ID: 1117080785

View in Genome Browser
Species Human (GRCh38)
Location 14:52150304-52150326
Sequence TAATACTGGGTTGCACCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117080778_1117080785 8 Left 1117080778 14:52150273-52150295 CCCTAATCTGCTGTCCAAGTGCT No data
Right 1117080785 14:52150304-52150326 TAATACTGGGTTGCACCTGCTGG No data
1117080779_1117080785 7 Left 1117080779 14:52150274-52150296 CCTAATCTGCTGTCCAAGTGCTT No data
Right 1117080785 14:52150304-52150326 TAATACTGGGTTGCACCTGCTGG No data
1117080777_1117080785 28 Left 1117080777 14:52150253-52150275 CCATATGATTGCTGGGTTGGCCC No data
Right 1117080785 14:52150304-52150326 TAATACTGGGTTGCACCTGCTGG No data
1117080781_1117080785 -6 Left 1117080781 14:52150287-52150309 CCAAGTGCTTCCTGAGGTAATAC No data
Right 1117080785 14:52150304-52150326 TAATACTGGGTTGCACCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117080785 Original CRISPR TAATACTGGGTTGCACCTGC TGG Intergenic
No off target data available for this crispr