ID: 1117077142

View in Genome Browser
Species Human (GRCh38)
Location 14:52116098-52116120
Sequence CAGTGGTTCTAGAGAGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117077142_1117077145 11 Left 1117077142 14:52116098-52116120 CCCTCATCTCTCTAGAACCACTG No data
Right 1117077145 14:52116132-52116154 TAACTCTTCTTGCTGTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117077142 Original CRISPR CAGTGGTTCTAGAGAGATGA GGG (reversed) Intergenic
No off target data available for this crispr