ID: 1117089021

View in Genome Browser
Species Human (GRCh38)
Location 14:52231079-52231101
Sequence CACTTCCCATTTAAAGTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117089018_1117089021 4 Left 1117089018 14:52231052-52231074 CCTATTGTCCATCAAGTCTTCTT No data
Right 1117089021 14:52231079-52231101 CACTTCCCATTTAAAGTTGATGG No data
1117089019_1117089021 -4 Left 1117089019 14:52231060-52231082 CCATCAAGTCTTCTTGCTCCACT No data
Right 1117089021 14:52231079-52231101 CACTTCCCATTTAAAGTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117089021 Original CRISPR CACTTCCCATTTAAAGTTGA TGG Intergenic
No off target data available for this crispr