ID: 1117090838

View in Genome Browser
Species Human (GRCh38)
Location 14:52248358-52248380
Sequence ACTACTTTCAGCACTGGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117090838_1117090844 5 Left 1117090838 14:52248358-52248380 CCATTGCCAGTGCTGAAAGTAGT No data
Right 1117090844 14:52248386-52248408 CAGCTGGAGGTGGAGATTTAAGG No data
1117090838_1117090842 -8 Left 1117090838 14:52248358-52248380 CCATTGCCAGTGCTGAAAGTAGT No data
Right 1117090842 14:52248373-52248395 AAAGTAGTAGGTTCAGCTGGAGG No data
1117090838_1117090843 -5 Left 1117090838 14:52248358-52248380 CCATTGCCAGTGCTGAAAGTAGT No data
Right 1117090843 14:52248376-52248398 GTAGTAGGTTCAGCTGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117090838 Original CRISPR ACTACTTTCAGCACTGGCAA TGG (reversed) Intergenic
No off target data available for this crispr