ID: 1117100214

View in Genome Browser
Species Human (GRCh38)
Location 14:52338253-52338275
Sequence CAACCTGCACAGATGCAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117100213_1117100214 -5 Left 1117100213 14:52338235-52338257 CCTTCTTGTTACTCACTTCAACC No data
Right 1117100214 14:52338253-52338275 CAACCTGCACAGATGCAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117100214 Original CRISPR CAACCTGCACAGATGCAACA AGG Intergenic
No off target data available for this crispr