ID: 1117139863

View in Genome Browser
Species Human (GRCh38)
Location 14:52778199-52778221
Sequence TTTCAGTCCAGTATTTATGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 4, 3: 15, 4: 157}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117139860_1117139863 26 Left 1117139860 14:52778150-52778172 CCCAAAGTAATCTTCTAAATGTC 0: 1
1: 0
2: 2
3: 22
4: 291
Right 1117139863 14:52778199-52778221 TTTCAGTCCAGTATTTATGGAGG 0: 1
1: 0
2: 4
3: 15
4: 157
1117139861_1117139863 25 Left 1117139861 14:52778151-52778173 CCAAAGTAATCTTCTAAATGTCA 0: 1
1: 1
2: 4
3: 16
4: 325
Right 1117139863 14:52778199-52778221 TTTCAGTCCAGTATTTATGGAGG 0: 1
1: 0
2: 4
3: 15
4: 157
1117139859_1117139863 30 Left 1117139859 14:52778146-52778168 CCAGCCCAAAGTAATCTTCTAAA 0: 1
1: 0
2: 8
3: 33
4: 373
Right 1117139863 14:52778199-52778221 TTTCAGTCCAGTATTTATGGAGG 0: 1
1: 0
2: 4
3: 15
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117139863 Original CRISPR TTTCAGTCCAGTATTTATGG AGG Exonic
901263362 1:7890182-7890204 TTTCATTCCACTCTTAATGGAGG - Intergenic
903564657 1:24255812-24255834 TTTAAGTCCAGTTTATATGAAGG - Intergenic
904332855 1:29775300-29775322 CTTCATTCCAGTTTTTATGGTGG + Intergenic
907357884 1:53891454-53891476 TTTCAGTCCAGTCTTTCTCAAGG - Intronic
909163392 1:72183523-72183545 TTTGATTACAGTATTTATAGGGG - Intronic
910005557 1:82392139-82392161 TTTCAGTTCAATATTTTTGTGGG + Intergenic
912010988 1:104962511-104962533 TTTCAGTTCAATATTTATAATGG + Intergenic
919166521 1:193901995-193902017 TGTAAGTCCAGTATGTATGATGG - Intergenic
920663787 1:207943276-207943298 CTTAAGTGCAGTATTTATTGAGG + Intergenic
921909691 1:220534070-220534092 GTGCAGTACAGTATTTTTGGTGG + Intronic
922103535 1:222493341-222493363 TGTAATTCCAGAATTTATGGAGG + Intergenic
922263848 1:223965855-223965877 TGTAATTCCAGAATTTATGGAGG + Intergenic
923062701 1:230490478-230490500 TTTGAGTGCAGTTTTTTTGGGGG + Intergenic
1064399921 10:15012776-15012798 ATTCAGTGCAGTATTTCAGGTGG - Intergenic
1065396655 10:25246399-25246421 CTTGAGTCCAGTTTTTAGGGGGG - Intronic
1066129592 10:32379551-32379573 TTTCAGTACTGTATTTATTTTGG - Intergenic
1077592575 11:3504083-3504105 TTTCATTCCAGTAGTTTTTGGGG + Intergenic
1077644547 11:3911994-3912016 TCTGTGACCAGTATTTATGGTGG - Intronic
1079823010 11:25155372-25155394 TTTTAGCCCACTATTTATTGGGG + Intergenic
1082089721 11:48079493-48079515 GTTCAGTGCAGTTTTTATGGAGG + Intronic
1082297579 11:50461017-50461039 TTTCATTCCAGTTTTTATCCTGG - Intergenic
1082300656 11:50500835-50500857 TTTCATTCTAGTTTTTATCGTGG + Intergenic
1083272489 11:61579503-61579525 TTTCAGTCCAGTCGATATTGAGG - Intronic
1084248412 11:67876808-67876830 TTTCATTCCAGTAGTTTTTGGGG + Intergenic
1085689584 11:78654352-78654374 TTGCAGTCTTGTATTTGTGGTGG - Exonic
1085853834 11:80153320-80153342 TTTCTATTCAGTATTTTTGGAGG - Intergenic
1086590296 11:88508029-88508051 CTTGGGTCCAGTATTTACGGAGG - Exonic
1086880700 11:92150216-92150238 TTTCAGTCGAGTGTTTAGTGTGG + Intergenic
1090519095 11:127459636-127459658 TTTCAGTACACTATTTGTGGGGG + Intergenic
1091162246 11:133434949-133434971 TTTCTGTACAGAATGTATGGTGG - Intronic
1095330402 12:40954904-40954926 TTTCTGTCCAGAGTTTTTGGGGG + Intronic
1100445300 12:94654518-94654540 TTTCAGGACAGTATCTCTGGTGG + Intergenic
1100763643 12:97837821-97837843 TTTAAGTCCTGTATTTGTTGTGG - Intergenic
1100868239 12:98880872-98880894 TCTCCTTCCAGTAATTATGGGGG - Intronic
1103793088 12:123485403-123485425 TTTAATTCCAGTATTTTGGGAGG - Intronic
1103815714 12:123654029-123654051 TTTCAGTCCACAATATATGTGGG - Intronic
1108821238 13:54353216-54353238 TATCAGTCTAGAATTGATGGGGG - Intergenic
1109168169 13:59061404-59061426 TTTCAGACCAGTTTTCATGGTGG + Intergenic
1112165656 13:96917338-96917360 TTTCAATACAGTATTACTGGGGG - Intergenic
1112343447 13:98571245-98571267 TTTCAGTTCAGTATTTTTCCAGG - Intronic
1117139863 14:52778199-52778221 TTTCAGTCCAGTATTTATGGAGG + Exonic
1119625209 14:76168365-76168387 TATTAGTCAAGTATTTATTGTGG + Intronic
1120147476 14:80995013-80995035 TTTAAGTCCATTATATATGCTGG - Intronic
1120171367 14:81249672-81249694 TTTCAGGCCAATAATTTTGGGGG - Intergenic
1126182406 15:45798344-45798366 TGTAATTCCAGCATTTATGGAGG - Intergenic
1126624810 15:50676404-50676426 CTTTTGTCCAGAATTTATGGTGG - Intronic
1126894045 15:53238883-53238905 TTTCATTCTAGTTTTTTTGGGGG - Intergenic
1127163231 15:56214133-56214155 TATAATTACAGTATTTATGGCGG - Intronic
1129460491 15:75697969-75697991 TGTGAATCCAGTCTTTATGGAGG - Intronic
1129724372 15:77894067-77894089 TGTGAATCCAGTCTTTATGGAGG + Intergenic
1130419394 15:83728628-83728650 TTTAAGTGCAGAATTTATGTTGG - Intronic
1130951652 15:88595632-88595654 TTTCTCTCCAGTATTTGTTGTGG + Intergenic
1134045303 16:11096666-11096688 TTTCACTCCAGGCCTTATGGGGG + Intronic
1138065630 16:53938442-53938464 TTTCAGACCAGTGATGATGGAGG + Intronic
1138509016 16:57497264-57497286 TTTCAGTCCAGCATTGATGCTGG + Intergenic
1139031488 16:62887184-62887206 CTTCAGTCCATTATTGATAGAGG + Intergenic
1139823301 16:69737763-69737785 TTCCAGCCAAGTATTTCTGGGGG + Intergenic
1141964007 16:87429211-87429233 TTTCATTCCAGTATTTCAAGAGG + Intronic
1203012336 16_KI270728v1_random:307923-307945 TTTCCTTCCAGTATTTATCCTGG - Intergenic
1203030671 16_KI270728v1_random:581082-581104 TTTCCTTCCAGTATTTATCCTGG - Intergenic
1203041050 16_KI270728v1_random:753349-753371 TTTCCTTCCAGTATTTATCCTGG + Intergenic
1143576192 17:7794683-7794705 TCTCAGTGCAGAATTTAAGGGGG + Intronic
1144577630 17:16439039-16439061 TTTCATTCCCGTTGTTATGGAGG + Intergenic
1148487498 17:48000255-48000277 TTTCAGTCTGGTCTTTATGATGG + Intergenic
1148870161 17:50654013-50654035 TTTCAGTTCACTATGTAAGGAGG + Intronic
1149404564 17:56334785-56334807 TTTTATTCCATTCTTTATGGTGG - Intronic
1151087894 17:71402318-71402340 TTTCAATCCAGCATTTTTTGAGG + Intergenic
1153176557 18:2380283-2380305 TTTGAGTGCAGGATTTATGTTGG - Intergenic
1154994112 18:21623657-21623679 TTGTAGTCCAGTATTTACTGTGG + Intronic
1155251480 18:23957193-23957215 TTTCAGTGCAGCAGTTTTGGGGG - Intergenic
1156720249 18:40061326-40061348 TTTCAGTGGAATATTTAGGGTGG - Intergenic
1157111271 18:44822650-44822672 TTTCAGTTCAGTATCTTTAGCGG - Intronic
1159251881 18:65890038-65890060 TGTAATTCCAGTATTTAAGGAGG - Exonic
1162101966 19:8344194-8344216 TGTAAATCCAGTATTTAGGGAGG + Intronic
924987226 2:283116-283138 TGTCAGTCCAGTGTGCATGGAGG - Exonic
929116093 2:38445468-38445490 TTTCAGTCCAGAGTATATGAAGG - Intergenic
932663883 2:73680662-73680684 TTTTACTCCAGTGTCTATGGAGG - Intergenic
936341487 2:111637393-111637415 ATTCAATCCAGTATCTATGTGGG + Intergenic
940571004 2:155433089-155433111 TTTGAGTACAGTATTTTTGTGGG + Intergenic
941904180 2:170705349-170705371 TATCAGTCCAGTATCTTTAGAGG - Intergenic
942873241 2:180761845-180761867 TTTCAGTCTAGGATTCATGCTGG - Intergenic
943593164 2:189822935-189822957 TCTCAGTCTACTATTTATGGAGG - Intronic
944201733 2:197114828-197114850 TTTCACACCAGTATTTTAGGAGG - Intronic
946948542 2:224847697-224847719 TTTCTGTCCTGAATTTGTGGGGG + Intronic
947475078 2:230438284-230438306 TTTCATTTCAGTAGTTTTGGGGG + Intronic
947983249 2:234427442-234427464 TTTTAGAGCAGTACTTATGGTGG + Intergenic
1168774999 20:440090-440112 ATTCTGTGCAGTATTAATGGGGG - Intronic
1169580209 20:7013815-7013837 TTTCAATCCAGTAGAGATGGTGG + Intergenic
1173026467 20:39311835-39311857 TAACAATCCAGTAGTTATGGTGG - Intergenic
1173071885 20:39776034-39776056 TTGCTTTCCATTATTTATGGGGG + Intergenic
1177752638 21:25304462-25304484 TTCAAGACCAGTATTTATGTTGG + Intergenic
1178542896 21:33470081-33470103 TTTCTTTCTAGAATTTATGGTGG - Intronic
1178702372 21:34844558-34844580 TATTTGTCCAGCATTTATGGAGG - Intronic
1179671859 21:42954901-42954923 TTTCAGTGCAATATTTCAGGTGG - Intergenic
1184351136 22:43945036-43945058 TTTGAGTGCAGCATTGATGGTGG + Intronic
1185004420 22:48267369-48267391 TTTCAATCGAGCATTTATGTTGG - Intergenic
949317664 3:2774500-2774522 TTTCAGTCAATTATTTGTAGAGG - Intronic
950595626 3:13978649-13978671 TTTCAGTGGAGTTTTTCTGGGGG + Intronic
955203256 3:56871867-56871889 TTTCTTTCCAGTATGAATGGAGG + Intronic
955388572 3:58500623-58500645 TTTCAGGCCAGAATATATGTGGG - Intronic
957721104 3:84000392-84000414 TTTCATTCCAGTAATTTTTGGGG + Intergenic
958529005 3:95300330-95300352 TTACAGTTCACTATGTATGGAGG - Intergenic
958668464 3:97171017-97171039 TTTCAGTCCATTATTTATAGTGG - Intronic
959271457 3:104216108-104216130 TTTCTTTCAAGTATTTAAGGAGG - Intergenic
961626533 3:128267901-128267923 TTTCAGTCCAGTGTTCTTGCTGG - Intronic
962025195 3:131540512-131540534 TTACAGTCAAGTATGTATGGGGG + Intronic
966270701 3:178101595-178101617 TTTTAGTTCAGTTTTTATGTGGG + Intergenic
967966219 3:194962068-194962090 TTCTAGACCAGTATTTAAGGAGG - Intergenic
969064888 4:4470890-4470912 TTCCAATGCAGTATTCATGGTGG + Intronic
969504843 4:7579040-7579062 TTTCATTTCAGTATTTATGGAGG + Intronic
970928970 4:21486555-21486577 TTTCAGTCAATAAATTATGGAGG - Intronic
971378658 4:26076641-26076663 TATCAATCCAGTATTGATTGGGG + Intergenic
977117267 4:93045879-93045901 TCTAAGCCAAGTATTTATGGGGG + Intronic
978870002 4:113564439-113564461 TTTCAGAGAAGTATTTCTGGAGG - Intronic
981158791 4:141472265-141472287 TTTCAGACAAATATTTATTGTGG - Intergenic
985893026 5:2730876-2730898 TGTCATTCCAGTATTTTGGGAGG + Intergenic
986562951 5:9081809-9081831 GTTCAGTCCACTATTTTTGAGGG + Intronic
986825199 5:11512752-11512774 TTTCAGTCCAGGATTTCTTCTGG + Intronic
988098477 5:26647875-26647897 TTGCAGTTCGCTATTTATGGAGG - Intergenic
989849290 5:46188483-46188505 TTTCCTTCTAGTATTTATGCTGG - Intergenic
990982010 5:61610536-61610558 TGTCAGTGCAGTGTTTATGGGGG + Intergenic
992201753 5:74391710-74391732 TTTCAGTTCACTATATATGGAGG + Intergenic
997021794 5:130011181-130011203 TTTCAGGCCAGTATCTCTGATGG + Intronic
997393514 5:133536471-133536493 TTTCAGTCAATTACTTTTGGGGG + Intronic
998454004 5:142256499-142256521 TTTCACCCCAGTATTTAGAGAGG - Intergenic
998574066 5:143293669-143293691 TTTTAGTCTAGCATTTTTGGTGG + Intronic
1000141809 5:158412102-158412124 TTTCAGTCAGGTGTTTATGCAGG - Intergenic
1000675906 5:164122208-164122230 TTTCAGGCCAGTATTCCTGATGG + Intergenic
1003255741 6:4473228-4473250 TTTCACACCAGTATTTATCGAGG - Intergenic
1010163537 6:72888518-72888540 TTTGAGACCAGTAATTCTGGTGG + Intronic
1010187788 6:73163019-73163041 TTTCAGTCCAGGGTTGAGGGTGG - Intronic
1012668305 6:102007509-102007531 TTTTGATCCTGTATTTATGGAGG + Intronic
1016596825 6:145813201-145813223 TTTCAATCCAGTATTTCTCCCGG - Intronic
1016686609 6:146889253-146889275 CTTCAGTCCCTTATTTATTGTGG + Intergenic
1019039069 6:169087939-169087961 TTCCAACCCAGTATTTTTGGTGG + Intergenic
1022056428 7:26740203-26740225 TCTCAGTCCTGTATTTTGGGAGG - Intronic
1024740727 7:52351461-52351483 TTTGACTTCAGTATTTATGAAGG - Intergenic
1025528808 7:61849995-61850017 TTTCCTTCCAGTATTTATCCTGG + Intergenic
1025581187 7:62720521-62720543 TTTCCTTCCAGTTTTTATTGTGG - Intergenic
1026893674 7:73997930-73997952 TGTCATTCCAGCATTTTTGGAGG + Intergenic
1028075368 7:86506194-86506216 TTTCAGTCTAGTATTGATCATGG + Intergenic
1028577435 7:92367799-92367821 TTTCAGACCAGTATTTTTCATGG + Intronic
1030100621 7:105941917-105941939 TTTCTTTCCAGTGATTATGGGGG + Intronic
1030964114 7:115968117-115968139 TTTAAATTCAGTATTTAAGGTGG + Intronic
1031071055 7:117162446-117162468 GTTTAGTCCACTATTTATGATGG + Intronic
1031071072 7:117162544-117162566 GTTTAGTCCACTATTTATGATGG - Intronic
1031579818 7:123459152-123459174 TTTCAGTACCGTATCTATGTAGG - Intronic
1031793544 7:126141141-126141163 TTTCAGTTCATAATATATGGAGG - Intergenic
1031913502 7:127541520-127541542 TTTCAGGGCAGTACATATGGAGG - Intergenic
1032835818 7:135672413-135672435 TTGTAGTCAAGTATTTATGTGGG + Intronic
1034020305 7:147634578-147634600 TTTCATTTCAGTATTTTGGGGGG - Intronic
1037865590 8:22440460-22440482 TTCCAGTCCAGTAGCTAGGGCGG - Intergenic
1038962130 8:32532641-32532663 TTTCAGTCAAGTATTTCTTTAGG + Intronic
1040606330 8:48935630-48935652 TTTCAGTCCAGTTTTCATGGTGG - Intergenic
1041158926 8:55017697-55017719 TTTCAATCAAGTATTTATCTGGG - Intergenic
1041523745 8:58783156-58783178 TTTCAGGCAAGTATTTCTGGTGG - Intergenic
1043323893 8:79026029-79026051 TTTCAGTCAAATATTTATTCTGG + Intergenic
1043818096 8:84828457-84828479 TTTCAAGCCAGTATTTATGGAGG + Intronic
1044002759 8:86905291-86905313 TTTCAGTCAAATATTTAGTGTGG + Intronic
1044947152 8:97399963-97399985 CTTCTGTCCAGGATTTATGGAGG - Intergenic
1046451743 8:114401448-114401470 TTTAAGCCCAGAATTTTTGGGGG - Intergenic
1047050988 8:121113240-121113262 TTTCAGTCCCATACTTATGGAGG + Intergenic
1047635484 8:126757037-126757059 TTCCACTATAGTATTTATGGTGG + Intergenic
1048548464 8:135408918-135408940 TTACATTCCAGTATTCATGATGG + Intergenic
1049046099 8:140152748-140152770 TTTCAGTGATGTTTTTATGGTGG + Intronic
1051033335 9:12710873-12710895 TTACAGTATAGTTTTTATGGAGG + Intergenic
1051069291 9:13144171-13144193 TTTCTGCCCAGTTTTTGTGGAGG + Intronic
1051531998 9:18114552-18114574 TTTGAGAACAGTCTTTATGGGGG - Intergenic
1187077274 X:15947685-15947707 TTTCAGTCTGGTAATTAAGGAGG + Intergenic
1188621205 X:32226234-32226256 TTTCAGTACAGTATACATGGTGG - Intronic
1189131943 X:38508369-38508391 TTTCTTTCCACTATTTAAGGTGG - Intronic
1189184792 X:39045104-39045126 TTTTTGTTCAGTATTTTTGGTGG - Intergenic
1191577217 X:62719329-62719351 TTTCTGTCAAGTTTTTATTGGGG + Intergenic
1191582245 X:62776671-62776693 TTTCTTTCCAGTTTTTATCGGGG + Intergenic
1192225398 X:69223891-69223913 CATCAGTCCAGTATTTCTGGAGG - Intergenic
1194664521 X:96662982-96663004 TTTCAGTTCAATGTTTCTGGTGG + Intergenic
1195476843 X:105296798-105296820 TTTCAGTCCCGTATTTTTAAAGG - Intronic