ID: 1117084684

View in Genome Browser
Species Human (GRCh38)
Location 14:52187537-52187559
Sequence CATCCTTTACAGATGTCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117084684_1117084686 25 Left 1117084684 14:52187537-52187559 CCATGGGACATCTGTAAAGGATG No data
Right 1117084686 14:52187585-52187607 TGAATTTATGTTTTCTAGCCAGG No data
1117084684_1117084685 -6 Left 1117084684 14:52187537-52187559 CCATGGGACATCTGTAAAGGATG No data
Right 1117084685 14:52187554-52187576 AGGATGTTAAAGATGCTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117084684 Original CRISPR CATCCTTTACAGATGTCCCA TGG (reversed) Intergenic
No off target data available for this crispr