ID: 1117147723

View in Genome Browser
Species Human (GRCh38)
Location 14:52852061-52852083
Sequence TTCCAAATGGGTCACAGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117147723_1117147729 14 Left 1117147723 14:52852061-52852083 CCAACACTGTGACCCATTTGGAA No data
Right 1117147729 14:52852098-52852120 TACATACAGGTATGAGGTTGTGG No data
1117147723_1117147727 1 Left 1117147723 14:52852061-52852083 CCAACACTGTGACCCATTTGGAA No data
Right 1117147727 14:52852085-52852107 TGATTTGGACTTATACATACAGG No data
1117147723_1117147728 8 Left 1117147723 14:52852061-52852083 CCAACACTGTGACCCATTTGGAA No data
Right 1117147728 14:52852092-52852114 GACTTATACATACAGGTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117147723 Original CRISPR TTCCAAATGGGTCACAGTGT TGG (reversed) Intergenic
No off target data available for this crispr