intronic
1157225324 18:45857890-45857912 ACTCAGCTCTGGGATCCTGGGGG - Exonic
1157451089 18:47789714-47789736 CCTCCTCTCGGTGATCCAGGTGG - Intergenic
1157800624 18:50617604-50617626 TCTCAGCTCTGGGATCCTACAGG - Intronic
1159743206 18:72199349-72199371 ACTCTTCTCTGAGATTCTGGTGG - Intergenic
1161443625 19:4305711-4305733 TCTCCTCTCTGGATCCCTGGAGG + Intronic
1161650131 19:5479255-5479277 TCTCAACTCTGGGAGCCTTGAGG + Intergenic
1162446115 19:10723842-10723864 TCAGCTCTTTGGGATCCAGGCGG + Intronic
1162584640 19:11551524-11551546 TCTCCTCCTTGGAATCCTGATGG - Intronic
1162802240 19:13118101-13118123 TCTCCTCTCTATGCCCCTGGGGG - Intronic
1164945601 19:32290656-32290678 ACTCCTGTCTGGGATCCTGTGGG - Intergenic
1165443358 19:35843552-35843574 TCACCTCAGTGGGGTCCTGGAGG + Exonic
1165687152 19:37831620-37831642 GCTGCTCTCTGGTACCCTGGGGG - Intergenic
1165695152 19:37895192-37895214 GCTTCTGTCTGGCATCCTGGGGG - Exonic
1165751840 19:38264952-38264974 GCTCCTCTCTGGGGTCCTGGCGG + Exonic
1165776870 19:38409853-38409875 TTTCCTCTTTTGCATCCTGGTGG - Exonic
1166669527 19:44701528-44701550 TCCCCTCCCTGGGGTCCTCGGGG - Intronic
1167385007 19:49157938-49157960 CCTCCTCTCTGGGAGCCTGGAGG - Intronic
1167616265 19:50535871-50535893 ATGCCTCTCTGGGCTCCTGGTGG - Intronic
1168104930 19:54160800-54160822 TCTCCTCTCTTGGACGCAGGTGG + Intronic
1168127506 19:54294138-54294160 TCTCCACTGTGTAATCCTGGGGG + Intergenic
1168133160 19:54333736-54333758 TCTCCACTGTGTAATCCTGGAGG + Exonic
1168170775 19:54587217-54587239 TCTCCACTGTGTAATCCTGGGGG - Exonic
1168172850 19:54600706-54600728 TCTCCACTGTGTAATCCTGGGGG - Exonic
1168187939 19:54713103-54713125 TCTCCACTGTGTAATCCTGGGGG - Intergenic
925589243 2:5493552-5493574 TTTCCTCTCCGGGGCCCTGGAGG + Intergenic
925924186 2:8658864-8658886 GCACCTCTCAGGGAACCTGGGGG - Intergenic
926203827 2:10820854-10820876 TCTCTTCTCATGGATGCTGGGGG + Exonic
926722393 2:15970893-15970915 TCTCCACTCGGGGCTCCTGGAGG + Intergenic
928904053 2:36352873-36352895 TTTCTTCTCTGGGATCCAGGAGG - Intergenic
929924146 2:46195459-46195481 TCTTCTCTCTGGGATGCTTCTGG - Intergenic
929977951 2:46653418-46653440 TCTCCTATCTGGGCTGCTGAGGG - Intergenic
932986802 2:76736229-76736251 TCAGCTCTCTGAGATACTGGGGG - Intergenic
933978666 2:87532502-87532524 CCTCCTCTTTGGGATCGTGTGGG + Intergenic
934067123 2:88350651-88350673 TCTGCTCTGTGGTCTCCTGGGGG - Intergenic
936315165 2:111418300-111418322 CCTCCTCTTTGGGATCATGTGGG - Intergenic
937481334 2:122262887-122262909 TCTCCTCTCTCTGATGCTGAAGG + Intergenic
939211074 2:139175447-139175469 TCTCCTCTCTGGTTTCCAGCAGG + Intergenic
940165478 2:150765661-150765683 CCTCGTCTCCGGGATCTTGGTGG - Intergenic
941666585 2:168248204-168248226 TCGCCTCCCTGGGATCCAGGCGG - Intergenic
944539579 2:200743026-200743048 GCTCCTCTCTGGGACTTTGGGGG - Intergenic
945977543 2:216282475-216282497 CCTCCTCTCTGGGGTGGTGGTGG - Intronic
946596332 2:221309776-221309798 TCGCCTCTGTGGGACCCTGCAGG + Intergenic
947270811 2:228332715-228332737 TCATCTCTCTGGGCTCCTGGTGG + Intergenic
947445505 2:230159861-230159883 CCTCCTCTCGGGGATGCTAGAGG - Intergenic
947807251 2:232977301-232977323 TCTGACCTCTGGGAGCCTGGGGG + Intronic
947904554 2:233750997-233751019 TCTACTATTTGGGATTCTGGAGG - Intronic
948159259 2:235810786-235810808 TGTCCTTTCTGGGGTCTTGGAGG + Intronic
948761820 2:240197089-240197111 TCTCCCTTGTGGGATCCTTGTGG - Intergenic
948851219 2:240707448-240707470 TCTTCTCTCTGAGAACTTGGTGG + Intergenic
948851660 2:240711315-240711337 TCTCCTGGCTGGGGGCCTGGCGG + Intergenic
949063556 2:241975334-241975356 TCTGTTCTCTGGTCTCCTGGAGG - Intergenic
1169187907 20:3634314-3634336 TTTCCTCTCTTTGCTCCTGGTGG + Exonic
1172146821 20:32762975-32762997 TCTCCTCTTCGGGCTCCTGGAGG - Intronic
1172991266 20:39038714-39038736 CATCCTTGCTGGGATCCTGGAGG + Exonic
1175308193 20:57992443-57992465 TCACCTCCCTGGGTTCCTGGAGG + Intergenic
1176159092 20:63639487-63639509 TTTCCTCTCTGGAATCCAAGGGG - Intergenic
1176164143 20:63664139-63664161 GCTCCTGTCAGGGAACCTGGGGG - Intronic
1176213864 20:63939209-63939231 ACTCCTCTCGGGGAGCCCGGGGG + Intergenic
1176346592 21:5753996-5754018 TCTCCTCTTTGGCCTCCTAGAGG + Intergenic
1176353406 21:5874580-5874602 TCTCCTCTTTGGCCTCCTAGAGG + Intergenic
1176498235 21:7570459-7570481 TCTCCTCTTTGGCCTCCTAGAGG - Intergenic
1176540913 21:8152066-8152088 TCTCCTCTTTGGCCTCCTAGAGG + Intergenic
1176559864 21:8335111-8335133 TCTCCTCTTTGGCCTCCTAGAGG + Intergenic
1176666264 21:9690188-9690210 TCTCCCCTCTGGGTTCATGGAGG + Intergenic
1179156857 21:38858559-38858581 TCTCCTCCCTTGAAACCTGGGGG - Intergenic
1179605009 21:42509503-42509525 TCTCCTCACTGGGCTCCTGTAGG + Intronic
1179731144 21:43367982-43368004 ACTCCTCTCTGTGTCCCTGGGGG - Intergenic
1180052330 21:45336944-45336966 CCTCCTCTCTGGGAGACTGTAGG + Intergenic
1180910933 22:19449452-19449474 TCTCCTCTCTGGAGTGTTGGAGG + Intergenic
1180955310 22:19738784-19738806 GATTTTCTCTGGGATCCTGGAGG + Intergenic
1182824788 22:33255427-33255449 TCTGCTCTCTGGTATCCTCTTGG + Intronic
1183058812 22:35322930-35322952 CCTCCTCTCTGGGACACAGGAGG + Intronic
1183193086 22:36334359-36334381 TCTGTTCCCTGGGATGCTGGTGG - Intronic
1183297316 22:37037870-37037892 CCTCCTCCCTTGGCTCCTGGCGG - Intergenic
1183803522 22:40188566-40188588 TCGCTGCCCTGGGATCCTGGAGG - Intronic
1183978052 22:41524565-41524587 TCTCCTCACAGCTATCCTGGAGG - Intronic
1184264134 22:43337737-43337759 ACTCCTCCCTGGGATGCTGGTGG - Intronic
1184275330 22:43406536-43406558 TCTCCTCTCTGCTTTCCAGGAGG + Intergenic
1184829129 22:46972845-46972867 TCCTCTCTCTGGGGTGCTGGGGG - Intronic
1185402206 22:50625092-50625114 GCTCCTCACTGGGAGCCTGTGGG - Exonic
1203245852 22_KI270733v1_random:68485-68507 TCTCCTCTTTGGCCTCCTAGAGG + Intergenic
949120137 3:374556-374578 TGTCAGCTCTGGGATCCTGCAGG - Intronic
950961683 3:17114739-17114761 TCACCTCTCTGGGACCCAAGGGG - Intergenic
951714942 3:25631911-25631933 TCTCCTCTTTGGAATTTTGGTGG - Intronic
955690236 3:61583601-61583623 TCTCCTCTCTGTGTTCTTGATGG + Intronic
956244019 3:67160827-67160849 GCTCTTCTCTGGAATCCTTGGGG + Intergenic
956738726 3:72258748-72258770 TTTCTTCTCTGGGCTCCTTGGGG - Intergenic
956742930 3:72289158-72289180 CCTCCTCCCTGGGCTGCTGGGGG + Intergenic
957071148 3:75568807-75568829 TCTGCACTCTGGTGTCCTGGGGG - Intergenic
959515649 3:107263839-107263861 TGACGTCTCTGGGATGCTGGGGG + Intergenic
960383189 3:116989474-116989496 TCAGGTCTCTGGGATGCTGGTGG - Intronic
960899518 3:122540829-122540851 TCTCCTCTCTGGTTGACTGGGGG + Exonic
961219681 3:125189871-125189893 TCTGCTGTGTGAGATCCTGGGGG - Intronic
961580420 3:127876153-127876175 ATTCCTCTCTGGGCTTCTGGGGG - Intergenic
961862490 3:129927743-129927765 TCTCCTCTGTCGTGTCCTGGCGG - Intergenic
962683071 3:137820564-137820586 TCTTCCCTCAGGAATCCTGGAGG + Intergenic
962829153 3:139124346-139124368 GCTCCTCTCTGGTAACCTGATGG + Intronic
963141644 3:141950647-141950669 TCTCATCTCTGGGACCCAGCAGG - Intergenic
964290923 3:155179271-155179293 TCTCCTCTCTAGCCTCCTCGTGG - Intronic
965694988 3:171398954-171398976 TCTCCTCTCTGTGCTCCCAGGGG + Intronic
965806651 3:172548967-172548989 TATCCTCTCTGAGATACAGGAGG + Intergenic
967089620 3:186124526-186124548 TCTCATGTCTGGGGTCCTGATGG + Intronic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
969361719 4:6668312-6668334 TCTCCTCCCTTTGACCCTGGCGG - Intergenic
972556493 4:40186753-40186775 TTTCCTTTCTTTGATCCTGGTGG - Intergenic
972881896 4:43434835-43434857 CCTCATCTCTTGGCTCCTGGTGG - Intergenic
974186744 4:58456871-58456893 TCTCCTCTCTGGGCTGGTGGAGG + Intergenic
974459879 4:62173578-62173600 TCTCCTCTCTGAGGTGGTGGTGG - Intergenic
976441831 4:85084903-85084925 TCTCCTCTCTGGTATCCCCTAGG + Intergenic
985408757 4:189662148-189662170 TCTCCCCTCTGTGTTCATGGAGG - Intergenic
985475372 5:75849-75871 TGCCCTCTCTGGGCTCCTAGAGG - Intergenic
985906783 5:2844348-2844370 TTTCATCTCTGTGATCCTGACGG - Intergenic
986425372 5:7626187-7626209 TTTCATCTGTGGGAACCTGGCGG + Exonic
987882170 5:23762350-23762372 TCTGCTTTGTGGGATGCTGGTGG - Intergenic
989242300 5:39215510-39215532 GCTCCTCTCAGGGATCTTTGGGG + Intronic
992194032 5:74322130-74322152 TCTCATCTCTGCTATCCTGGGGG + Intergenic
993027285 5:82661413-82661435 TCTCAGCTCTGAGATCCTCGGGG - Intergenic
993441747 5:87964960-87964982 TTTTTTCTCTGGGACCCTGGAGG - Intergenic
994732380 5:103507874-103507896 TCTCCCCTCTGGCACCATGGTGG - Intergenic
996080729 5:119255584-119255606 TTTTCTCTCAGGGATCCTTGGGG + Intergenic
998067852 5:139172935-139172957 TGTCTTCTTTGGGATCATGGGGG - Intronic
999765991 5:154741279-154741301 TCCCCTCTCTGGGCTTCTGTAGG - Intronic
1000009062 5:157214891-157214913 TCTCCTCTCTGAGACTGTGGAGG - Intronic
1000633260 5:163615200-163615222 TCTCCTCCCTAGTTTCCTGGTGG + Intergenic
1001933602 5:175689513-175689535 TCACTTCTCAGGGTTCCTGGGGG - Intergenic
1002187051 5:177459351-177459373 CCTCCTCTCTGGAATCTGGGTGG + Intronic
1002337986 5:178493625-178493647 TTTCCTCTCTGGAACCTTGGAGG - Intronic
1002900125 6:1404246-1404268 CCTCGGCTCTGGGCTCCTGGAGG - Intergenic
1003081725 6:3026645-3026667 AATCCTGTCTGGGATCCTGACGG + Intergenic
1003569492 6:7246863-7246885 TCTCGTCCTTGGGCTCCTGGCGG - Exonic
1003927242 6:10887663-10887685 TCTTCTGCCTGGGTTCCTGGTGG + Intronic
1007339226 6:41179734-41179756 TCTCCCCTCTTGCCTCCTGGAGG + Intergenic
1007397336 6:41585348-41585370 TGTCCCATCTGGGCTCCTGGGGG - Intronic
1007695786 6:43733728-43733750 TCTCCTCCCTGCCATCCTTGGGG + Intergenic
1010087898 6:71942087-71942109 TCTCCACTCTGGCACCATGGTGG - Intronic
1011253068 6:85393474-85393496 TTTCCTGCCTGGGAACCTGGGGG - Intergenic
1013006674 6:106080673-106080695 TCTCCTCCCAGGGATCATGGTGG + Intergenic
1013301633 6:108809647-108809669 TTTCCCATCTGGGATCTTGGTGG - Intergenic
1014153237 6:118082959-118082981 TCTCCCCTCAGTGGTCCTGGTGG - Intronic
1015745699 6:136507288-136507310 TTCCCTCTCTGGACTCCTGGAGG + Intronic
1017682524 6:156878434-156878456 TCGCCCCACTGGCATCCTGGTGG + Intronic
1019036128 6:169061174-169061196 TCTACCCTCTGGGGTCCTGTAGG + Intergenic
1019224349 6:170498063-170498085 TCTCCTCTCTGGGAGACTCTGGG - Intergenic
1019716391 7:2541358-2541380 CCACCTCTGTGGGACCCTGGCGG - Exonic
1019983590 7:4639428-4639450 TATCCTCTCTGTGATCCAAGAGG - Intergenic
1020455761 7:8372232-8372254 TCATCTCTCAGGGGTCCTGGGGG - Intergenic
1021114261 7:16730711-16730733 TCTGCTCTCTTGGTTTCTGGTGG - Intergenic
1021586113 7:22210419-22210441 TCTCCTCTCTTTGATGGTGGAGG + Intronic
1024216949 7:47255960-47255982 TCTTCTCTCTGGGATCTGTGAGG + Intergenic
1024532734 7:50406846-50406868 TCTCCTCACTGAAAGCCTGGAGG + Intergenic
1026005696 7:66598711-66598733 TCTGCTCAGTGGGATCCTGCAGG + Intergenic
1026671977 7:72398709-72398731 GCTCCTCTTAGGGGTCCTGGGGG + Intronic
1026968880 7:74455833-74455855 TTTCCTCTGTGGGGTCCTGTGGG - Intronic
1028440586 7:90855272-90855294 CCTCCTCACTTGGATACTGGTGG - Intronic
1028850758 7:95534629-95534651 TCTCCTCTGTGGGTTGCTGATGG + Intronic
1030304191 7:108002753-108002775 TCACCTTCGTGGGATCCTGGGGG - Intronic
1032009661 7:128336406-128336428 TCTATTCTCTGAGACCCTGGTGG + Intronic
1034316253 7:150136151-150136173 TTTCCACCCTGGGATCCAGGAGG - Intergenic
1034401537 7:150864725-150864747 TCTCCACTCAGGGATTCTTGGGG - Intergenic
1034497919 7:151433146-151433168 TCTGCTCTCTGGGTTGTTGGTGG - Intronic
1034790605 7:153964510-153964532 TTTCCACCCTGGGATCCAGGAGG + Intronic
1036719905 8:11164441-11164463 TCTCCCCTATGGGTTCCTGTGGG + Intronic
1037030027 8:14093246-14093268 TCCCCTATCTGGCCTCCTGGTGG + Intronic
1037393241 8:18416437-18416459 TCTGCCCTCTGGGCTCATGGTGG + Intergenic
1037584457 8:20267163-20267185 TCACCTCTCAGGCACCCTGGTGG + Intronic
1037885931 8:22596357-22596379 TCTCCTCCCAGGGGTCCTGAGGG + Intronic
1038300438 8:26341930-26341952 TCTCCTTCCTGTGATCCAGGCGG + Intronic
1038672114 8:29591008-29591030 CTTCTTCTCTGGGATCCTGGTGG + Intergenic
1040294962 8:46144378-46144400 TCTCCTCTCTGCCACCCTGAAGG + Intergenic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1045227334 8:100261819-100261841 TGTCCTCTCTGAAATCATGGAGG - Intronic
1045321688 8:101086582-101086604 TCTCCTCTCTCTAAGCCTGGTGG + Intergenic
1045383361 8:101648248-101648270 TCACGTCTGTGGGACCCTGGGGG + Intronic
1045571074 8:103370336-103370358 TGTCCTCTCAGCAATCCTGGCGG - Intergenic
1047716107 8:127596668-127596690 TCTACTCTTTGGAAGCCTGGGGG - Intergenic
1047914246 8:129565170-129565192 TGTCCTCTCTGGCTTCCTAGGGG + Intergenic
1048138185 8:131766950-131766972 TCTCCTGTTTTGGAACCTGGAGG + Intergenic
1048254641 8:132896504-132896526 GCTCCTCACCAGGATCCTGGAGG - Intronic
1049317171 8:141975479-141975501 GCTCCTCTCTGGGATGTTAGGGG + Intergenic
1049326870 8:142026123-142026145 TGTCCACTCTGGGTTACTGGAGG - Intergenic
1049482888 8:142835161-142835183 GCTCCTCTCAGGGGTACTGGGGG + Intronic
1049583610 8:143423273-143423295 CCTCCTCTCAGGGACCCTGGAGG + Intronic
1049661072 8:143819999-143820021 TCCCATCTCGGGGATCCTGAGGG - Intronic
1053013982 9:34651509-34651531 TTTCTTCCCTGAGATCCTGGAGG + Exonic
1056809268 9:89751669-89751691 TCTTCTCCCATGGATCCTGGTGG - Intergenic
1057202858 9:93152158-93152180 CCTCATCTCTGGGATGCTGTTGG + Intergenic
1057479619 9:95434355-95434377 TCACCCCGCTGGGAACCTGGCGG + Intergenic
1057793235 9:98137826-98137848 TATTCCCTGTGGGATCCTGGGGG + Intronic
1058308776 9:103474894-103474916 TCTTCTCTCTGAGAACCTGGTGG + Intergenic
1060199804 9:121645822-121645844 CCTCTTCTCTGGGCTTCTGGAGG + Intronic
1060314749 9:122499225-122499247 ACACACCTCTGGGATCCTGGTGG - Intergenic
1061012502 9:127963875-127963897 TCTCCTTCCTGGGAGACTGGCGG - Intronic
1061100041 9:128485387-128485409 TATCCACTCTGGAATCCTGGAGG + Exonic
1061188175 9:129067261-129067283 TTCACTCTCTGGGACCCTGGGGG - Intronic
1061584852 9:131558918-131558940 ACTCCTCTCTGAGATGCTGTTGG + Intergenic
1061859343 9:133460159-133460181 TCGCCTGTCTGGGGTGCTGGGGG + Exonic
1062118876 9:134823242-134823264 TCTCATCTCAAGGATCCAGGAGG + Intronic
1203462189 Un_GL000220v1:51556-51578 TCTCCTCTTTGGCCTCCTAGAGG + Intergenic
1203659835 Un_KI270753v1:31573-31595 TCTCCCCTCTGGGTTCATGGAGG - Intergenic
1185713984 X:2326606-2326628 TCTTCACCCTGGGAACCTGGTGG - Intronic
1186217736 X:7317834-7317856 TGTTCTCTCTGGGATTCTGTTGG + Intronic
1186396687 X:9216209-9216231 TTTCCTCTCTCTGAACCTGGAGG - Intergenic
1187245118 X:17547011-17547033 TTTCCTCCCTGGGGTCCAGGAGG + Intronic
1188262111 X:28034359-28034381 GCTCCTCCCTGGTATCCTGGAGG - Intergenic
1188359320 X:29233287-29233309 TCTCTTCTCCAGGATCCTGCTGG + Intronic
1188416803 X:29945132-29945154 TCTCCTCTCTGTGGCCCTGAGGG + Intronic
1190047113 X:47121271-47121293 TCTCCTCTCCTAGATTCTGGTGG + Intergenic
1190439084 X:50458929-50458951 TCTCCTCTCTGGGTTTGAGGGGG + Intronic
1190877194 X:54468428-54468450 TCTACTCTCAGGGATTCTAGTGG + Intronic
1191849519 X:65575643-65575665 TTGCCTCTCTGGGATCCCTGGGG + Intergenic
1193773883 X:85620174-85620196 TCACCTCTGTGGCATGCTGGAGG - Intergenic
1195287396 X:103398324-103398346 TCTCCTCTCTGGGAGGGAGGAGG - Intergenic
1195399484 X:104446418-104446440 GCTTCTCTCTGGGATCCCTGAGG + Intergenic
1199435019 X:147803260-147803282 TATGTTCTATGGGATCCTGGTGG - Intergenic
1199679265 X:150214301-150214323 TCTCCTCACTGGTCTCCAGGTGG + Intergenic
1200146722 X:153930227-153930249 GCTTCTCCCTGGGTTCCTGGTGG - Intronic
1200815060 Y:7522572-7522594 TGTCCTTTGTGGGATCATGGAGG + Intergenic
1201579602 Y:15496667-15496689 TCCCCACTCTCGGATCATGGAGG + Intergenic
1201589572 Y:15600268-15600290 TCCCCACTCTCGGATCATGGAGG - Intergenic