ID: 1117099762

View in Genome Browser
Species Human (GRCh38)
Location 14:52334267-52334289
Sequence GCTTAAGCATGTGCACTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117099762_1117099765 7 Left 1117099762 14:52334267-52334289 CCTCTTAGTGCACATGCTTAAGC No data
Right 1117099765 14:52334297-52334319 CCCAGCTCCCAAGATCTTATTGG No data
1117099762_1117099767 8 Left 1117099762 14:52334267-52334289 CCTCTTAGTGCACATGCTTAAGC No data
Right 1117099767 14:52334298-52334320 CCAGCTCCCAAGATCTTATTGGG No data
1117099762_1117099768 12 Left 1117099762 14:52334267-52334289 CCTCTTAGTGCACATGCTTAAGC No data
Right 1117099768 14:52334302-52334324 CTCCCAAGATCTTATTGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117099762 Original CRISPR GCTTAAGCATGTGCACTAAG AGG (reversed) Intergenic
No off target data available for this crispr