ID: 1117102177

View in Genome Browser
Species Human (GRCh38)
Location 14:52361021-52361043
Sequence AGCTGAACTCCATTTGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117102174_1117102177 -10 Left 1117102174 14:52361008-52361030 CCTGCCTGGAATCAGCTGAACTC No data
Right 1117102177 14:52361021-52361043 AGCTGAACTCCATTTGTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117102177 Original CRISPR AGCTGAACTCCATTTGTAGA GGG Intergenic
No off target data available for this crispr