ID: 1117098232

View in Genome Browser
Species Human (GRCh38)
Location 14:52318697-52318719
Sequence AACCTAGAACTACTAATGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117098227_1117098232 15 Left 1117098227 14:52318659-52318681 CCAGTAGTGGACAGAGGAGGGAA 0: 1
1: 0
2: 2
3: 29
4: 246
Right 1117098232 14:52318697-52318719 AACCTAGAACTACTAATGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 90
1117098223_1117098232 25 Left 1117098223 14:52318649-52318671 CCACAGCACTCCAGTAGTGGACA 0: 1
1: 0
2: 2
3: 16
4: 244
Right 1117098232 14:52318697-52318719 AACCTAGAACTACTAATGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117098232 Original CRISPR AACCTAGAACTACTAATGTC AGG Intronic
903666522 1:25011101-25011123 AACATATAACTTCTAAAGTCTGG - Intergenic
904464571 1:30700217-30700239 AACCTAGAACTACTCAGCCCTGG + Intergenic
908661933 1:66445992-66446014 AACTTAGAACCACAAATGTGAGG + Intergenic
909456013 1:75849656-75849678 AACCTAAAACAACTGATGTTTGG + Intronic
911581344 1:99636776-99636798 AAGCTAGAATTACAATTGTCTGG + Intergenic
911899319 1:103482090-103482112 AACCTTGAACCTCTAATGTAAGG - Intergenic
912581695 1:110726663-110726685 AACCTAGAGATAGTAATGTTTGG + Intergenic
913700575 1:121370150-121370172 GACCTAGAAATACTAAAGTTGGG - Intronic
914041126 1:144050601-144050623 GACCTAGAAATACTAAAGTTGGG - Intergenic
914136961 1:144909868-144909890 GACCTAGAAATACTAAAGTTGGG + Intronic
915485969 1:156220866-156220888 GATCTCGAACTCCTAATGTCAGG + Intronic
916393447 1:164358972-164358994 AACCTAGAACTACAAAGGGAAGG + Intergenic
916619663 1:166482475-166482497 TAGATAGAACTTCTAATGTCAGG + Intergenic
920487990 1:206388877-206388899 GACCTAGAAATACTAAAGTTGGG - Intronic
921298903 1:213730885-213730907 AACCTAGAACTACAAAACCCTGG - Intergenic
921683240 1:218059494-218059516 TACCTGAAACCACTAATGTCTGG - Intergenic
1063995834 10:11618320-11618342 AAGGTAGCACTACTAATTTCAGG + Intergenic
1066338555 10:34505830-34505852 AACTTAGAAATACTGATGCCAGG + Intronic
1068540949 10:58294456-58294478 AATCTAGAACCACCCATGTCAGG + Intergenic
1073157035 10:101354941-101354963 AAGCTAGAATTACAAATGTCAGG + Intronic
1074829238 10:117237067-117237089 AACAGAGAACACCTAATGTCAGG + Intergenic
1074935551 10:118176544-118176566 AACCACAAACTACCAATGTCAGG + Intergenic
1080471787 11:32552860-32552882 AAACTAAAACAACTAATGTCTGG + Intergenic
1081282051 11:41221819-41221841 AAACTAGAACTAATGATGTTAGG - Intronic
1081518289 11:43855480-43855502 AATATAGAACTAATATTGTCGGG + Exonic
1088584323 11:111347464-111347486 ATCTTAGAACAAATAATGTCAGG + Intergenic
1089941933 11:122427776-122427798 AGCCCAGAAAAACTAATGTCTGG - Intergenic
1094284931 12:28782372-28782394 AACCTAGACCTTGTAATGTGGGG - Intergenic
1103240736 12:119411327-119411349 AACCTAGAAAGGCTACTGTCTGG - Intronic
1109941420 13:69371332-69371354 AACCTGGGACTACTAATGGAGGG + Intergenic
1112103453 13:96215292-96215314 AACCAAGAATTACTAATCACTGG - Intronic
1115242609 14:31264677-31264699 AACATACAACCACAAATGTCAGG - Intergenic
1117098232 14:52318697-52318719 AACCTAGAACTACTAATGTCAGG + Intronic
1132838566 16:1967078-1967100 ACCCCAGGACTACTAATCTCTGG - Intronic
1137763086 16:50956404-50956426 AACCTAGCACTACTGACATCTGG + Intergenic
1145975321 17:28980718-28980740 AATCTTGAACTTCTGATGTCAGG + Intronic
1165172651 19:33905131-33905153 AACCTGAAGCTACTAAGGTCTGG + Intergenic
929060539 2:37919976-37919998 AACTTAGACCTGCTGATGTCAGG - Intergenic
931812251 2:65865884-65865906 AGCCCAGACCTAATAATGTCTGG - Intergenic
933574335 2:84050196-84050218 AACCTAGGACTTCTAATTTGAGG - Intergenic
933925473 2:87088564-87088586 AACCTCCAACTACTACTTTCTGG + Intergenic
935282144 2:101527417-101527439 AACCTGAAAGTACTGATGTCAGG - Intergenic
935796576 2:106647413-106647435 AATGTAGAACTAATAATATCTGG - Intergenic
940115264 2:150201434-150201456 GGCCTAGAATTACTATTGTCAGG - Intergenic
942476414 2:176328551-176328573 AAACTAGAACTGAAAATGTCAGG - Intronic
945007915 2:205428982-205429004 AACCTGGAACTACTTATTTGTGG + Intronic
946698831 2:222389127-222389149 ACCCTTGGACTTCTAATGTCTGG + Intergenic
1175875088 20:62225707-62225729 AAACTATAGCAACTAATGTCTGG - Intergenic
1177220553 21:18186731-18186753 AACCTAGAAATATTATTGTGTGG - Intronic
1177244992 21:18511268-18511290 AAACTAGAACTGAAAATGTCTGG + Intergenic
1177429201 21:20968450-20968472 ATCCTAGAACTATTTATGCCTGG - Intergenic
1183675775 22:39298094-39298116 AAACTAGGACTTCTAATTTCAGG + Intergenic
951093665 3:18603289-18603311 AACCTTGAAGTAAAAATGTCTGG + Intergenic
952097931 3:29977396-29977418 AATCTAGAACTAATAATTTGGGG + Intronic
952601076 3:35084032-35084054 AAACTACAACTACTAAATTCAGG - Intergenic
954015131 3:47682358-47682380 AACCTAGAACTCCTAAGCTCAGG + Intronic
954222743 3:49164571-49164593 AACCTAGAATTACTCAGCTCTGG + Intronic
958158860 3:89790587-89790609 AACCTCAAACTACTGATCTCAGG - Intergenic
959309185 3:104710452-104710474 AATATAGAACTTATAATGTCAGG + Intergenic
959664505 3:108905707-108905729 AACACAGAACTAGTAATGGCAGG - Intergenic
962706483 3:138049598-138049620 CACCTAGATCTACTAATCTGGGG + Intergenic
965063240 3:163807988-163808010 AACCTACAACTCCAAATGTTAGG - Intergenic
967709155 3:192685821-192685843 AACCTTAAAATACTATTGTCAGG - Intronic
967803563 3:193691707-193691729 AACCCACAGTTACTAATGTCTGG - Intronic
975383112 4:73725692-73725714 AACCTAAATCTACTAAATTCAGG - Intergenic
977741186 4:100485153-100485175 AACCTAGACCAACTAATTTATGG + Intronic
977761500 4:100743255-100743277 AACTTAGAAGTACTATAGTCAGG + Intronic
977851081 4:101830574-101830596 AACCTTGAACTGCTACTGACTGG - Intronic
979797829 4:124869537-124869559 AACCTAGCACTACTAACAGCTGG + Intergenic
982982729 4:162161598-162161620 TACCTTGAACTACCAATATCTGG - Intronic
995233997 5:109805421-109805443 AAAGTAGAACTACAAATTTCAGG - Intronic
995495159 5:112734109-112734131 AACCTCGAACTCCTAACCTCAGG - Intronic
995948302 5:117678496-117678518 CACCTAGAACTGCTATTGTTAGG + Intergenic
996676463 5:126180679-126180701 TACCTGGAACAACTAATCTCGGG + Intergenic
997663706 5:135609848-135609870 TACCTATAACCACTAATTTCTGG - Intergenic
1004722695 6:18281644-18281666 AAACTAGTACTACTACTGCCAGG - Intergenic
1011009099 6:82683717-82683739 AACCTAGGACTCCTAATTCCAGG - Intergenic
1014085514 6:117338384-117338406 AAAATAGAACTGCTGATGTCAGG + Intronic
1014406322 6:121056258-121056280 AACCTAGATCTATTAAATTCAGG + Intergenic
1016605680 6:145921948-145921970 AAGGTAGAACTCATAATGTCCGG - Intronic
1016998341 6:149976881-149976903 AATCTAGAACTTCTAAGGTAGGG - Intergenic
1022052477 7:26691350-26691372 AACCTAGAAATACTTAAGGCAGG + Intronic
1022340643 7:29464253-29464275 TACCTACCAGTACTAATGTCCGG - Intronic
1024192795 7:47029809-47029831 AAATTATAACTATTAATGTCAGG + Intergenic
1028697919 7:93737997-93738019 AACCTAGAACCACTGATATACGG - Intronic
1030261933 7:107574636-107574658 AAAGTAGAACTATTATTGTCAGG - Intronic
1030803519 7:113885261-113885283 AGCCTTGAACTACTAAGCTCAGG + Intronic
1031221720 7:118975135-118975157 AACCTAGAACAATAAATGTGTGG - Intergenic
1038291357 8:26252562-26252584 AACGGAGAGCTTCTAATGTCGGG - Intergenic
1043959277 8:86397044-86397066 AATCTAGAACTACTAATCACCGG - Intronic
1051789337 9:20782816-20782838 AAACAAGAACTAATAATGACTGG - Intronic
1056726090 9:89119108-89119130 TACCTAGAACTACTCAGTTCCGG - Intronic
1186703154 X:12113102-12113124 AGCCTTGAACTACTATGGTCAGG + Intergenic
1188628378 X:32316785-32316807 AAACTAGATCTCCAAATGTCTGG - Intronic
1195890283 X:109685924-109685946 AACCCTGAACTAAAAATGTCTGG + Intronic
1196769099 X:119275389-119275411 AACCTATTACTACCAATGTCTGG + Intergenic