ID: 1117123033

View in Genome Browser
Species Human (GRCh38)
Location 14:52589464-52589486
Sequence TATCATCTGAAGAGGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 3, 3: 67, 4: 179}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117123033 Original CRISPR TATCATCTGAAGAGGGTGGA TGG Intronic
900555419 1:3278003-3278025 TCTCATCTGAAAAGGAGGGAGGG + Intronic
907090193 1:51716897-51716919 TATAAACTGAAGTGGGTGGGGGG - Intronic
908327121 1:63033871-63033893 TAAAATGTGAAGACGGTGGATGG + Intergenic
909246608 1:73293341-73293363 TAGCATCTGGAGGGGGTAGATGG - Intergenic
910604021 1:89063724-89063746 AATCATTTGAAGATGGAGGAAGG - Intronic
910715223 1:90223114-90223136 TAGCATCTGAAGTGGGGGGAGGG - Intergenic
912587254 1:110778355-110778377 TGTCATCTGAAGAGGTAGGCAGG + Intergenic
918126308 1:181587195-181587217 GGTCATCAGCAGAGGGTGGAAGG + Intronic
918164934 1:181936083-181936105 TAGCATCTGAAGAGTGTTGGGGG - Intergenic
918588299 1:186212852-186212874 TCTCATCTGAAGATCTTGGAAGG - Intergenic
918655961 1:187027101-187027123 TCTGATCCCAAGAGGGTGGATGG - Intergenic
918771173 1:188562222-188562244 AGACATCTGAAGAAGGTGGAAGG + Intergenic
919424831 1:197417193-197417215 TGTCATCTAAAGTTGGTGGAAGG + Intronic
919500031 1:198326829-198326851 AATCATCTTAAGAGGATAGATGG + Intergenic
923797320 1:237170371-237170393 TATCCACTGTAGAAGGTGGAAGG + Intronic
1063355577 10:5395470-5395492 TCCCATCTGCAGAGGGTGAAAGG + Exonic
1064030567 10:11880304-11880326 TCTCATCAGAAGAGGCTGGGAGG - Intergenic
1064105958 10:12501355-12501377 TATCATCTGGTGAGGGGCGAGGG + Intronic
1064839825 10:19578784-19578806 TACCATCAGAAGAGGAAGGAAGG - Intronic
1065045384 10:21743642-21743664 TCTCATTTGGAGAGGATGGAGGG + Intergenic
1067030837 10:42878144-42878166 TATCATGTGAAGAGACAGGAAGG - Intergenic
1068577994 10:58706634-58706656 TATCATGAGAACAGCGTGGAAGG - Intronic
1069741926 10:70690372-70690394 TCTCCTCTGCAAAGGGTGGAAGG - Intronic
1070303623 10:75224141-75224163 TGGCATCTGAAGTGGGAGGAGGG + Intronic
1071119964 10:82265744-82265766 TATCATCAGAGGATGGTGGTGGG + Intronic
1071549260 10:86553713-86553735 TCTCATCTGAAGACTGGGGATGG + Intergenic
1071875029 10:89836292-89836314 TATCAGCTGAAGAGGGAGTCTGG + Intergenic
1071984030 10:91032827-91032849 TATCATCTGAAGAGGAACCACGG - Intergenic
1072776475 10:98201347-98201369 TATCATTTGAAGAGGATGCCAGG + Intronic
1074001291 10:109376039-109376061 TTTAGTCTGAAGAGGTTGGAAGG + Intergenic
1074092195 10:110271481-110271503 TATCATCTGAGGAAGGAGTATGG + Intronic
1076047282 10:127304327-127304349 TATTTTCTGAAGTGCGTGGAAGG - Intronic
1078131492 11:8617848-8617870 TATCCTCTTCAGAGTGTGGATGG - Exonic
1081155052 11:39680056-39680078 TTCCATCTGCAGAGGGTGGAGGG + Intergenic
1083112258 11:60422849-60422871 AGTTATCTGAAGAGGATGGAAGG + Intergenic
1086862236 11:91938658-91938680 TAGCTTCTGAAGAGGAAGGAAGG + Intergenic
1086931609 11:92699710-92699732 TATCATCTGCAGAGGGAAGTAGG + Intronic
1089367636 11:117931020-117931042 TATCTTCTCAGGAGGATGGATGG - Intergenic
1089705067 11:120271884-120271906 TTTCCTTTAAAGAGGGTGGAGGG + Intronic
1093848679 12:24009025-24009047 TACCATGTGAAGAGGCTGCAGGG + Intergenic
1094403560 12:30089166-30089188 TAATATCTGAATAGGGTGTAAGG + Intergenic
1095663234 12:44762574-44762596 TTTCAGCTGAAGAGGTAGGATGG - Intronic
1095854409 12:46844447-46844469 TAGCATCAGGAGAGGCTGGAGGG + Intergenic
1099938539 12:89157609-89157631 TATCATATGAAAAGGGCAGAGGG - Intergenic
1100362344 12:93890216-93890238 TATCATCTGTAGAATGGGGAGGG + Intronic
1108007898 13:45970964-45970986 TCTCATCTGAAAATGGTGGGTGG + Intronic
1109381791 13:61571107-61571129 TATCTTTTGAAGAAGGTGGAAGG - Intergenic
1113086455 13:106574156-106574178 TATCATTGGAAGGGGTTGGATGG + Intergenic
1113116315 13:106878099-106878121 TATCATCTAAGGGGAGTGGAAGG + Intergenic
1113232333 13:108226550-108226572 TTTTATCTGAAGAGGGAGAAAGG + Intronic
1114286857 14:21252748-21252770 TAACATGGGAAGGGGGTGGATGG + Intronic
1117123033 14:52589464-52589486 TATCATCTGAAGAGGGTGGATGG + Intronic
1121649805 14:95549613-95549635 TGTACTCTGAAGAGGGCGGAAGG + Intergenic
1121817857 14:96942264-96942286 AATCATCAGAAGCGGGTGGGTGG - Intergenic
1122187886 14:100015694-100015716 TTCCAGCTGAAGAAGGTGGAGGG - Intronic
1123988393 15:25665248-25665270 GTTTATCTGAAGAGGGTGGCAGG + Intergenic
1124612541 15:31217905-31217927 TATGACCTGAAGGGGATGGAGGG - Intergenic
1130410223 15:83641366-83641388 TATCATCTTAATGGGGTGGGGGG + Intergenic
1131392127 15:92058203-92058225 TAGCATCTCTAGAAGGTGGAGGG + Intronic
1131706507 15:95001915-95001937 TTTCATCTGAAGAGCTTGGCAGG - Intergenic
1132086201 15:98910232-98910254 TATGATCTGAACAGGGAGCAAGG - Intronic
1132663685 16:1072469-1072491 GAGAGTCTGAAGAGGGTGGAGGG - Intergenic
1133095291 16:3440952-3440974 TGTCAGCACAAGAGGGTGGAGGG + Intronic
1134165712 16:11927681-11927703 TATCATCCGCTGAGGGTGGAAGG + Exonic
1134495022 16:14726128-14726150 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134495045 16:14726256-14726278 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134500406 16:14765248-14765270 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134500429 16:14765376-14765398 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134526946 16:14951860-14951882 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134526969 16:14951988-14952010 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134545434 16:15104362-15104384 TATCATCCACTGAGGGTGGAAGG + Intronic
1134545469 16:15104560-15104582 TATCATCCGCTGAGGGTGGAAGG + Intronic
1134580151 16:15363674-15363696 TATCATCCGCTGAGGGTGGAAGG + Exonic
1134580185 16:15363871-15363893 TATCATCCGCTGAGGGTGGAAGG + Exonic
1134714512 16:16350268-16350290 TATCATCCGCTGAGGGTGGAAGG - Intergenic
1134714534 16:16350394-16350416 TATCATCCGCTGAGGGTGGAAGG - Intergenic
1134714556 16:16350522-16350544 TATCATCCGCTGAGGGTGGAAGG - Intergenic
1134722387 16:16393632-16393654 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134722409 16:16393758-16393780 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134722431 16:16393886-16393908 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134944996 16:18317983-18318005 TATCATCCGCTGAGGGTGGAAGG + Exonic
1134945018 16:18318111-18318133 TATCATCCGCTGAGGGTGGAAGG + Exonic
1134945040 16:18318237-18318259 TATCATCCGCTGAGGGTGGAAGG + Exonic
1134952260 16:18358136-18358158 TATCATCCGCTGAGGGTGGAAGG + Intergenic
1134952282 16:18358264-18358286 TATCATCCGCTGAGGGTGGAAGG + Intergenic
1134952304 16:18358390-18358412 TATCATCCGCTGAGGGTGGAAGG + Intergenic
1135310926 16:21404063-21404085 GATCATCCGCTGAGGGTGGAAGG + Intronic
1135310977 16:21404354-21404376 TATCATCTGCTGAGGGTGGAAGG + Intronic
1135311051 16:21404786-21404808 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135311075 16:21404924-21404946 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135311084 16:21404981-21405003 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135311094 16:21405038-21405060 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135311104 16:21405095-21405117 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135363876 16:21836500-21836522 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135364002 16:21837237-21837259 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135364026 16:21837375-21837397 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135364036 16:21837432-21837454 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135364046 16:21837489-21837511 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135364056 16:21837546-21837568 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135447786 16:22533802-22533824 TATCATCCGCTGAGGGTGGAAGG - Exonic
1135447796 16:22533859-22533881 TATCATCCGCTGAGGGTGGAAGG - Exonic
1135447806 16:22533916-22533938 TATCATCCGCTGAGGGTGGAAGG - Exonic
1135447815 16:22533973-22533995 TATCATCCGCTGAGGGTGGAAGG - Exonic
1135447839 16:22534111-22534133 TATCATCCGCTGAGGGTGGAAGG - Exonic
1135447911 16:22534546-22534568 TATCATCTGCTGAGGGTGGAAGG - Exonic
1135447939 16:22534710-22534732 GATCATCCGCTGAGGGTGGAAGG - Exonic
1136150259 16:28342990-28343012 TATCATCCACTGAGGGTGGAAGG + Exonic
1136166496 16:28456828-28456850 TATCATCCACTGAGGGTGGAAGG + Exonic
1136196477 16:28658204-28658226 TATCATCCACTGAGGGTGGAAGG - Exonic
1136212817 16:28772329-28772351 TATCATCCACTGAGGGTGGAAGG - Exonic
1136257543 16:29052248-29052270 TATCATCCGCTGAGGGTGGAAGG - Exonic
1136307775 16:29383896-29383918 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136307800 16:29384034-29384056 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136307810 16:29384091-29384113 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136321131 16:29485093-29485115 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136321170 16:29485326-29485348 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136321195 16:29485464-29485486 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136321205 16:29485521-29485543 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136321214 16:29485578-29485600 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136321224 16:29485635-29485657 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136435746 16:30224685-30224707 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136435851 16:30225296-30225318 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136435876 16:30225434-30225456 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136435885 16:30225491-30225513 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136435894 16:30225548-30225570 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136435904 16:30225605-30225627 TATCATCCGCTGAGGGTGGAAGG + Exonic
1140367236 16:74391567-74391589 TATCATCCACTGAGGGTGGAAGG - Exonic
1143178879 17:4972282-4972304 CATCATCTGAAGCTGGTGGGAGG + Exonic
1143934552 17:10469297-10469319 TATCAGATGAAGAAGGTGGCAGG + Exonic
1143963116 17:10736995-10737017 CATGAACTGGAGAGGGTGGAAGG + Intergenic
1145112566 17:20176684-20176706 TATACTCTGAAGAGGGAAGAAGG - Intronic
1147292515 17:39455433-39455455 AATCATCTGAACATGGTGGCAGG + Intergenic
1153749155 18:8211309-8211331 CAGCATCAGAACAGGGTGGAAGG + Intronic
1154116968 18:11619721-11619743 TATCATCCACTGAGGGTGGAAGG + Intergenic
1157952976 18:52061021-52061043 TAGCATCTGAAGAGGGTCTCAGG - Intergenic
1159126955 18:64235183-64235205 TATTATATGATGAGGGAGGAAGG + Intergenic
1163018771 19:14471977-14471999 TGTCATCTGAAGAGGATCAAGGG + Intergenic
1164086273 19:21905494-21905516 TATCATGAGAAGAGCGTGGGGGG + Intergenic
925341340 2:3139788-3139810 TATCATCTTAAAAGTGTTGAGGG - Intergenic
926225161 2:10961914-10961936 TGTCACCTGAAGAGGTTGGATGG + Intergenic
926362071 2:12098583-12098605 TATCATTTGGACAGGGAGGAAGG + Intergenic
927881338 2:26692176-26692198 TATGCTGTGATGAGGGTGGAGGG + Intergenic
927914472 2:26926111-26926133 TATCATCTGAGAAGGGTGTTAGG - Intronic
928959773 2:36912148-36912170 GATAATCTGAAGAAGGTGGTAGG - Intronic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
933979634 2:87539417-87539439 TAGGGACTGAAGAGGGTGGAGGG + Intergenic
935527590 2:104190161-104190183 TATTATAAGAAGAGGGTTGAAGG - Intergenic
936025360 2:109027528-109027550 TATCATAAACAGAGGGTGGATGG - Intergenic
936314186 2:111411374-111411396 TAGGGACTGAAGAGGGTGGAGGG - Intergenic
937146074 2:119645946-119645968 TATCATCTGAAATGTGTGTATGG + Intronic
937476582 2:122220496-122220518 TATCATCTGCTGAAGGAGGAGGG - Intergenic
941140815 2:161779083-161779105 CATCATCTTAACAGGGTGGAAGG + Intronic
942013542 2:171788814-171788836 TTTCATCTGAATAGGGTGCAAGG - Intronic
943220397 2:185096596-185096618 TTTGATCTAAAGAGTGTGGAAGG + Intergenic
944127998 2:196316103-196316125 TATCATCTTAAGCAGGTAGAGGG - Intronic
944681088 2:202077326-202077348 AAGCATCTGAAGACGATGGAAGG - Intronic
947754438 2:232551158-232551180 TCTCATCTGCAGAGTGGGGACGG + Intronic
1169091870 20:2865775-2865797 TCTTGTCTGAGGAGGGTGGAGGG + Intronic
1169281425 20:4270435-4270457 GAATATTTGAAGAGGGTGGAGGG - Intergenic
1169388890 20:5173594-5173616 TATCATCTGCAGAGACTGGCAGG - Exonic
1173541900 20:43859702-43859724 TAGCATCTGCAGAGGTTTGAGGG - Intergenic
1175225308 20:57440993-57441015 TATCGTCTTAAGAGGGTGTTTGG - Intergenic
1175391339 20:58629321-58629343 TGTCATCTGCAGAGGCTGGCTGG - Intergenic
1176669859 21:9723007-9723029 TATCATCGGAAAAAGGAGGAAGG - Intergenic
1178627580 21:34231096-34231118 TTGCATCAGAGGAGGGTGGAGGG + Intergenic
1179354608 21:40647709-40647731 TATTATCTGATGAGGTTTGAAGG - Intronic
1180858133 22:19061035-19061057 TATCAGCTAATGATGGTGGAAGG - Intronic
1181325925 22:22045868-22045890 TGTCATCTGAAGAGCCGGGAGGG - Intergenic
1181949986 22:26546859-26546881 TATCAAGGGAAGAGGGTGAAGGG + Intronic
1183489229 22:38107967-38107989 TTTCAGCGGAAGAGGGTGGTGGG - Intronic
1184339852 22:43880264-43880286 TATCAGGTCCAGAGGGTGGAAGG - Exonic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
1184668473 22:46000823-46000845 CATCATCTGCCCAGGGTGGAAGG - Intergenic
949261955 3:2113160-2113182 GAGCAACTGAAGCGGGTGGAAGG + Intronic
950106629 3:10392810-10392832 TGTCATCTGTAGAGTGGGGAGGG + Intronic
950934677 3:16826278-16826300 TCCCATCTAAAGAGAGTGGATGG - Intronic
955963966 3:64368978-64369000 TATCAGCTGGGGAGGGTGGCAGG + Intronic
962113743 3:132478785-132478807 TAACATTTGAACATGGTGGAGGG + Intronic
963757996 3:149256115-149256137 TTACATGTGAAGAGGGTGGAGGG + Intergenic
966264940 3:178028568-178028590 TATTATATGGAGAGGGTGAAGGG + Intergenic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
967498557 3:190170290-190170312 TATCATCTTAAGAGAGTTGACGG + Intergenic
967871001 3:194228990-194229012 GAGCATCTGTAGAGGGTGGGGGG - Intergenic
971098632 4:23436819-23436841 TATCATTGGGAGAGGCTGGAAGG + Intergenic
971851125 4:31987454-31987476 TAACCTCTGAAGAGGGTGTGGGG + Intergenic
978987996 4:115039349-115039371 TAAAATCTGTAGAGGCTGGAGGG + Intronic
982106520 4:152016205-152016227 CGGCATCTGATGAGGGTGGAAGG - Intergenic
984657195 4:182330928-182330950 TCTCATCTGAAGAGGGAGAGTGG + Intronic
984720306 4:182966043-182966065 TAGCATCTGTAGAGGGAGAATGG - Intergenic
986432403 5:7694038-7694060 GATCATCTGAACAGAGTGGAGGG + Intronic
987769660 5:22284398-22284420 TCTCATCTGAAGACTGAGGATGG + Intronic
989049174 5:37301931-37301953 TATCTTCAGCAGAGGGTGGAAGG - Intronic
989725806 5:44585053-44585075 TTGCATTTGAAGATGGTGGATGG + Intergenic
990254583 5:53953605-53953627 TTTCATATGAAGAGGGTGGAGGG + Intronic
994392856 5:99206375-99206397 TAACATCTGGGGAGGGGGGAAGG - Intergenic
997824002 5:137090402-137090424 TGTGATCTGCAGAGGGAGGAAGG - Intronic
997882239 5:137601473-137601495 CATCAGCTGAAGGGAGTGGAGGG + Intergenic
998090741 5:139366546-139366568 TATGATCTGAATAGTCTGGAGGG + Intronic
1001077566 5:168641884-168641906 TATCATGAGAAGAGCATGGAGGG - Intergenic
1001711908 5:173785929-173785951 TATCTTCTGAAAGGGGAGGAAGG - Intergenic
1003552944 6:7115158-7115180 TCTCCTCTTGAGAGGGTGGATGG + Intronic
1003668218 6:8131377-8131399 TATCATCTGAGCACGGTGCAGGG + Intergenic
1004633702 6:17446704-17446726 TATCATCAGAAGAGGGGAAAAGG + Intronic
1006264461 6:32907205-32907227 TTTTATCTGAATAGGGTGGATGG - Intergenic
1006413534 6:33890066-33890088 TTTCATATGAAGAGGATGGCTGG + Intergenic
1006777727 6:36609045-36609067 TCTCAACAGAAGTGGGTGGAAGG + Intergenic
1008621997 6:53279900-53279922 TATCCTCTGAGGGGGATGGAGGG - Intronic
1009535431 6:64877000-64877022 TAACATCAGAAGAGGGAAGATGG + Intronic
1011364199 6:86562760-86562782 TATAAAATGAAGAGGTTGGATGG - Intergenic
1011445678 6:87436561-87436583 AGTCATCTGAGGAGGGTGGGGGG + Intronic
1012077983 6:94717993-94718015 GATCATTGGAACAGGGTGGAAGG + Intergenic
1012237197 6:96832624-96832646 TATTATATCATGAGGGTGGAGGG + Intronic
1013870443 6:114752220-114752242 AAGTATCTGAAAAGGGTGGATGG + Intergenic
1017082531 6:150683164-150683186 TATCCTCTGTAGAGGGCAGATGG + Intronic
1019778115 7:2924360-2924382 TGTCATCTGCAGAGGGACGAGGG + Exonic
1021864055 7:24937216-24937238 TATCATGAGAACAGGATGGAGGG + Intronic
1023925930 7:44669637-44669659 CATCATATGAAGGGGGTGGAGGG + Intronic
1028976015 7:96914996-96915018 TAACAAATGAAGAGGGTGGGAGG - Intergenic
1030218200 7:107068252-107068274 CATCGTCTAAAGAGGCTGGAGGG + Intronic
1033050594 7:138000988-138001010 TTTCCTCCGAAGAGGGAGGAAGG + Intronic
1033296581 7:140143347-140143369 TGTCATCTGAAAAGGATGGCAGG + Intronic
1039318868 8:36405782-36405804 TAGCATCCAAAGATGGTGGAGGG - Intergenic
1040970727 8:53135043-53135065 AATCATCCTAAGAGGGTGGGAGG + Intergenic
1042801611 8:72723855-72723877 AATTATCTGAAGAGGCTAGAGGG + Intronic
1044580007 8:93815758-93815780 TAACGTCTGGAGAGGGTGGATGG - Intronic
1045379879 8:101612449-101612471 TAGCATCTTCAGAGTGTGGATGG + Intronic
1045710819 8:104981659-104981681 TACGATGTGAAGAGAGTGGACGG - Intronic
1048207017 8:132423425-132423447 CATCATCTGAAAAGGCAGGAAGG + Intronic
1049488728 8:142879823-142879845 TTGCAGCTGAACAGGGTGGAGGG - Exonic
1050901587 9:10956245-10956267 TATCTTCTGAAGTGTGTAGAGGG + Intergenic
1050909079 9:11043635-11043657 ACATATCTGAAGAGGGTGGACGG - Intergenic
1051502134 9:17789392-17789414 CATCATCTAAAGAAGTTGGAGGG + Exonic
1051953458 9:22662437-22662459 TATCCTCTTAAAAAGGTGGATGG - Intergenic
1053392686 9:37746843-37746865 AAACATTTGAAGAGGGTGGGTGG - Exonic
1055982098 9:82014205-82014227 TGACATCTGGAGAGTGTGGAGGG + Intergenic
1057620020 9:96626534-96626556 CATCATCTGCAAAGGGTGAAGGG - Intergenic
1059131849 9:111760220-111760242 TTTCATCAAAAAAGGGTGGATGG - Intronic
1061536926 9:131256035-131256057 TGTCAGCTGGAGAGGCTGGAGGG + Intergenic
1061542488 9:131285114-131285136 TAACATGGGAAGAGGGTGGTTGG + Intergenic
1186691696 X:11984729-11984751 TATCATCTCAAGAAAGTGAAAGG + Intergenic
1189351032 X:40275876-40275898 TACCATAAGAAGTGGGTGGAAGG - Intergenic
1190051825 X:47156270-47156292 TATCACCTTAAGAGTGGGGAAGG - Intronic
1190259574 X:48789644-48789666 CTTCCTCTGAAGAGGGTGGCAGG - Intronic
1190300618 X:49054891-49054913 GAAGATCTGAACAGGGTGGAGGG - Intronic
1193095848 X:77548134-77548156 TTACATCTGAAAAGGGTGGTTGG + Intronic
1196463260 X:115950274-115950296 TTTCCTCTGCAAAGGGTGGAGGG - Intergenic
1196787482 X:119433661-119433683 TAACATCTGATGAGTTTGGAAGG + Intronic
1198566205 X:137907613-137907635 TATCATGAGAAGAGCATGGAGGG - Intergenic
1199443196 X:147892309-147892331 TAGCAGCTAAAGAGAGTGGAAGG - Intergenic
1201337678 Y:12897828-12897850 TATGATGTGGTGAGGGTGGAAGG + Intergenic