ID: 1117074787

View in Genome Browser
Species Human (GRCh38)
Location 14:52091046-52091068
Sequence CTGTGGGTCTGGGGTCAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117074779_1117074787 1 Left 1117074779 14:52091022-52091044 CCTGCCTCTGGGTAAGTCAGGAA No data
Right 1117074787 14:52091046-52091068 CTGTGGGTCTGGGGTCAAGAGGG No data
1117074780_1117074787 -3 Left 1117074780 14:52091026-52091048 CCTCTGGGTAAGTCAGGAAGCTG No data
Right 1117074787 14:52091046-52091068 CTGTGGGTCTGGGGTCAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117074787 Original CRISPR CTGTGGGTCTGGGGTCAAGA GGG Intergenic
No off target data available for this crispr