ID: 1117122581

View in Genome Browser
Species Human (GRCh38)
Location 14:52584270-52584292
Sequence CCAGGTTATATGTGCTAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 55}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117122577_1117122581 19 Left 1117122577 14:52584228-52584250 CCAAAGACAATAAGTTTATTCAG 0: 1
1: 0
2: 4
3: 26
4: 212
Right 1117122581 14:52584270-52584292 CCAGGTTATATGTGCTAAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117122581 Original CRISPR CCAGGTTATATGTGCTAAGC TGG Intronic
900932975 1:5748188-5748210 CCAGGTGATGCGTGCTCAGCGGG + Intergenic
904113522 1:28145236-28145258 CCAGGCTATATGTGAGAAACTGG + Intergenic
913444984 1:118941534-118941556 CCATGTTATATTTACTAAACGGG - Intronic
920159524 1:203985566-203985588 CCAGTTCAAATGTGCAAAGCTGG - Intergenic
922449354 1:225724342-225724364 TCAGGCTATTTGTGCTAAGCAGG + Intergenic
1064801840 10:19084140-19084162 CCAGGTAATATTTGCTAAAATGG - Intronic
1065863103 10:29888064-29888086 CCAGGTTACATGTGAAAAGTTGG - Intergenic
1067749646 10:48962324-48962346 CCAGGTCACCTGTGCTAAGTTGG - Intronic
1070032016 10:72686238-72686260 CCAGGTTAGAGGTGCCAATCTGG - Intergenic
1071131391 10:82397710-82397732 CCAGGAAATATGTGGTAAGGAGG + Intronic
1087557216 11:99736238-99736260 CAAGCTTATCTGTGGTAAGCAGG + Intronic
1088080539 11:105906650-105906672 CCAGCTAATACGTGGTAAGCTGG + Intronic
1090462163 11:126901254-126901276 GCAGGTTCTATGTGCTGTGCTGG - Intronic
1092272037 12:7031102-7031124 CCAGGTTTTATGGGCTCAGAAGG + Intronic
1096639684 12:52984231-52984253 CCAGGATGTATGTGTGAAGCAGG - Intergenic
1096967523 12:55640014-55640036 CAGGGATTTATGTGCTAAGCAGG + Intergenic
1109510439 13:63365149-63365171 CCAAGTTATATGTGTTAGGGTGG + Intergenic
1114926521 14:27407416-27407438 CCAGGGGATCTGTGATAAGCAGG + Intergenic
1117122581 14:52584270-52584292 CCAGGTTATATGTGCTAAGCTGG + Intronic
1122515949 14:102308527-102308549 GCATGTAATATGTGCTGAGCAGG - Intergenic
1123186183 14:106519010-106519032 CCAGGGAGTTTGTGCTAAGCTGG - Intergenic
1133968610 16:10550512-10550534 CCAGATTATATTTTTTAAGCAGG + Intronic
1136072459 16:27796125-27796147 CCAGCTGATCTGTGCCAAGCTGG - Intronic
1149405842 17:56350143-56350165 CCAGGGTATCTGGGGTAAGCAGG + Intronic
1159044466 18:63355987-63356009 GCAGGTTATATTTGCAAAGAGGG - Intronic
925367569 2:3321247-3321269 TCAGGGTATAGGTGCTCAGCTGG - Intronic
926823779 2:16882110-16882132 CCAGGCTATATGAGCTCAGTGGG + Intergenic
928132094 2:28659895-28659917 CCATTTTATATGTGCTCAGAAGG - Intergenic
932993376 2:76816046-76816068 CCAGGTTGTATCTGCTAATCTGG - Intronic
941508259 2:166375238-166375260 ACAGGTTGTATCTGCTAAGCTGG + Intronic
943178781 2:184514518-184514540 CCAGCTTATATGTACTAAACAGG + Intergenic
948896242 2:240929107-240929129 CCAGGTGTTATGGGCTCAGCTGG + Intronic
1171069185 20:22049800-22049822 CCATGTTATATGTGCTGATTTGG - Intergenic
1173503408 20:43569306-43569328 CAAGCTTATATGGGCTGAGCCGG + Intronic
1175063019 20:56260831-56260853 ACAGGTTTTATGTGCCAAGTAGG - Intergenic
950730245 3:14949690-14949712 CCAGGCACTATGTGCTAGGCTGG + Intronic
951242157 3:20299741-20299763 CCAGGTTAGAGGAGCTAAGTTGG - Intergenic
956516095 3:70049987-70050009 CAAGATTCTATGTGCCAAGCTGG + Intergenic
960266368 3:115625083-115625105 GCTGGCTAAATGTGCTAAGCTGG - Intronic
964807965 3:160632064-160632086 CCAGGATATATGTGCAGGGCAGG - Intergenic
965904359 3:173685337-173685359 CCAGGTTTTATGAGCTATGAGGG + Intronic
967700153 3:192582969-192582991 CCAGGCTATATGTGATGAGGGGG - Intronic
968637779 4:1690926-1690948 CCAGGTGATGTGTGCCCAGCTGG - Intergenic
969941203 4:10733438-10733460 CCATGTTATACTTGGTAAGCTGG + Intergenic
970506949 4:16741388-16741410 TCTGTTTATATGTGCTCAGCTGG - Intronic
973854975 4:55002340-55002362 ACAGTTTATATTTGCTAATCTGG - Intergenic
992767690 5:80016265-80016287 ACCGATTATATGTGCTCAGCTGG + Intronic
993175634 5:84481768-84481790 CTAGGTTTTATGTGCCAACCAGG + Intergenic
995411574 5:111863338-111863360 CTATTTTATATGTGCTAAGTGGG + Intronic
996345919 5:122488281-122488303 CTTGTTTATCTGTGCTAAGCTGG + Intergenic
1005780501 6:29186795-29186817 CCAGCTTATATGTGCTGGTCTGG + Intergenic
1008369937 6:50720707-50720729 CCAGGTGAGATGTGCTGATCAGG + Intronic
1008479592 6:51971642-51971664 CCAGGATATGTGTGCTTAGGGGG + Intronic
1017140136 6:151182750-151182772 CCAGATTATAAGTGCTATGAAGG + Intergenic
1023130794 7:37000838-37000860 CCAGGGTATGTGGGTTAAGCAGG + Intronic
1034216011 7:149406152-149406174 ACAGGTGAAATGTGCTAAGAAGG - Intergenic
1042203484 8:66304513-66304535 CCAGCTTATATGTGCCCACCAGG + Intergenic
1051822937 9:21190368-21190390 CCAGGGTAAATGTGCTCAACGGG - Intergenic
1199500084 X:148499215-148499237 CCAGGTTCTAGGTTCTAATCTGG + Intergenic
1199751097 X:150818923-150818945 CCAGGGTTTATGTGCTAGGGTGG + Intronic