ID: 1117087988

View in Genome Browser
Species Human (GRCh38)
Location 14:52220927-52220949
Sequence CTCCATCAACCCCACAACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117087988_1117087991 -4 Left 1117087988 14:52220927-52220949 CCAAAGTTGTGGGGTTGATGGAG No data
Right 1117087991 14:52220946-52220968 GGAGCTTTCTGATGAGTTTGGGG No data
1117087988_1117087990 -5 Left 1117087988 14:52220927-52220949 CCAAAGTTGTGGGGTTGATGGAG No data
Right 1117087990 14:52220945-52220967 TGGAGCTTTCTGATGAGTTTGGG No data
1117087988_1117087992 -3 Left 1117087988 14:52220927-52220949 CCAAAGTTGTGGGGTTGATGGAG No data
Right 1117087992 14:52220947-52220969 GAGCTTTCTGATGAGTTTGGGGG No data
1117087988_1117087989 -6 Left 1117087988 14:52220927-52220949 CCAAAGTTGTGGGGTTGATGGAG No data
Right 1117087989 14:52220944-52220966 ATGGAGCTTTCTGATGAGTTTGG No data
1117087988_1117087993 -2 Left 1117087988 14:52220927-52220949 CCAAAGTTGTGGGGTTGATGGAG No data
Right 1117087993 14:52220948-52220970 AGCTTTCTGATGAGTTTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117087988 Original CRISPR CTCCATCAACCCCACAACTT TGG (reversed) Intergenic
No off target data available for this crispr