ID: 1117101369

View in Genome Browser
Species Human (GRCh38)
Location 14:52351785-52351807
Sequence TTATGCTCCTTGGCAAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117101369_1117101372 0 Left 1117101369 14:52351785-52351807 CCAGTCTTTGCCAAGGAGCATAA No data
Right 1117101372 14:52351808-52351830 ATATACTTGGCAGAATCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117101369 Original CRISPR TTATGCTCCTTGGCAAAGAC TGG (reversed) Intergenic
No off target data available for this crispr