ID: 1117097701

View in Genome Browser
Species Human (GRCh38)
Location 14:52314680-52314702
Sequence GCTGCTGGCGCGCCGCTGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 182}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117097697_1117097701 -8 Left 1117097697 14:52314665-52314687 CCTCATAGCACTGGCGCTGCTGG 0: 1
1: 0
2: 0
3: 13
4: 137
Right 1117097701 14:52314680-52314702 GCTGCTGGCGCGCCGCTGGCGGG 0: 1
1: 0
2: 0
3: 17
4: 182
1117097691_1117097701 23 Left 1117097691 14:52314634-52314656 CCGTCATGTTCTCGGCCGGGGTG 0: 1
1: 0
2: 0
3: 1
4: 53
Right 1117097701 14:52314680-52314702 GCTGCTGGCGCGCCGCTGGCGGG 0: 1
1: 0
2: 0
3: 17
4: 182
1117097695_1117097701 8 Left 1117097695 14:52314649-52314671 CCGGGGTGCTGGGGAACCTCATA 0: 1
1: 0
2: 0
3: 17
4: 166
Right 1117097701 14:52314680-52314702 GCTGCTGGCGCGCCGCTGGCGGG 0: 1
1: 0
2: 0
3: 17
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117097701 Original CRISPR GCTGCTGGCGCGCCGCTGGC GGG Exonic
900364586 1:2305879-2305901 GCTGATGGCGCGCTGGGGGCGGG + Intronic
900513369 1:3070423-3070445 GCTGCGGGAGCCGCGCTGGCCGG - Intronic
901148657 1:7085762-7085784 CCTGCTGGCTCCCAGCTGGCTGG + Intronic
901628399 1:10636242-10636264 GCTGCTGGGCCGGCGTTGGCAGG - Intergenic
901633761 1:10660199-10660221 GCTGCTGGGCAGCCGCAGGCCGG + Exonic
903788325 1:25875656-25875678 GCTGCTTGTGCGCGGCGGGCGGG - Intergenic
905007558 1:34722218-34722240 GCTGCTGGAGTGATGCTGGCAGG - Intronic
906917171 1:50023923-50023945 GCGGCAGGCGCGCGGGTGGCCGG + Intergenic
907319593 1:53594302-53594324 GCGGCAGGCGTGCCGCTGGGTGG - Exonic
910876773 1:91885750-91885772 GCGGCTGGAGCGACCCTGGCCGG + Intronic
913519506 1:119631727-119631749 GCTCCTGGCCCGCCGCCCGCCGG - Intronic
914677032 1:149913479-149913501 GCAGATGGGGCGCCCCTGGCTGG - Exonic
914911428 1:151790501-151790523 GCGGCTGAAGCGCCGCCGGCGGG - Intronic
918423719 1:184387546-184387568 GCTGCTGGTGCGGGGCTGGCGGG + Intronic
919513582 1:198494807-198494829 GCTGCTGTCCCGCCGGTGGGTGG + Intergenic
919755395 1:201062976-201062998 GCTGCTCCCGCCCCACTGGCAGG - Intronic
1065140532 10:22714655-22714677 GCGGCTGCGGCGCCGCGGGCGGG + Intergenic
1066022858 10:31319872-31319894 GCTGTGGGCGCGCGGCAGGCGGG + Intronic
1066126242 10:32346300-32346322 GCGGCCTGCGCGCCGCTGCCCGG - Intronic
1067040780 10:42952098-42952120 CCTGCTGCCCCGCCCCTGGCTGG - Intergenic
1068669714 10:59710220-59710242 GCCGCTGGCGCCCTCCTGGCCGG + Intronic
1072188461 10:93062799-93062821 GCTCCTGGTGCGCGGCGGGCGGG + Exonic
1073061300 10:100735410-100735432 GCTGCTTGCCTGCGGCTGGCTGG + Intergenic
1073121237 10:101123556-101123578 GCGGGTGGCGCGCGGGTGGCAGG + Intronic
1074213436 10:111360398-111360420 TCTGCAGGCGCCCCTCTGGCTGG + Intergenic
1074591997 10:114822136-114822158 GCTGCGGGCGCACGGCAGGCCGG + Intronic
1075102989 10:119519101-119519123 GCTGGTGGAGCAGCGCTGGCTGG - Intronic
1075438369 10:122461364-122461386 GGTGCTGGCGGGGCGCGGGCGGG - Intergenic
1077065051 11:637337-637359 GCTGCTGGCTGGGCGCGGGCCGG + Exonic
1078273244 11:9816943-9816965 GATGTTGGCGCCCGGCTGGCAGG - Exonic
1078470005 11:11579072-11579094 TCTGCTGGGGTGCTGCTGGCTGG - Intronic
1082067207 11:47910634-47910656 GCTGCTGGCCAGCCTCTGGTTGG + Intergenic
1082238811 11:49851709-49851731 GCTCCTGGAGCGCCCCTGCCAGG + Intergenic
1084169135 11:67392094-67392116 GCTGCTGCACCGCCGCTGCCAGG - Intronic
1084410764 11:69004889-69004911 GCTGCTGGCCTGGTGCTGGCTGG + Exonic
1086690762 11:89787063-89787085 GCTCCTGGAGCGCCCCTGCCGGG + Intergenic
1086697760 11:89864442-89864464 GCTCCTGGAGCGCCCCTGCCAGG - Intergenic
1086708402 11:89980046-89980068 GCTCCTGGAGCGCCCCTGCCAGG + Intergenic
1086715038 11:90052596-90052618 GCTCCTGGAGCGCCCCTGCCGGG - Intergenic
1088679467 11:112226636-112226658 GCTGCTGGGGCGACGCGCGCTGG + Intronic
1089496573 11:118911200-118911222 GCTGCTGGAGGGCTGCTGGAGGG - Intronic
1094473846 12:30826369-30826391 GCTGCTGGGGAGCCTCTGCCAGG - Intergenic
1095261616 12:40105396-40105418 GCTGCCGTCTCGGCGCTGGCCGG - Exonic
1098704106 12:73665354-73665376 GCTGCTGGCCCGGTGCTTGCTGG + Intergenic
1101414734 12:104499313-104499335 GCTTCTGGGGCCCCACTGGCTGG - Intronic
1102370986 12:112382228-112382250 GCAAGTGGGGCGCCGCTGGCGGG - Intronic
1105935613 13:25095911-25095933 GCTGCTGCGGGGCCGCTGGCGGG - Exonic
1108871274 13:54989228-54989250 GCTGCTTGCTGGCCTCTGGCAGG + Intergenic
1113378574 13:109784602-109784624 GCCGCTGGAGGGCCGCTGGCCGG + Exonic
1114516315 14:23302166-23302188 GCCGCGGGCGCGGGGCTGGCAGG + Exonic
1114672171 14:24417137-24417159 GCTGCTGGAGCTCCACTGGAGGG + Exonic
1117092851 14:52267931-52267953 GCTGCTGGCGCGCTCGGGGCTGG + Exonic
1117097701 14:52314680-52314702 GCTGCTGGCGCGCCGCTGGCGGG + Exonic
1119744324 14:77033465-77033487 GCTGCCCGCGCGCCCCAGGCTGG - Intergenic
1121527903 14:94632323-94632345 GCTCCTGGCTCGCCCTTGGCAGG - Intergenic
1127867094 15:63042191-63042213 GCTGCCGGGGAGGCGCTGGCGGG + Intergenic
1132153200 15:99476742-99476764 GCTGCTGGCAGGCTGCTTGCTGG - Intergenic
1132532143 16:457393-457415 TCTGCTGGAGCGGTGCTGGCTGG + Intronic
1132698070 16:1210714-1210736 GGAGCTGGCGCGCTGCTGGGTGG - Intronic
1132721020 16:1315602-1315624 GCTGCTTGCCTGCCGCAGGCCGG - Intronic
1132873031 16:2124034-2124056 GCTGCTGGGGCACCACTGGGTGG + Intronic
1133021705 16:2969754-2969776 GCTGCTGGCGGGCCGGTACCCGG - Exonic
1133139174 16:3731735-3731757 GCTGCAGCCGTGCCTCTGGCCGG - Intronic
1134552119 16:15143213-15143235 GCTGCTGGGGCACCACTGGGTGG + Intergenic
1137009554 16:35309370-35309392 GCTGCTGGTGCCACGCGGGCAGG - Intergenic
1137988594 16:53130897-53130919 GCTGCCGGAGTGCCGCTCGCAGG + Intronic
1138340265 16:56284620-56284642 GCTGCTGGGGGGCAGCTGGGAGG - Intronic
1139785027 16:69385795-69385817 GCAGCGGGCGGGCAGCTGGCAGG - Exonic
1142009195 16:87705172-87705194 GCTGCTGGCGCGGCGCGGCTGGG - Intronic
1142186987 16:88699308-88699330 TCTGCTGGCGCTGCCCTGGCAGG + Intronic
1142876059 17:2852922-2852944 GAGGCTCGCGCGCGGCTGGCAGG + Intronic
1144782215 17:17813949-17813971 GCTGCTCCCGGGCCGGTGGCGGG - Intronic
1145241345 17:21242491-21242513 GCTGCAGGCCCGCCCCTTGCTGG - Exonic
1147000624 17:37359416-37359438 GCCGCGGGCGGGCCGCGGGCGGG + Intronic
1147123904 17:38352533-38352555 CCTGCTGCCGCCCCGCAGGCCGG + Exonic
1151367902 17:73629046-73629068 GCTGCTGGCCAGTCTCTGGCAGG - Intronic
1151706718 17:75773087-75773109 GCTCCTGGCGCTCCGAAGGCAGG - Intergenic
1151975730 17:77482726-77482748 GCTGCTGGGAAGCCTCTGGCCGG - Intronic
1152745323 17:82036151-82036173 ACTGCTGGCACCACGCTGGCTGG + Intronic
1153480583 18:5543390-5543412 GCGGCTGGCGGGCCGCGGGAGGG - Intronic
1153488878 18:5628939-5628961 GCTCCTGGCCGGCGGCTGGCGGG - Intronic
1154161230 18:11981842-11981864 GGTCCTGGCGCGCAGCCGGCGGG + Intronic
1157464308 18:47930806-47930828 GCGGCTGGCGGGCTGCTGGCTGG + Intronic
1160157670 18:76445961-76445983 GCTGCTGGCACACAGCTGGCTGG - Intronic
1160583198 18:79899312-79899334 GCGCCTGGCGCGCCACTCGCTGG + Exonic
1160972323 19:1775131-1775153 GCTGCGGGCGAGCGGCGGGCGGG - Exonic
1161102351 19:2427398-2427420 GCTGCAGGTGCGGGGCTGGCCGG - Exonic
1161323814 19:3653416-3653438 CTTGCTGGCGCGCCGCTTGTAGG + Exonic
1161343197 19:3753839-3753861 GCTGATGGCGCGGCGGCGGCTGG - Exonic
1161479765 19:4504674-4504696 GCTGCTGGAGCTCGGCGGGCAGG + Exonic
1162106233 19:8371409-8371431 GGTGGTGGCGCCCAGCTGGCCGG - Exonic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1162954332 19:14090069-14090091 GCTGCTGTGGCGGCGCCGGCGGG + Exonic
1163551407 19:17967923-17967945 GCTGCTGGCAGGCTCCTGGCGGG + Intronic
1163720420 19:18895868-18895890 GCTGCTGGCGCTCGGCGCGCTGG - Exonic
1166001115 19:39877955-39877977 GCAGCTGGCGAGCCCCAGGCTGG - Exonic
1166003900 19:39894214-39894236 GCAGCTGGCGAGCCCCAGGCTGG - Exonic
1166809651 19:45507710-45507732 GCTCCCGGGGCGCCCCTGGCTGG - Exonic
1166998514 19:46731328-46731350 CCTGCTTGCGCGAGGCTGGCTGG - Intronic
1167125521 19:47545770-47545792 GCTGCTGGGGGGCGGCTGGCCGG + Exonic
1167221744 19:48203908-48203930 GCTGGTGGCGCTCAGCCGGCTGG - Intronic
924995326 2:355747-355769 GTTGCTGGTGCACCGCCGGCGGG + Intergenic
926285458 2:11483737-11483759 GCTGCCGGCGCCCTGGTGGCCGG - Intergenic
928042327 2:27890743-27890765 CCTGCGCGCGCGCCGCGGGCAGG - Exonic
933810297 2:86028884-86028906 GCTGCTGACGGCTCGCTGGCCGG + Intronic
934588462 2:95526451-95526473 GCTCCTGGAGCGCCCCTGCCGGG + Intergenic
937160938 2:119760190-119760212 GCTGCTGGGCAGCCGCGGGCCGG - Exonic
937221795 2:120346233-120346255 GCTGCTGGCGGCCGGCTGGCTGG + Exonic
944104769 2:196068448-196068470 CCTGCTGGCGCGCCGCTAGGCGG + Intronic
947418565 2:229921950-229921972 GCCGCCGCCGCGCCGCTGGGGGG - Exonic
948487355 2:238289210-238289232 GCTGGGGGCGCGCCTCTGGCCGG - Intronic
948752528 2:240140768-240140790 GCTCCTGTCGCCCTGCTGGCAGG + Intronic
948988912 2:241541943-241541965 CCAGCTGGGGCCCCGCTGGCCGG + Intergenic
1168886836 20:1266225-1266247 GCTGCCGGCGAGCCGCCGACTGG + Intronic
1168991732 20:2102011-2102033 TCTGCTGCCGCGGCGCTCGCTGG - Exonic
1171524117 20:25796415-25796437 GCTGCAGGCGCGGCGGCGGCTGG + Intronic
1171544400 20:25989428-25989450 GCTGCAGCCGCGGCGATGGCGGG - Intergenic
1171552710 20:26059468-26059490 GCTGCAGGCGCGGCGGCGGCTGG - Intergenic
1173551582 20:43936581-43936603 GCTGCTGGCTGGGGGCTGGCTGG + Intronic
1178407261 21:32335015-32335037 GCTGCTGCCCCGCTGCTGCCAGG + Intronic
1178561421 21:33642645-33642667 GCCGCTCACGCGCCGCTGGGAGG - Exonic
1178893809 21:36542684-36542706 GCTGCTGGGGGGCCTCTGGGAGG - Intronic
1179545726 21:42111285-42111307 GTGGCTGGTGCTCCGCTGGCTGG - Exonic
1179769441 21:43603463-43603485 GCTGGTGGCATGCCCCTGGCAGG - Intronic
1180156959 21:45982539-45982561 GCTGCAGGCGCTGGGCTGGCCGG + Intronic
1180702435 22:17788942-17788964 GCGGCTGGAGCGCCCCTGGCAGG + Exonic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1180841481 22:18960863-18960885 GCTGCTGGCGCGCCCTGAGCAGG + Intergenic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1181177559 22:21046226-21046248 GCTGGAGGCGCCCCGCAGGCGGG - Intronic
1181967777 22:26668674-26668696 GCTCCTCGGGTGCCGCTGGCTGG + Intergenic
1183607128 22:38872344-38872366 GCGGCTGGCGCGCGGTTGCCAGG + Intergenic
1184973281 22:48043096-48043118 GCTGCTGGCAGGACCCTGGCAGG + Intergenic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
950282503 3:11719797-11719819 GCACCGGGCGCGCAGCTGGCGGG - Intronic
952451747 3:33439994-33440016 GCTGCGGGGGCCCCACTGGCAGG + Exonic
952788257 3:37176601-37176623 GCTGCTGGCGGGGCGGAGGCCGG + Intronic
953069135 3:39502465-39502487 GCTGCTTAAGCGACGCTGGCAGG - Exonic
953749959 3:45601437-45601459 GCTGCTGGGGTGCGGCAGGCAGG - Intronic
953982125 3:47418198-47418220 GCTGCTGGTGAGCTGCTGCCTGG - Exonic
957215725 3:77317652-77317674 GCTGCTGGGGGGCTGCTGGGGGG + Intronic
957215764 3:77317744-77317766 GCTGCTGGGGGGCTGCTGGGGGG + Intronic
957215793 3:77317813-77317835 GCTGCTGGGGGGCTGCTGGGGGG + Intronic
957215807 3:77317846-77317868 GCTGCTGGGGGGCTGCTGGGGGG + Intronic
957215818 3:77317869-77317891 GCTGCTGGGGGGCTGCTGGGGGG + Intronic
957653065 3:83034900-83034922 GCTCCTGGCTCGCCCTTGGCAGG - Intergenic
959037601 3:101384667-101384689 GCACCTGGCTCGCCGTTGGCAGG + Intronic
961314568 3:126025797-126025819 GCTGCTGCCAAGCCGCTGACTGG + Intronic
962832536 3:139157340-139157362 GCAGGTGGCGCCCTGCTGGCTGG + Intronic
968178082 3:196568694-196568716 GCCGCTGGCGCGCCGCGGAGAGG + Exonic
968672375 4:1858430-1858452 GCTGTTGGCTCTCCGCTGCCAGG - Intergenic
969605275 4:8199316-8199338 GCTCCTGGCCCAGCGCTGGCTGG - Intronic
974539792 4:63219269-63219291 GCTGCTGCTGTGCTGCTGGCTGG + Intergenic
979582788 4:122379622-122379644 GCTGCTGCTGCGCCTCAGGCCGG - Intronic
985966293 5:3340932-3340954 GCTGCTGGCCTGCAGTTGGCAGG - Intergenic
986597507 5:9439064-9439086 GCTGCTGGGGCGTCTCAGGCAGG - Intronic
986733056 5:10649363-10649385 GCTGCTGGAGCGCCCCTGCCCGG + Exonic
996404215 5:123090312-123090334 GCCGCTGCCGCCGCGCTGGCTGG + Exonic
997505258 5:134411921-134411943 GCTGATGGGGCCCCTCTGGCCGG - Intergenic
1000336485 5:160245248-160245270 GCTGCTGGGGAGCCGAAGGCAGG + Intergenic
1005959581 6:30685967-30685989 GCTGCTAGCCCGGCGCCGGCAGG - Exonic
1011426741 6:87239376-87239398 GCGGCTGGCGGGCCGGGGGCTGG + Intronic
1015569286 6:134604691-134604713 GCTGCTGGAGCGATGATGGCGGG - Intergenic
1018216639 6:161534452-161534474 GCTGCTGTGGGGCCGCTGGTGGG - Intronic
1019281797 7:204274-204296 GCTGCTGGCCCGCCTGAGGCTGG + Intronic
1019327438 7:445379-445401 GCTGGTGACGGGGCGCTGGCTGG - Intergenic
1022454637 7:30547567-30547589 GCTGCTGGCCTGCCAATGGCAGG + Intronic
1024043842 7:45574498-45574520 GCCGCGGGCGCGCCCCTCGCCGG - Intronic
1025959063 7:66205009-66205031 GCTGCAGGGGAGCCGCGGGCAGG - Intergenic
1026968375 7:74454133-74454155 GGGGCCGGGGCGCCGCTGGCAGG + Exonic
1028477149 7:91265024-91265046 GCAGCTGGCGCGCCAATCGCCGG - Exonic
1033670549 7:143488764-143488786 GCTGCTGGTGCCCTGCTGCCTGG - Intergenic
1033899307 7:146116265-146116287 GCTGCTCGCGCTCCGCCGCCCGG + Intergenic
1033899430 7:146116844-146116866 GCTCTTGGAGCGCCGCCGGCCGG + Exonic
1034418784 7:150978370-150978392 GCTGCGGGCGCGCGGCAGGCGGG - Intergenic
1036654761 8:10671056-10671078 GGTGCTGGCACGGCGCTGTCAGG - Intronic
1036755307 8:11467295-11467317 GCCGATGCCGCGCCCCTGGCGGG - Intronic
1038516277 8:28190319-28190341 GCTGCTGGCTGGCTGCTGCCAGG - Exonic
1038644541 8:29351093-29351115 GCTGGAGGCGCGGCGCAGGCTGG - Intergenic
1039608409 8:38901149-38901171 GGTGCCGGGGCGCCGCGGGCTGG - Intergenic
1045277634 8:100721850-100721872 GCTGCTGCGGGGCCGCGGGCGGG + Exonic
1045479687 8:102582063-102582085 GATGCAGGCGGGCTGCTGGCTGG + Intergenic
1049207347 8:141369709-141369731 GCTGATGCCTCACCGCTGGCAGG - Intergenic
1049288584 8:141789952-141789974 GCCGCTGCCGCCCCGCTGGCTGG + Intergenic
1049351189 8:142165623-142165645 GCTCCTGGAGCGCCACTGGAGGG + Intergenic
1049383771 8:142330776-142330798 GCTGCTTGCGCACAGCTGCCTGG - Intronic
1049409033 8:142464264-142464286 GCTGCTGGGACGCCGCGCGCGGG + Exonic
1050335107 9:4583066-4583088 GCTGCTGGCGTGCCCCAGGCTGG + Exonic
1051718502 9:20010050-20010072 TCAGGTGGAGCGCCGCTGGCTGG - Intergenic
1053203147 9:36166200-36166222 CCAGCTGGAGCGCCGCGGGCGGG - Intergenic
1058885882 9:109320823-109320845 GCTGCTCCCGCGCCGCGCGCCGG + Exonic
1060917953 9:127402561-127402583 GGTGCTGGAGTGGCGCTGGCTGG + Exonic
1061382207 9:130265483-130265505 GCCGATGGCGCGCCGGGGGCGGG - Intergenic
1061862571 9:133475585-133475607 CCTGCTGCCGTGGCGCTGGCTGG - Exonic
1062531389 9:137002236-137002258 GCTGGAGGGGCACCGCTGGCTGG + Intergenic
1186421911 X:9433239-9433261 GCTGGTGGAACCCCGCTGGCAGG + Intergenic
1186463281 X:9765368-9765390 GCTGAGGGCGCGTAGCTGGCTGG - Intronic
1196444538 X:115738633-115738655 GCGGGTGCCGCGCTGCTGGCCGG + Intergenic
1198807149 X:140503985-140504007 GCTGCGGCCGCGGCGGTGGCGGG + Exonic
1200161880 X:154013789-154013811 GCTGCTGCCGCGCCCCCTGCTGG - Intronic