ID: 1117122215

View in Genome Browser
Species Human (GRCh38)
Location 14:52580397-52580419
Sequence CTGTAGCCCAAGCTGGAGTT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 11511
Summary {0: 1, 1: 6, 2: 219, 3: 3947, 4: 7338}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117122215 Original CRISPR CTGTAGCCCAAGCTGGAGTT CGG Intronic
Too many off-targets to display for this crispr