ID: 1117120303

View in Genome Browser
Species Human (GRCh38)
Location 14:52560636-52560658
Sequence AAGTGCCAAGGTAATTTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 0, 2: 16, 3: 70, 4: 338}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117120295_1117120303 24 Left 1117120295 14:52560589-52560611 CCAGAATTAGACCCACATATATA 0: 1
1: 5
2: 176
3: 615
4: 1806
Right 1117120303 14:52560636-52560658 AAGTGCCAAGGTAATTTAGTGGG 0: 1
1: 0
2: 16
3: 70
4: 338
1117120296_1117120303 13 Left 1117120296 14:52560600-52560622 CCCACATATATATAGTCAACTGA 0: 4
1: 61
2: 219
3: 586
4: 1334
Right 1117120303 14:52560636-52560658 AAGTGCCAAGGTAATTTAGTGGG 0: 1
1: 0
2: 16
3: 70
4: 338
1117120297_1117120303 12 Left 1117120297 14:52560601-52560623 CCACATATATATAGTCAACTGAT 0: 3
1: 62
2: 356
3: 992
4: 2505
Right 1117120303 14:52560636-52560658 AAGTGCCAAGGTAATTTAGTGGG 0: 1
1: 0
2: 16
3: 70
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117120303 Original CRISPR AAGTGCCAAGGTAATTTAGT GGG Intronic
900812183 1:4814547-4814569 AGGTGTCAAGGTAATTTAATGGG + Intergenic
900859138 1:5213440-5213462 AAATGTCAAGGTAATTCAATGGG + Intergenic
901817375 1:11802499-11802521 AAGTGCTAATGTAATTCAGTTGG + Intronic
904283615 1:29438951-29438973 AATTGCCAATGTCAGTTAGTTGG + Intergenic
904548124 1:31292930-31292952 AAGTGCCTTGGTAAATTAGCTGG + Intronic
904668066 1:32139375-32139397 AAGTGCAAAGGCTATGTAGTAGG + Intronic
905982038 1:42237879-42237901 AGGTACCAATGTAATTCAGTAGG - Intronic
906138543 1:43518758-43518780 AAGTGCCAAGGAAATTCAATGGG - Intergenic
906419875 1:45656614-45656636 AAGTACAAAGGTAATTCAATGGG - Intronic
906440589 1:45839856-45839878 ATTTGCCAAGGCAATTTAATGGG + Intronic
906926904 1:50127430-50127452 AAATGGCAGGGTAATTTAGATGG + Intronic
907568107 1:55456255-55456277 ACGTGCCAAGGTAATCCAATGGG + Intergenic
907655647 1:56339746-56339768 AGGTGCTAAGGTAATTCAATGGG - Intergenic
908086333 1:60638509-60638531 TAGTGCCAAAGTTATTTAGTGGG + Intergenic
908312322 1:62897092-62897114 CAGTGGGAAGGTAATTTTGTAGG - Intergenic
908819675 1:68071733-68071755 AAGTGTCAATGTAATTGAGCTGG - Intergenic
909230062 1:73077035-73077057 AGGTGTCAAGGTAATTTAGTTGG + Intergenic
909256067 1:73424032-73424054 AGGTGCAAAGGTAATGCAGTGGG + Intergenic
909546687 1:76855923-76855945 AAGTGCCAAGGTGACATAGAGGG + Intergenic
909887035 1:80954799-80954821 ATGTACCAAGGCAATTTAATGGG + Intergenic
910502756 1:87911889-87911911 GAGTGCCAAGATAGTTCAGTGGG - Intergenic
910807862 1:91206483-91206505 AAGTTACAAGGTCATTTACTTGG - Intergenic
911092030 1:94025066-94025088 AAGTTCCAAGGTAATTAACGTGG - Intronic
911140965 1:94502133-94502155 AAGTGCCAAGGCAAATAACTGGG - Intronic
911259310 1:95667378-95667400 AGGTGCCAAAGTGATTCAGTGGG + Intergenic
912569426 1:110610567-110610589 GAGGACCAAGGTAATTTAGCTGG + Intronic
915057389 1:153147033-153147055 AGGTGTCAGGGTAATTTAATGGG + Intergenic
915851523 1:159329154-159329176 AATTGCAATGGTAATTTAATGGG - Intergenic
916710956 1:167407624-167407646 AGGTGCCAAGGCAATTCAATAGG + Intronic
916834349 1:168527454-168527476 TAGTGCTAAGGTCATGTAGTTGG + Intergenic
917001787 1:170368478-170368500 AAGTGCCAAGGTATTTCAATGGG + Intergenic
917129531 1:171726542-171726564 AGATACCAAGGTAATTCAGTGGG + Intronic
917132043 1:171752971-171752993 AAGTTCCAAGGTAATATTTTTGG + Intergenic
918090023 1:181282406-181282428 AAGTGCCAAGGGAATCTAATAGG - Intergenic
918314349 1:183310632-183310654 AAGTGCTACTGTCATTTAGTTGG + Intronic
918587093 1:186200734-186200756 AAGTGCCAAGGCAATTCAATGGG - Intergenic
919117397 1:193297481-193297503 AAGGGGCAAGGTAATTCAATGGG + Intergenic
919295382 1:195692524-195692546 GAGTGCCAAGATCATTGAGTGGG + Intergenic
919341659 1:196316441-196316463 AAGTGCTATGTTAATTTAGATGG + Intronic
919867983 1:201797246-201797268 GAGTGCCAAGACAATTCAGTGGG - Intronic
921151523 1:212406851-212406873 AAGTGCCCAGGTAAATCAGGAGG - Intronic
921970667 1:221145932-221145954 AAGTGCCAAGGCAATTCAATGGG - Intergenic
922114602 1:222600418-222600440 TGGTGCCAAGGTAAATTAGGTGG + Intergenic
922394900 1:225187994-225188016 AAATGCCAAGATCATTTAGTGGG - Intronic
924505127 1:244675544-244675566 AGGTGCCAAGACAATTCAGTGGG - Intronic
1063496094 10:6509758-6509780 ATATGTCCAGGTAATTTAGTTGG - Intronic
1064465923 10:15581882-15581904 AGGTGCCAAAGTAATTCAGTGGG + Intronic
1066017297 10:31260636-31260658 AAGAGGCATGGTTATTTAGTTGG + Intergenic
1067159328 10:43809828-43809850 AGGTGCCAAGATATTTTATTGGG + Intergenic
1067320374 10:45214309-45214331 AAGTGCAAAGGCAATTCAGTGGG + Intergenic
1067513644 10:46916975-46916997 AGGTGCCAAGATAATATAATGGG - Intronic
1067648608 10:48134859-48134881 AGGTGCCAAGATAATATAATGGG + Intergenic
1067770863 10:49123686-49123708 GAGTGCCAAGATAATTTAATGGG - Intergenic
1067889550 10:50122205-50122227 AGGTGCCAAGATATTTCAGTGGG + Intronic
1068139012 10:52980942-52980964 AAGTGCCAAGGTAATTAAATGGG - Intergenic
1068482983 10:57618511-57618533 AAACGCCAATGTAATTTTGTGGG + Intergenic
1068503652 10:57871144-57871166 AAGTGACAAGGCAATTAATTGGG - Intergenic
1068931879 10:62598801-62598823 AGGTGCTAAGGTAATTAAATGGG + Intronic
1069159954 10:65080927-65080949 AAGCACCAATGTGATTTAGTGGG - Intergenic
1069284878 10:66701130-66701152 AAGTTCAAAGGCAATTCAGTGGG - Intronic
1070763436 10:79040959-79040981 AAGTGATAAGGTTATTCAGTGGG + Intergenic
1071020676 10:81051241-81051263 TAGTGCCAAGGCAATTTAGTAGG + Intergenic
1072038533 10:91586300-91586322 AATTGGGAAGGTAATTTAGAGGG - Intergenic
1072825557 10:98602683-98602705 AAGTGCCAAGATGATTAAATGGG + Intronic
1073357781 10:102870675-102870697 AAGGGCCAAGGTTGATTAGTGGG - Intronic
1073822077 10:107275304-107275326 AAGTTACAAGGTCATTTACTTGG + Intergenic
1074744435 10:116517580-116517602 CAGTGCCATGGTAATACAGTCGG - Intergenic
1074957099 10:118402472-118402494 AGATGCCAAGGTAATTTAATGGG - Intergenic
1075268192 10:121024263-121024285 AAATGCCAAGGTAATTCAAAGGG + Intergenic
1075831155 10:125412679-125412701 GAGTGCCAAGCCAACTTAGTGGG - Intergenic
1075972222 10:126664505-126664527 AATTGCCAAGGTCACTTAGCTGG + Intronic
1077372205 11:2188271-2188293 AGGTGCCAAGGCCATTCAGTGGG + Intergenic
1077437912 11:2552347-2552369 AGGTGCCAAAGTAATTCAATGGG - Intronic
1077908505 11:6554206-6554228 ATGTGCCAAGATAATTCAATGGG + Intronic
1078189473 11:9080168-9080190 AAGTGCTAAGGTAATCCATTGGG + Intronic
1078345374 11:10543683-10543705 ATATGCCAAGGCAATTCAGTGGG + Intergenic
1078626067 11:12959493-12959515 TGGTGCCAAAGTAATTTAATGGG - Intergenic
1078965697 11:16338880-16338902 AAATGCCAAGTTACTTTGGTGGG - Intronic
1079732709 11:23955466-23955488 AAGGGCCCAGGTACATTAGTTGG - Intergenic
1080542784 11:33284260-33284282 AAGTGCCAAGGATATAGAGTTGG - Intronic
1080638088 11:34140791-34140813 AAGTGTCAAGGCAACGTAGTGGG - Intronic
1081539440 11:44020017-44020039 GGGTGCCAAGATAATTCAGTGGG - Intergenic
1082704347 11:56475369-56475391 AAGTCCCAAGGTAAGCAAGTAGG - Intergenic
1084159790 11:67340936-67340958 CAGTGCCAACGTAATTAAGTGGG + Intronic
1084277021 11:68057799-68057821 AAAGGCCAAGGTAATTTAAGAGG - Intronic
1085117484 11:73942804-73942826 AAATGGCAAGTTAATTTAGCTGG - Intergenic
1085144451 11:74180986-74181008 AATTGCCAAGTTTATTTTGTTGG + Intronic
1086570127 11:88273655-88273677 AAGTGCAATGGTAATTCAGTGGG + Intergenic
1086927261 11:92653729-92653751 AAGAGACAATGTAATTTATTAGG - Intronic
1087713996 11:101585502-101585524 CAGTGCCAAGGTAATCTCTTTGG + Intronic
1088043043 11:105412257-105412279 AAGAGCCAAGGCATTTCAGTAGG - Intergenic
1088305541 11:108403758-108403780 AGGTGCCAAGGGAACTTAATTGG - Intronic
1088863620 11:113825246-113825268 CAGTGCCAAGATAATTCAATGGG + Intronic
1089194381 11:116685269-116685291 AGGTACCAAGGTAATTCAATGGG + Intergenic
1089266615 11:117267809-117267831 AAGTGCCAAGGTACCTCAATGGG - Intronic
1089686594 11:120152669-120152691 AGGTGCCAAGGTAATTCAACGGG - Intronic
1089871485 11:121676736-121676758 AACTGCCAAGGTAATTCAATGGG - Intergenic
1091163443 11:133448300-133448322 AGGTACCAAGGCAATTTAATGGG - Intronic
1091198857 11:133755164-133755186 AGGTGCCAAGGCAATTCACTGGG + Intergenic
1091210892 11:133859020-133859042 AGGTGCCAAGGCAATTCAGTGGG - Intergenic
1091313266 11:134590776-134590798 AAGTGCCAGGGCAATTCAATGGG - Intergenic
1091882035 12:3987429-3987451 AAATGTCAAGGTAATTTAATGGG + Intergenic
1092037856 12:5355496-5355518 AAGTGCCAAGACAATTCAATGGG + Intergenic
1093136357 12:15456465-15456487 CAGAGCCAAGGTATTTTACTTGG + Intronic
1094257650 12:28452268-28452290 AAATGCCATGGAAATTAAGTAGG + Intronic
1095254006 12:40012200-40012222 AACTGTCAATCTAATTTAGTAGG - Intronic
1096762892 12:53857943-53857965 AAGTGCCAAGACAATTCAGTGGG + Intergenic
1100075347 12:90774343-90774365 ATGTGCCAAGATAATTTAACAGG - Intergenic
1100646598 12:96538351-96538373 AAGTGAGAAGGTAAATGAGTAGG - Intronic
1100693259 12:97062522-97062544 AAATGCCAAGGTGTTTTAGAGGG - Intergenic
1104613865 12:130252856-130252878 AAGTCCCAAGCTCATTCAGTTGG - Intergenic
1106214617 13:27684962-27684984 AAGTGCAAAAGCAATTTAGTGGG + Intergenic
1106238863 13:27891265-27891287 GAGTGCCAAGATTATTCAGTGGG - Intergenic
1107759916 13:43667057-43667079 AAATGCAAAGGAAATTTAGAAGG + Intronic
1108487282 13:50939653-50939675 AAGTGTGAAGATAATTCAGTGGG + Intronic
1108925878 13:55743266-55743288 TAGTGGCAAGCTAATTTATTAGG + Intergenic
1109432779 13:62257303-62257325 AAGTGCAAATGTAATTTAGAGGG - Intergenic
1109887413 13:68559818-68559840 AAGGACCAAGGTAATTTAATGGG - Intergenic
1110095939 13:71520860-71520882 AGGTGAGAAGGTAAGTTAGTAGG + Intronic
1110356050 13:74568749-74568771 AGAACCCAAGGTAATTTAGTGGG - Intergenic
1110536578 13:76657871-76657893 AAGGACCAAGGTAATGTAATCGG + Intergenic
1110732463 13:78895069-78895091 AGGTGCCAAGGCAATTCAATGGG - Intergenic
1110762651 13:79247548-79247570 ATGTGGCAAGGCAATTTAATGGG - Intergenic
1111290084 13:86155329-86155351 AAGTGTCAAAGCAATTTATTGGG + Intergenic
1112647523 13:101351613-101351635 ATCTCCCAAGGTAATTAAGTTGG - Intronic
1112759934 13:102683637-102683659 AGGTGCCAAAGTAATTCAATGGG - Intergenic
1113658301 13:112084925-112084947 AGGTGCCATGGCAATTTAATGGG - Intergenic
1114526057 14:23367412-23367434 AGGTGCCCAGGTAATACAGTGGG - Intergenic
1116754806 14:48933964-48933986 AGGTGCCAAAGTAATTCAATGGG + Intergenic
1117120303 14:52560636-52560658 AAGTGCCAAGGTAATTTAGTGGG + Intronic
1117806247 14:59493920-59493942 AAGTGCCATGGCAAATTAGTTGG + Intronic
1120915321 14:89705345-89705367 TAGTGGCAAGTTAATTAAGTAGG - Intergenic
1120963083 14:90142667-90142689 CAGTGCCAAGGCAATTCACTTGG - Intronic
1122403823 14:101485130-101485152 AAGGGCCAAGCTAAATTATTGGG - Intergenic
1124873730 15:33570347-33570369 AGGTGCCAAGGTAACTTGATGGG - Intronic
1126770860 15:52054463-52054485 AAGTGTCAAGATAATTCAGTGGG - Intronic
1127950795 15:63804010-63804032 AAGTGTCAAGGCAGTTTAATAGG + Intronic
1128955915 15:71944615-71944637 AGGCACCAAGATAATTTAGTGGG - Intronic
1134151697 16:11810482-11810504 AAGTTACAAAGTTATTTAGTTGG + Intergenic
1134873532 16:17675159-17675181 AGGTGCCAAAATAATTTAATGGG - Intergenic
1135894777 16:26389319-26389341 AAGTGCCAGTGCAATTCAGTGGG - Intergenic
1137954658 16:52816709-52816731 AAGTGCCAAGTATATATAGTAGG + Intergenic
1138486340 16:57346845-57346867 GAGTGCCAAGATAATTCAATGGG + Intergenic
1139678575 16:68542131-68542153 AACTGTAAAGTTAATTTAGTGGG + Intronic
1140028702 16:71316319-71316341 ATGTACCAAGTCAATTTAGTGGG + Intergenic
1140171195 16:72606793-72606815 AAGTGCCAAGATAATTCAATGGG + Intergenic
1140309646 16:73836751-73836773 AATTGCCAATGTAATGTGGTTGG + Intergenic
1141122840 16:81374847-81374869 AGGTGCCAAGGCAATTTAGTGGG + Intronic
1141239259 16:82249951-82249973 AAGTGACAAGGTTTTTTAATAGG - Intergenic
1143690161 17:8555507-8555529 ATGTGTCAAGGTAATTTAATAGG + Intronic
1144636765 17:16915021-16915043 AAGTGCCAAGATCATTCAATGGG + Intergenic
1145087336 17:19952920-19952942 AAATGTCAAGTTGATTTAGTTGG - Intronic
1146875031 17:36402708-36402730 AAGTGCCAGGATCATTCAGTGGG - Intronic
1146951077 17:36906859-36906881 AAGTGCCATGGGAATGTAGAAGG + Intergenic
1147064357 17:37910162-37910184 AAGTGCCAGGATCATTCAGTGGG + Intergenic
1147174242 17:38643013-38643035 AAGAGTCAAGGTACTTCAGTGGG + Intergenic
1150073984 17:62176791-62176813 AAGTGCCAAAATAATTCAATAGG + Intergenic
1153036439 18:767520-767542 AGGTAACAAGGTAATTCAGTGGG - Intronic
1153613949 18:6917110-6917132 AACTGCCAAGGCAATTCAGTGGG + Intergenic
1153844398 18:9035904-9035926 AGGTGCCAAGGTAATTTAACGGG + Intergenic
1153845392 18:9044825-9044847 AGGTGCCAAGATTATTCAGTGGG + Intergenic
1153870551 18:9315667-9315689 AAGTGCCAATGAAATTCAATGGG + Intergenic
1154233206 18:12577021-12577043 AAGTGCCAAGGTAGTTCAATGGG + Intronic
1156735214 18:40248895-40248917 AGATGCCAAAGTAATTTAATTGG - Intergenic
1156741199 18:40330847-40330869 GTGTGCCAAGGTGATTTAATGGG - Intergenic
1157465390 18:47939821-47939843 AACAGCCTAGGTAATATAGTGGG + Intergenic
1157637457 18:49173084-49173106 GGGTGCCAAGGTAATTTAAGGGG - Intronic
1157791854 18:50539489-50539511 AGGTCCCAAGGTAATTCAATAGG - Intergenic
1158042771 18:53116376-53116398 AAGTGACAAAGTCATCTAGTTGG + Intronic
1158138670 18:54233139-54233161 AAGTTCAAAGATAATTTACTGGG - Intergenic
1158498563 18:57979230-57979252 AAGTGCTCAGGGAATATAGTGGG + Intergenic
1158986489 18:62822882-62822904 AGGTACCAAGGCAATTCAGTAGG + Intronic
1159045277 18:63364070-63364092 ATGTGCCAAGGTACTGTGGTTGG - Intronic
1160252548 18:77215877-77215899 AAATGCCAAGATAATTCAATGGG - Intergenic
1161762149 19:6181823-6181845 AAATGCCAAGGAAATTTCGTTGG - Intronic
1163825634 19:19522892-19522914 AGGTGCCAAGATAATTCAATGGG - Intronic
1164471605 19:28541081-28541103 AGCTGCCAAGGTAATTCAATAGG + Intergenic
1164786947 19:30940977-30940999 AGGTGCCAGGGTAATTCAATGGG - Intergenic
1165271967 19:34716798-34716820 AAGTGCCAAGAACATTTATTGGG + Intergenic
1165638051 19:37360189-37360211 AGGTGCCAAGGTAATTCAATGGG - Intronic
1165928113 19:39339876-39339898 AAGTGCAAAGGCCATGTAGTAGG - Intronic
1166417161 19:42604160-42604182 GAGTGTCAAGATAATTTAATGGG - Intronic
1166969364 19:46553801-46553823 GAGTGCCAAGATCATTTAATGGG - Intronic
925541715 2:4974447-4974469 AAATGCCAAGGCCATTTAGGAGG - Intergenic
925678396 2:6390802-6390824 AAATGCCAAGGCAATTCATTAGG - Intergenic
926449071 2:12980480-12980502 AAGTGCCAAGCTAATTTAATTGG + Intergenic
926813640 2:16779056-16779078 AGGTGCCAAGATAATGTAGCTGG + Intergenic
926835705 2:17017508-17017530 ATATGCCAAGATAATTCAGTAGG - Intergenic
927421587 2:22938390-22938412 AGATGCCAAGGTAATTCAATTGG + Intergenic
928008886 2:27588530-27588552 AGATGCCAAGGCAATTCAGTAGG - Intronic
928075379 2:28259835-28259857 AGGTGCTAAGGTAATTTAATGGG - Intronic
928308185 2:30188500-30188522 AAGTTACAAAGTCATTTAGTTGG - Intergenic
928497342 2:31847337-31847359 ATGTACCAAGGCAATTTATTGGG - Intergenic
928698590 2:33875908-33875930 GGGTGCCAAGATAATTCAGTGGG - Intergenic
928965185 2:36968667-36968689 AAGTTACAACGTCATTTAGTTGG - Intronic
931772388 2:65509191-65509213 AAGTGCAAAGGCAATTTGATGGG - Intergenic
933643562 2:84790139-84790161 AGGTGCCAAGGCAATTCAATGGG + Intronic
933831278 2:86211319-86211341 AATTGCCAAGGGAATTTAACTGG + Exonic
933855451 2:86409547-86409569 GAGTGCCAAGATCATTTAATGGG + Intergenic
934919208 2:98329060-98329082 AAGTCCCAAGGCAATTTGATGGG + Intergenic
935519613 2:104088186-104088208 AAGTGCCAAGATGATTTAATGGG - Intergenic
935728855 2:106048026-106048048 AGGTGCCAAGATAATTTAGTGGG - Intergenic
937327351 2:120998722-120998744 AAGTGCCAAGGCAATTCAATAGG + Intergenic
938202032 2:129380086-129380108 GAGTGCCAAGTTAATGTACTTGG + Intergenic
938770044 2:134493882-134493904 AGGTGCCAAGGTAATTCAATGGG - Intronic
940952821 2:159695645-159695667 GAATGCCAAGGTAATTCAATGGG - Intergenic
941217348 2:162729064-162729086 ATGGGCCAAGGTAATGTAATAGG - Intronic
941605799 2:167595001-167595023 AAGTGCCAAAGTAATATATAGGG - Intergenic
941846191 2:170136046-170136068 AGGTGCCAAGAACATTTAGTGGG + Intergenic
942894542 2:181036291-181036313 AAATGCCAAGGTAATTCAGTAGG + Intronic
943550619 2:189334950-189334972 AGGTGTCAAGATAATTTAATAGG + Intergenic
944457028 2:199905885-199905907 AAGTGCCAAGATAATTCAATGGG - Intergenic
945113330 2:206386330-206386352 ATTTGCCAAGGCAATTCAGTGGG + Intergenic
945199274 2:207265003-207265025 AAAAGCCAAAGTAACTTAGTGGG + Intergenic
946923737 2:224605000-224605022 AAGGCCCAAGGGAATGTAGTTGG + Intergenic
947055587 2:226097788-226097810 AATTGCCAAGGCAATTAAATGGG + Intergenic
947122253 2:226829148-226829170 AATTGCTAAGGCAATTTAATGGG - Intergenic
948442675 2:238005669-238005691 AGGTGCCAAGGTAAGTCAATGGG - Intronic
948579658 2:238976745-238976767 AAGTGCCAAGATAATTCAATGGG + Intergenic
948914149 2:241022491-241022513 GGGTGCCAAGGTTATTCAGTGGG - Intronic
949067396 2:242001524-242001546 AGGTCCCAAGGAAATTCAGTGGG - Intergenic
1168911733 20:1453470-1453492 ATTTGCCATGGTAGTTTAGTCGG - Intronic
1170254856 20:14329715-14329737 AAATGCCAAGGTAACTTTTTAGG + Intronic
1170563873 20:17582577-17582599 GAGTGCCAGGATAATTCAGTTGG + Intronic
1171397990 20:24851277-24851299 ATGTGCCAAGGTAATCCAATAGG + Intergenic
1172961518 20:38803912-38803934 GAGTGCCAAGACAATTTAATGGG - Intergenic
1173528387 20:43750073-43750095 AAGCACCCAGGTAATTTAGAAGG - Intergenic
1173639402 20:44589958-44589980 AAGTTCCAAACTAAATTAGTGGG + Intronic
1174727856 20:52882249-52882271 AAGTGCCAAGATAATTCAGTGGG - Intergenic
1177165371 21:17596547-17596569 AAGTGCCAAAGCAATTCAATGGG - Intronic
1177305130 21:19305710-19305732 AAGTACCAAGGTACATTGGTTGG + Intergenic
1177795511 21:25774692-25774714 AGGTGCCAAGGTAATTCAATAGG + Intergenic
1178101781 21:29277636-29277658 AAGTGCCAAAGTAAATCAATGGG + Intronic
1178926265 21:36777845-36777867 AATTACAAAGGCAATTTAGTGGG - Intronic
1179009381 21:37544226-37544248 AGGTACCAAGGTAATTCAATGGG + Intergenic
1179193975 21:39147814-39147836 AGGTGCCAAGGTAATTCAACAGG - Intergenic
1179375956 21:40849852-40849874 AAGCGCCATGGTAATTTAGGAGG + Intergenic
1179434832 21:41353535-41353557 CAGTGCCAAGATTATTTAATGGG + Intronic
1179555119 21:42168719-42168741 AAATGCTAAGGTAATTGAATGGG - Intergenic
1179634730 21:42700739-42700761 AGGTGTCATGGTAATTCAGTGGG - Intronic
1181835079 22:25598926-25598948 AAATGCCAAGACAATTTAGTGGG + Intronic
1183123305 22:35749417-35749439 AATTACCAAGTTAGTTTAGTAGG - Intronic
1184700322 22:46167107-46167129 AAGTGCCAAGTCATTTAAGTGGG + Intronic
949345643 3:3074018-3074040 AAATGCCAAGGCAATTCACTGGG + Intronic
949686844 3:6583858-6583880 AAGTGTCATGGTAATTCAATGGG - Intergenic
950595771 3:13980040-13980062 AAGTGAGATGATAATTTAGTGGG - Intronic
952021903 3:29032961-29032983 AAATGCTAATGAAATTTAGTAGG - Intergenic
952081880 3:29768891-29768913 AAGGGACAAGGTAGTTTAATTGG - Intronic
952318157 3:32250137-32250159 GAGTGCCAAGATAATTCAATGGG - Intronic
952786327 3:37159251-37159273 GGGTGGCAAGGTAATTCAGTGGG - Intronic
952969054 3:38639286-38639308 AAGTGCCAAATGAATTTAGTTGG + Intronic
953484363 3:43281154-43281176 AATTGCCAAGGCAATTTAATTGG + Intergenic
953853517 3:46483994-46484016 GAGTGCCAAGGTTATTTATGAGG - Intronic
953898941 3:46827850-46827872 AAGTGCTGAGGTAATTAATTGGG - Intergenic
954972726 3:54664679-54664701 AGGTGCCAAGGCCATTTCGTGGG + Intronic
955441430 3:58959531-58959553 AAGTGCTAAAGCAATTTAATGGG - Intronic
955717486 3:61845932-61845954 AACTGTCAAGGTTTTTTAGTGGG + Intronic
956237041 3:67083868-67083890 GAGTTCCAATGTAATTGAGTTGG + Intergenic
956988655 3:74735665-74735687 AAGTGTCAAGGTAACTCAATTGG - Intergenic
957966721 3:87331290-87331312 AAGTGCAATGATAATGTAGTTGG + Intergenic
958252586 3:91287772-91287794 AGGTGCCAAAATAATTCAGTGGG + Intergenic
960931078 3:122850962-122850984 AACTGCCAAGCTAATAGAGTGGG - Intronic
962265525 3:133941841-133941863 AAGAGCAAAGAGAATTTAGTTGG - Intronic
962347911 3:134634468-134634490 AAGTGCAAAGACAATTCAGTTGG + Intronic
963242344 3:143019546-143019568 AAGTGCCAACATAATTTAATAGG - Intronic
964278632 3:155036990-155037012 AGGTGCCAAGGCAATTCAATGGG - Intronic
964725617 3:159811549-159811571 AGGTGCCAAGGTAATTCAATGGG - Intronic
964807125 3:160622687-160622709 AAGAGCCAAGGGAATGCAGTAGG - Intergenic
965256314 3:166417550-166417572 AACTGCTAAGGTAATTCACTGGG + Intergenic
966284073 3:178272463-178272485 AAGAGAAAAAGTAATTTAGTAGG + Intergenic
966364727 3:179173225-179173247 AGGTGCCAAGGTAATTCAATGGG + Intronic
966707684 3:182934404-182934426 AGGTACCAAGATAATTAAGTGGG + Intergenic
967618022 3:191597093-191597115 AAATGCCAAGGCAATTCAATAGG - Intergenic
967952138 3:194849433-194849455 AAGTTACAAAGTCATTTAGTCGG + Intergenic
968197668 3:196722121-196722143 AGGTACCAACGTAATTTAATGGG - Intronic
968344452 3:197989493-197989515 AAATGCCATATTAATTTAGTGGG - Intronic
968715021 4:2150713-2150735 AGGCGCCAAGGTAATTAAATGGG + Intronic
970595137 4:17593377-17593399 AGGTGCCAAGGTAGTCTAGTGGG - Intronic
971102934 4:23488222-23488244 AAGCACCAAGGTAATTAAATGGG - Intergenic
971229164 4:24784879-24784901 CAGTGCCAAGGTAATTTAATGGG - Intergenic
971285284 4:25283254-25283276 AGGTGCCAAGGCAATTCAATGGG + Intergenic
971386609 4:26146269-26146291 AAGTGCCAACATAATTTACTGGG + Intergenic
972226065 4:37013547-37013569 AGGTACCAAGGGAATTCAGTAGG + Intergenic
974205111 4:58691906-58691928 CAGTGCCAAGGTAATTCAATGGG + Intergenic
974394042 4:61312142-61312164 AAGTGCAAAGGCAATTTAATAGG + Intronic
975636465 4:76454424-76454446 GAGTGCCAAGATCATTCAGTAGG - Intronic
975688419 4:76941430-76941452 AAGTGCCAAGATAATTCTATGGG - Intergenic
979764672 4:124449437-124449459 AAATGCCAAGGAGAATTAGTGGG - Intergenic
979781470 4:124656304-124656326 AAATGCCAAAGTAATTCAATGGG + Intergenic
981485985 4:145286587-145286609 AAGTGCCAATGGGACTTAGTTGG - Intergenic
981999232 4:151007166-151007188 AAGTGCCAAGGTAATTCAATGGG + Intronic
982503119 4:156184463-156184485 ATGTGGCAGGGTAATTTACTGGG + Intergenic
982806361 4:159769711-159769733 AAGTGCCAAGGTAATTGTATTGG + Intergenic
983128409 4:163983375-163983397 AATGGTCAAAGTAATTTAGTAGG - Intronic
984217371 4:176931076-176931098 GAGTGCCAACTTGATTTAGTTGG - Intergenic
984621231 4:181954976-181954998 AGGTGCTAAGGTAATTCAATGGG - Intergenic
984722159 4:182983572-182983594 AAGTGCCAAGGTAATCAAATGGG + Intergenic
989345625 5:40426286-40426308 AAGGGCCCATGTAATTTAGAAGG + Intergenic
989352055 5:40497896-40497918 AAGAGCCAAAGGAATTCAGTTGG - Intergenic
989819801 5:45782714-45782736 AGCTGCCAAGATAATTTAATTGG - Intergenic
991551321 5:67839658-67839680 ATGTACCAAGGTGATTCAGTGGG - Intergenic
992862353 5:80924197-80924219 AGGTGCAAAGGCAATTTAATAGG + Intergenic
992983013 5:82196654-82196676 GGGTGCCAAGATAATTAAGTGGG - Intronic
994110119 5:95993146-95993168 AAGCACCAAGGTAATTTGGTGGG + Intergenic
995284655 5:110373969-110373991 AGGTGCCAAGGAAATTCAATGGG - Intronic
995523124 5:113029588-113029610 AAGTGCAAATGTAATTTCATGGG - Intronic
995788140 5:115853721-115853743 AAGTACCAAGGCAATTCAATAGG - Intronic
996854881 5:127994530-127994552 ACGTGTCAAGAGAATTTAGTGGG + Intergenic
997760044 5:136436922-136436944 AAGTGCCAAGGTAATTCAATAGG - Intergenic
997971887 5:138410411-138410433 AGGTGCCAAGGTAGTTCAGTGGG + Intronic
998977982 5:147669211-147669233 AAGAGCAAAGGGAATTTAGAGGG - Intronic
1000566975 5:162860546-162860568 AGGTGCCGAGACAATTTAGTAGG + Intergenic
1001509228 5:172307073-172307095 AGGTGCCAAGGCAATTCAATGGG + Intergenic
1002463842 5:179393683-179393705 AAGTGCTAAGGCAATTTAACGGG + Intergenic
1002528322 5:179827916-179827938 AAGTGCCAAGGCCTTTTGGTTGG + Intronic
1003597268 6:7485388-7485410 GAGTGCCAAGATCATTCAGTGGG - Intergenic
1003710897 6:8588632-8588654 AAGTGCCAATGCCATTTACTTGG + Intergenic
1005412382 6:25563759-25563781 AAGTGGCAAGGTAGTTTTGGTGG + Intronic
1005907160 6:30273276-30273298 TACTGCCAAGGCAATTCAGTGGG + Intergenic
1007801290 6:44395754-44395776 AAGTTCCCATGTGATTTAGTTGG + Intronic
1008145207 6:47883304-47883326 AAGTGCCAATATAATTTTTTAGG - Intronic
1009191893 6:60639150-60639172 AGGTGCCAAAATAATTCAGTGGG - Intergenic
1010120939 6:72375345-72375367 AAGTATCAAGATTATTTAGTAGG - Intronic
1011033611 6:82949739-82949761 AAGTGCCAAGAACATATAGTGGG + Intronic
1012266792 6:97154711-97154733 GAGTGCCAAGACAATTTAATTGG - Intronic
1013143969 6:107369043-107369065 AAGTGCCAAGACAATTCAATGGG + Intronic
1013331282 6:109103007-109103029 AAGTAACAAGGTAATTCAATTGG - Intronic
1014017527 6:116550408-116550430 AAGTGCCAGGGTAATTTTCCTGG + Intronic
1014297285 6:119635378-119635400 AAGTACCAATGTAGTTTAATGGG + Intergenic
1014732583 6:125051010-125051032 AAATGCTAACATAATTTAGTAGG - Intronic
1015193253 6:130495392-130495414 AAGTGCCAAGGTAACTCAATGGG - Intergenic
1015916299 6:138220847-138220869 ATATGGCAAGGCAATTTAGTTGG - Intronic
1016136236 6:140547413-140547435 AGTTGCTAAGGTAATTTAATGGG - Intergenic
1016179675 6:141129606-141129628 AAGTGCCAAGGTAATGAAATAGG + Intergenic
1016421705 6:143891952-143891974 AGATGCCAAGGTAATTCACTGGG + Intronic
1016697400 6:147013700-147013722 TGGTGCCAAGGTAATTCAGTTGG + Intergenic
1018741226 6:166730548-166730570 AATTGACAAGAAAATTTAGTTGG - Intronic
1018789220 6:167133368-167133390 AGGTGCCAAGGTAACTCAATGGG - Intronic
1018994838 6:168702828-168702850 AAGTGCCACCGTAGTTTATTAGG + Intergenic
1019657826 7:2206554-2206576 AAGTGTCCAGATAATTCAGTGGG - Intronic
1020694724 7:11399271-11399293 AAATGTCAAGATAATTTAGAAGG - Intronic
1020977953 7:15031224-15031246 AAGTGGGAAAGTAATTTGGTAGG - Intergenic
1021205938 7:17781135-17781157 AGGTGTCAAGGTAATTTAATGGG + Intergenic
1023288047 7:38639505-38639527 AAGTGCCAAGATCATTCAATGGG + Intergenic
1024171152 7:46788417-46788439 GAGTGCCAAGATAATTCAATAGG - Intergenic
1026066442 7:67077933-67077955 AGGTGCCAAGGTCATGCAGTGGG - Intronic
1026710483 7:72734406-72734428 AGGTGCCAAGGTCATGCAGTGGG + Intronic
1026786257 7:73303587-73303609 AGGTGCCAAGGTGAGTGAGTGGG - Exonic
1030017980 7:105243925-105243947 AACAGCCAAGGTAACTGAGTTGG + Intronic
1030187917 7:106781263-106781285 AAGTTGCAATGTAATTGAGTAGG + Intergenic
1030506444 7:110430074-110430096 CAGTTCCAAGGTAATTCAATGGG + Intergenic
1031248963 7:119354940-119354962 CAGTCCCAAGGGAAATTAGTGGG - Intergenic
1031862800 7:127001140-127001162 AAGTGCCAAGATAATTTAATAGG + Intronic
1032348152 7:131135978-131136000 AAGTGACAAGGGAATTCAGGTGG + Intronic
1035144903 7:156805097-156805119 AGGTGCCAAGGGAATTTAGTGGG - Intronic
1036554453 8:9846373-9846395 GAGTGCCAAGACAATTCAGTGGG + Intergenic
1037506128 8:19531550-19531572 ATTTGCCAAGGTTACTTAGTTGG - Intronic
1037848044 8:22301877-22301899 AGGTGTCAAGGTAAATCAGTAGG - Intronic
1038881753 8:31621721-31621743 AAGTGCTAAGGTAATATAATGGG + Intergenic
1039651438 8:39343742-39343764 AATTGCCAAGACAATTAAGTGGG - Intergenic
1041357833 8:57020553-57020575 AATTGCCAAAATAATTTAATGGG + Intergenic
1041553697 8:59129057-59129079 AGATGCCAAGGTAATTCAGTGGG + Intergenic
1041834474 8:62196300-62196322 AAGATGCAAGGTACTTTAGTAGG + Intergenic
1043953378 8:86334947-86334969 AAGTTCCAAAGTAATTCAATGGG + Intergenic
1044352502 8:91183636-91183658 AAGTGCAAAGAGAATGTAGTGGG + Intronic
1044901773 8:96953861-96953883 AACTGACAAGATAATTCAGTGGG - Intronic
1045060145 8:98403826-98403848 AAGTGCCAAGGGGATATGGTGGG + Intronic
1046000545 8:108415973-108415995 AAGTGCCAAGAAAATTGAATGGG + Intronic
1046090991 8:109502503-109502525 AAGTGCGATGCTAAGTTAGTTGG - Intronic
1046106119 8:109668416-109668438 AACTGGCTAGGTAACTTAGTAGG + Intronic
1046120048 8:109834543-109834565 ACATGCCAAGGTAATTCAATAGG + Intergenic
1047132875 8:122040738-122040760 AAGTACCATGGCAATATAGTGGG - Intergenic
1047562396 8:126001800-126001822 AAGTGCCAAAGGAATTCAATGGG + Intergenic
1047676008 8:127202975-127202997 AGGTGCCAAGGCAATTGAGTAGG + Intergenic
1049049015 8:140177405-140177427 ATGTGCCAAGGTAATTCAAAGGG - Intronic
1050748786 9:8911319-8911341 AAGTGCCAAGGCAATTCAGTTGG + Intronic
1050951085 9:11594811-11594833 AAGAGCAGAGGCAATTTAGTGGG - Intergenic
1051966901 9:22839228-22839250 AGGTGCAAAGGTAATTCAGTGGG - Intergenic
1052565813 9:30149830-30149852 AAGTGCCAAGGACATATATTGGG - Intergenic
1053485537 9:38452338-38452360 TTGTGCAAAAGTAATTTAGTAGG - Intergenic
1053558798 9:39167550-39167572 CAGTGCAAAGTTAATTTAATAGG - Intronic
1053822925 9:41987778-41987800 CAGTGCAAAGTTAATTTAATAGG - Intronic
1054138313 9:61451391-61451413 CAGTGCAAAGTTAATTTAATAGG + Intergenic
1054607649 9:67199587-67199609 CAGTGCAAAGTTAATTTAATAGG + Intergenic
1054711866 9:68518811-68518833 AAGTGCTAACATAATTTAGTTGG + Intronic
1055555952 9:77473886-77473908 AGGTGCCAAGCTAATTCAATGGG + Intronic
1056264453 9:84882455-84882477 AAGGGCCAAGGTGATTTGGAAGG + Intronic
1056378792 9:86038661-86038683 AGGTGCCAAGACAATTCAGTGGG + Intronic
1056510814 9:87303590-87303612 GAGTGCCAAGACAATTTAATGGG + Intergenic
1057344468 9:94236462-94236484 AAGTGCTAAGGCAATCCAGTAGG + Intergenic
1057373965 9:94501460-94501482 AAATGCCATATTAATTTAGTGGG - Intergenic
1057703439 9:97380632-97380654 AGGTGCCAAGACAATTTAATGGG - Intergenic
1057756505 9:97842398-97842420 CAGTGCCAAGGTAATTCAATGGG + Intergenic
1057770386 9:97962243-97962265 AGGAGCCAAGGTTATTTAATTGG - Intergenic
1057984320 9:99695414-99695436 AGGTGCCAAGGTAAATAACTGGG + Intergenic
1058968784 9:110061054-110061076 ACGTGACAAGGTACTTTAGAAGG - Intronic
1060447118 9:123700023-123700045 AGGTGCCAAGGTAATTCAAAGGG - Intronic
1061011519 9:127958061-127958083 CAGTGCCAAAATAATTCAGTGGG + Intronic
1203744251 Un_GL000218v1:32180-32202 GAGTGCCAAGATTATTCAGTGGG + Intergenic
1203565858 Un_KI270744v1:87334-87356 GAGTGCCAAGATTATTCAGTGGG - Intergenic
1186901207 X:14058761-14058783 TCGTGCCTAGGTAATTTAATGGG + Intergenic
1188545699 X:31303790-31303812 ATGTGTCAAGGCAATTTAGCAGG - Intronic
1189716037 X:43867128-43867150 AAGTGCCAAGGAGATTTGGTAGG + Intronic
1190145416 X:47887089-47887111 AAGTGCCAATGTGATTCAATGGG - Intronic
1190538290 X:51450668-51450690 AGGGGCCAAGATAATTTTGTGGG - Intergenic
1190631422 X:52390698-52390720 GGGTGCCAAGATAATTCAGTGGG + Intergenic
1190635491 X:52428882-52428904 AGGTGCCAAGATAATTTAGTGGG - Intergenic
1190639468 X:52468868-52468890 AGGTCCCAAGATAATTTAGTGGG - Intergenic
1190640505 X:52479435-52479457 AAGTGCCAAGAGAATTCAGTGGG - Intergenic
1190647167 X:52533430-52533452 AAGTGCCAAGAGAATTCAGTGGG + Intergenic
1190649299 X:52553610-52553632 AAGTGCCAAGATAATTCAGTGGG + Intergenic
1190841278 X:54146859-54146881 AAGTGCAAAGGTAATTCAATGGG + Intronic
1192622370 X:72691173-72691195 AGGTGCCAAGATAATTCAATGGG - Intronic
1194980114 X:100431829-100431851 AATTGTCAAGGTCATTCAGTTGG - Intergenic
1195216417 X:102708419-102708441 AGGAGCAAAGGTAATTTAATGGG + Intergenic
1195780516 X:108458314-108458336 AAGTATCAAGGTAATTTAATGGG - Intronic
1196400653 X:115312653-115312675 AAGTTACAAAGTAATTTACTTGG + Intergenic
1197339237 X:125245378-125245400 GAGTGCCAATTTCATTTAGTGGG - Intergenic
1198146759 X:133865348-133865370 AATTGCAAAAGTAATTTATTTGG - Intronic
1198315158 X:135458086-135458108 GAGTGCCAAGATAATTCAATAGG - Intergenic
1198591271 X:138185399-138185421 GAGTACCAAGGTAATCCAGTGGG + Intergenic
1198881035 X:141281379-141281401 AGGTACCAAGGTAATTAAATGGG - Intergenic
1199141282 X:144316538-144316560 AAATGCCAAGATAATTTAATGGG + Intergenic
1199923548 X:152436607-152436629 GGGTGCCAAGGTAATTCAATGGG + Intronic
1200288902 X:154852470-154852492 AAGTGCCAAGACCATTTTGTGGG - Intronic