ID: 1117133473

View in Genome Browser
Species Human (GRCh38)
Location 14:52708879-52708901
Sequence CTCTAATTCTTGAGGCAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 88}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117133471_1117133473 15 Left 1117133471 14:52708841-52708863 CCTGATGATTGACAAAGCAGTTT 0: 1
1: 0
2: 0
3: 10
4: 167
Right 1117133473 14:52708879-52708901 CTCTAATTCTTGAGGCAAGCAGG 0: 1
1: 1
2: 0
3: 7
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117133473 Original CRISPR CTCTAATTCTTGAGGCAAGC AGG Intronic
903419822 1:23210641-23210663 CTCAAATTCCTGTTGCAAGCAGG - Intergenic
915565178 1:156708953-156708975 CATTACTTCTTGAGGCTAGCAGG + Intergenic
915941181 1:160119453-160119475 CTCTATTTCCTGAGGGAAGTGGG + Intronic
917266161 1:173223068-173223090 CTGAAAAGCTTGAGGCAAGCTGG - Intergenic
919417185 1:197325690-197325712 CTCAAACTGTTGAGACAAGCAGG - Intronic
920423117 1:205849602-205849624 GTGTAATACTCGAGGCAAGCAGG + Intronic
1063190333 10:3687864-3687886 CTCAAATTATTGAGTCAGGCTGG - Intergenic
1065357677 10:24858383-24858405 TTCTCATTGTTGAGGTAAGCTGG - Exonic
1065925085 10:30427994-30428016 CTCTATTGCTTAAGGCAGGCAGG + Intergenic
1066065979 10:31761091-31761113 CTGGGATCCTTGAGGCAAGCAGG - Intergenic
1066598822 10:37081791-37081813 CACTAATACTTCAGGCAAGCAGG - Intergenic
1071837538 10:89433909-89433931 CTCTAAATTTTGAGGAAAACCGG + Intronic
1073704671 10:105969740-105969762 TTCTGATTCTTGAGCCCAGCTGG + Intergenic
1073783377 10:106863561-106863583 CTCTATTTCATGAGGGATGCTGG - Intronic
1077765121 11:5150504-5150526 CTCTGATTCTTGAGGAATGATGG - Intergenic
1085185054 11:74568904-74568926 CTCTAATTCTTCAGGCTTTCTGG + Intronic
1088840833 11:113626411-113626433 CTCTAGTTCTGGAGGCTAGAAGG + Intergenic
1099994057 12:89757581-89757603 CTCTTATTCTTAAGGGATGCAGG - Intergenic
1100246027 12:92757747-92757769 CTCTGATTCTGGAAGCCAGCTGG - Intronic
1102271603 12:111541242-111541264 CTTTAATTCTGGAGGAAAGGTGG - Intronic
1106369025 13:29113349-29113371 CTCTAATTCTTGAGGCAAGTGGG - Intronic
1110624281 13:77634379-77634401 CTCTAACACTGGAGCCAAGCAGG + Exonic
1117133473 14:52708879-52708901 CTCTAATTCTTGAGGCAAGCAGG + Intronic
1118766390 14:68912357-68912379 CTCTACTTCTAGAGGGAAACAGG + Intronic
1120259031 14:82159320-82159342 CTATGATTCTAGAGGCAAGATGG - Intergenic
1121185115 14:91960382-91960404 GTCTAATTCTTGAGATATGCCGG - Intergenic
1127037658 15:54936369-54936391 CACTAATTTTTAAGTCAAGCTGG + Intergenic
1127698466 15:61474176-61474198 CTTTATTTCTTAAGGCAATCAGG - Intergenic
1134339640 16:13333295-13333317 TTCTGATTCTTCAGGCAATCTGG + Intergenic
1147045358 17:37747223-37747245 TTATCCTTCTTGAGGCAAGCTGG - Intergenic
1157102109 18:44740448-44740470 TAATAATTCTTGAGGCAAGTTGG - Intronic
1160123084 18:76147692-76147714 CTCTAAAACCTTAGGCAAGCTGG + Intergenic
1163679528 19:18672629-18672651 CTCTCATTCTGGTGGCCAGCCGG + Intergenic
1165529178 19:36382415-36382437 CTGGAATTCTAGAGGCAAGAGGG + Intergenic
1165946524 19:39446079-39446101 CTCTATCTCTTGAGACAATCTGG - Intronic
1166626881 19:44365886-44365908 ATTTAATTCTTGAGCCCAGCTGG - Intronic
925495423 2:4443389-4443411 CTCTAATTCAGGAAGAAAGCTGG + Intergenic
925758382 2:7157418-7157440 CTCTAAGTATTGGGGCAAGTAGG + Intergenic
926378498 2:12260266-12260288 CTCTGATCCTTGAGCAAAGCAGG - Intergenic
926894002 2:17664366-17664388 CTCTAGTTATTGAGGAAAACTGG - Exonic
930601026 2:53443285-53443307 TTATAATTCTTGAGACGAGCTGG - Intergenic
938546622 2:132338643-132338665 ATTTAATTCTTGAGCCCAGCTGG + Intergenic
939390862 2:141568377-141568399 CTTTACTTCTTGAGGCACTCAGG - Intronic
939790881 2:146574064-146574086 TTCTAATTCTGGAGGCATGTGGG + Intergenic
941128661 2:161618827-161618849 CTCTCATTCCTGATGCAGGCTGG + Intronic
942035492 2:172006507-172006529 TTCTAATGCTTGAGGAAAGCGGG - Intronic
942900717 2:181114124-181114146 TTCTAATTCTTCTAGCAAGCTGG + Intergenic
948551753 2:238777716-238777738 GTCTAATTCCTGAGGCCAGCAGG + Intergenic
1170352286 20:15455001-15455023 CTCTCATTGATGAGGAAAGCTGG + Intronic
1171875486 20:30571377-30571399 ATTTAATTCTTGAGCCCAGCTGG + Intergenic
1172993468 20:39052586-39052608 CTTTGTTTCTTGAGGCAAGTGGG + Intergenic
1174729450 20:52901367-52901389 CCCTAACTCTTGAGGCAAGTTGG - Intergenic
1174898018 20:54471224-54471246 CTCTCATTTTGGAGGCAAGATGG + Intergenic
1179187303 21:39094767-39094789 CTCTCATTCTGGGGACAAGCTGG - Intergenic
1179341959 21:40520237-40520259 CTCTCATTCTAGAGGCACACAGG + Intronic
1179894124 21:44351835-44351857 CTCTAATCCCAGAGGCAAGCAGG - Intronic
1180632274 22:17237812-17237834 CTCTAAGGCTAGAGGCAAGTTGG - Intergenic
951924906 3:27898561-27898583 CTTTTATTCTTGATGCAGGCTGG + Intergenic
953534187 3:43764970-43764992 GGACAATTCTTGAGGCAAGCAGG - Intergenic
957283779 3:78188751-78188773 CTCTACTTCATCAGGAAAGCTGG - Intergenic
960342231 3:116487385-116487407 CTCTGATTCAAGTGGCAAGCTGG - Intronic
966645681 3:182244404-182244426 CTCACATTCCTGAGGCAATCTGG + Intergenic
967271106 3:187733750-187733772 CTCTGATACCTGTGGCAAGCAGG - Exonic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
968011227 3:195278902-195278924 CACATATTCTTGAGGCAGGCAGG + Exonic
970446677 4:16129014-16129036 CTCTACTTCTTGAAGAAAGCTGG - Intergenic
975155084 4:71062468-71062490 CTCTAGTTCTTAGGGCAAGAGGG + Intergenic
977732464 4:100370360-100370382 TTCTGCTTTTTGAGGCAAGCAGG - Intergenic
983146062 4:164216019-164216041 ATATAATTCTTGAGGCCACCTGG + Intronic
983511800 4:168616883-168616905 CTCTATTACTTGAGGCATGAGGG - Intronic
983905874 4:173182628-173182650 CTCTGAATGATGAGGCAAGCAGG + Intronic
993112614 5:83677395-83677417 CTTTAATGCTTCATGCAAGCTGG + Intronic
998029951 5:138857775-138857797 CTCAAATTCTGGAGCCAGGCTGG - Intronic
999579138 5:153014580-153014602 TTCTAATTCTTGGGAGAAGCAGG - Intergenic
1007420713 6:41717660-41717682 CTCTAATGCTGGGAGCAAGCAGG + Intronic
1017957336 6:159189522-159189544 CTCTAAGAATTTAGGCAAGCAGG + Intronic
1019843845 7:3476914-3476936 CTCTAACTGGTGAGGCATGCAGG + Intronic
1020764848 7:12306627-12306649 CTTTAATTCTCAAGGCTAGCTGG - Intergenic
1029236892 7:99127563-99127585 CTCTTTCTCTGGAGGCAAGCTGG + Intronic
1032246510 7:130218122-130218144 GCCTAAGTCTTGAGGAAAGCTGG + Intergenic
1036637203 8:10559545-10559567 CTCTAATTCTGCTGGGAAGCTGG - Intergenic
1038387550 8:27163468-27163490 TTCTAATTCTGGTAGCAAGCAGG + Intergenic
1041944191 8:63423513-63423535 CTCTGTTCCTTGTGGCAAGCAGG + Intergenic
1042566507 8:70117260-70117282 CTCTAAGTCTTCAGACTAGCTGG + Intronic
1042710110 8:71707856-71707878 CTCACATTCTAGAGGCAAGCTGG + Intergenic
1046089622 8:109485574-109485596 CTATAATTGTTGAGGAAAGAAGG + Intronic
1047098509 8:121650260-121650282 CTCTGATTCTTGAAGCCACCTGG - Intergenic
1048846956 8:138611181-138611203 CTCCATTTCTGGAGGCAAGAGGG - Intronic
1049028710 8:140016057-140016079 TACTAATTCTTGAGGAAAGAAGG - Intronic
1057352754 9:94314529-94314551 CTCTCATTCCTGAGGAATGCAGG + Intergenic
1057717440 9:97505660-97505682 CCCTAATTCTTGCATCAAGCTGG + Intronic
1058644689 9:107119715-107119737 CTCTAATTCTTATGAGAAGCAGG + Intergenic
1187258346 X:17661555-17661577 CTCTACCTCCTGAGGCAGGCAGG - Intronic
1195789475 X:108567192-108567214 CTCTAATTCTTTAGCAAAACTGG - Intronic
1198280234 X:135134311-135134333 GTCCAGTTCTTGAGGCAAGGAGG + Intergenic
1198290724 X:135238203-135238225 GTCCAGTTCTTGAGGCAAGGAGG - Intergenic
1198638338 X:138725614-138725636 CTGTACTTCTTCAGGGAAGCTGG + Intronic