ID: 1117080224

View in Genome Browser
Species Human (GRCh38)
Location 14:52144059-52144081
Sequence AGGATTGAAAAACTATTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117080224_1117080229 7 Left 1117080224 14:52144059-52144081 CCAATAAATAGTTTTTCAATCCT No data
Right 1117080229 14:52144089-52144111 CTCCCCTAACAGCCTCAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117080224 Original CRISPR AGGATTGAAAAACTATTTAT TGG (reversed) Intergenic
No off target data available for this crispr