ID: 1117151165

View in Genome Browser
Species Human (GRCh38)
Location 14:52889851-52889873
Sequence TACAAGCATGAGCCAACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 877
Summary {0: 1, 1: 0, 2: 47, 3: 204, 4: 625}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117151165_1117151166 -8 Left 1117151165 14:52889851-52889873 CCAGGTGTTGGCTCATGCTTGTA 0: 1
1: 0
2: 47
3: 204
4: 625
Right 1117151166 14:52889866-52889888 TGCTTGTAATCGCAACACTTTGG 0: 3
1: 414
2: 13649
3: 130012
4: 259837
1117151165_1117151169 2 Left 1117151165 14:52889851-52889873 CCAGGTGTTGGCTCATGCTTGTA 0: 1
1: 0
2: 47
3: 204
4: 625
Right 1117151169 14:52889876-52889898 CGCAACACTTTGGGAGGCCAAGG 0: 34
1: 7525
2: 103474
3: 225991
4: 236608
1117151165_1117151172 9 Left 1117151165 14:52889851-52889873 CCAGGTGTTGGCTCATGCTTGTA 0: 1
1: 0
2: 47
3: 204
4: 625
Right 1117151172 14:52889883-52889905 CTTTGGGAGGCCAAGGTGGGTGG 0: 21198
1: 71365
2: 150513
3: 157804
4: 132965
1117151165_1117151174 25 Left 1117151165 14:52889851-52889873 CCAGGTGTTGGCTCATGCTTGTA 0: 1
1: 0
2: 47
3: 204
4: 625
Right 1117151174 14:52889899-52889921 TGGGTGGATCACTTGAGACCAGG 0: 80
1: 3383
2: 26521
3: 81013
4: 148670
1117151165_1117151170 5 Left 1117151165 14:52889851-52889873 CCAGGTGTTGGCTCATGCTTGTA 0: 1
1: 0
2: 47
3: 204
4: 625
Right 1117151170 14:52889879-52889901 AACACTTTGGGAGGCCAAGGTGG 0: 4221
1: 66343
2: 155330
3: 159343
4: 92549
1117151165_1117151171 6 Left 1117151165 14:52889851-52889873 CCAGGTGTTGGCTCATGCTTGTA 0: 1
1: 0
2: 47
3: 204
4: 625
Right 1117151171 14:52889880-52889902 ACACTTTGGGAGGCCAAGGTGGG 0: 2536
1: 40105
2: 146028
3: 241222
4: 211356
1117151165_1117151167 -7 Left 1117151165 14:52889851-52889873 CCAGGTGTTGGCTCATGCTTGTA 0: 1
1: 0
2: 47
3: 204
4: 625
Right 1117151167 14:52889867-52889889 GCTTGTAATCGCAACACTTTGGG 0: 6
1: 763
2: 29434
3: 271959
4: 277159
1117151165_1117151168 -4 Left 1117151165 14:52889851-52889873 CCAGGTGTTGGCTCATGCTTGTA 0: 1
1: 0
2: 47
3: 204
4: 625
Right 1117151168 14:52889870-52889892 TGTAATCGCAACACTTTGGGAGG 0: 106
1: 24211
2: 336685
3: 258343
4: 132559

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117151165 Original CRISPR TACAAGCATGAGCCAACACC TGG (reversed) Intronic
900580539 1:3406452-3406474 TACAGGTGTGAGCCACCACCTGG - Intronic
900983780 1:6061326-6061348 TACAGGCGTGAGCCACCGCCCGG - Intronic
901243553 1:7710320-7710342 TACAGGTGTGAGCCAACACACGG - Intronic
901505504 1:9682823-9682845 TACAGTCATGAGCCACCACTGGG + Intronic
901623723 1:10610766-10610788 TACAGGCATGAGCCACTGCCTGG + Intronic
901702308 1:11052203-11052225 TACAGGCATGAGCCACCACCCGG + Intergenic
901760831 1:11470156-11470178 TACAGGTATGAGACCACACCTGG - Intergenic
902445830 1:16463599-16463621 TAAAGGCATGAGCCACCACATGG + Intergenic
902827286 1:18985320-18985342 TACAGGCGTGAGCCATCGCCTGG - Intergenic
902831626 1:19017569-19017591 TACAGGCATGAGCCACCACCCGG - Intergenic
903087594 1:20876718-20876740 TACAGGCAGGAGCCACCTCCTGG - Intronic
903529870 1:24021912-24021934 TGCAACCATGAGCCACCACCTGG - Intergenic
903924191 1:26819837-26819859 TACAGGCATGAGCCACCAACCGG - Intergenic
904084278 1:27893584-27893606 TACAGGCATGAGCTAATGCCTGG + Intronic
904134459 1:28300581-28300603 TACAAGCGTGCGCCACCGCCCGG - Intergenic
904203942 1:28840392-28840414 TACAGGCATGAGCCACTACCTGG + Intronic
904628893 1:31826715-31826737 TACAGGCATGAGCCACCACCCGG + Intergenic
904638628 1:31904265-31904287 TACAGGCATGAGCCACTGCCCGG - Intergenic
904641469 1:31933980-31934002 TACAGGCATGAGCCACCGCGCGG - Intronic
904675256 1:32195200-32195222 TCCCAGCATGACCCAACACCAGG - Exonic
905074649 1:35259171-35259193 TACAGGCTTGAGCCACCAGCTGG - Intergenic
905553366 1:38861098-38861120 TACAAGCGTGAGCCACCGCGCGG - Intronic
905576134 1:39046151-39046173 TACAGGCGTGAGCCACCGCCTGG + Intergenic
905698173 1:39991353-39991375 TACAGGTGTGAGCCACCACCCGG - Intergenic
905814769 1:40940955-40940977 TATAGGCATGAGCCACTACCAGG - Intergenic
906088595 1:43157608-43157630 TACAGGCGTGAGCCACCACCCGG - Intergenic
906232782 1:44179938-44179960 TACAGGTGTGAGCCACCACCCGG + Intergenic
906268161 1:44450906-44450928 TACAGGCGTGAGCCACCACGTGG - Intronic
906483331 1:46215755-46215777 TACAGGCATGTACCTACACCTGG - Intronic
906530249 1:46519879-46519901 TACAGGCGTGAGCCACCGCCTGG + Intergenic
908236405 1:62151311-62151333 TACAGGCGTGAGCCACCGCCTGG - Intronic
908502890 1:64761972-64761994 TACAGGCATGTGCCACCACTAGG - Intronic
908771484 1:67600860-67600882 TACAGGCGTGAGCCACCACATGG + Intergenic
909763265 1:79320883-79320905 TACAGGCATGAGCCAGCGCCTGG + Intergenic
909765420 1:79349602-79349624 TACAGGCATGAGCCAGCGCCCGG + Intergenic
910247842 1:85161448-85161470 TACAGGCGTGAGCCACCACCTGG - Intronic
910887404 1:91979252-91979274 TACAGGCATGCGCCACCACACGG + Intronic
910967483 1:92822394-92822416 TACAGGCGTGAGCCACCGCCTGG + Intergenic
911463698 1:98223890-98223912 TACAGACATGAGCCCACACCTGG - Intergenic
911467585 1:98274665-98274687 TACAAGAATGGTCCAACACAGGG + Intergenic
912819891 1:112858675-112858697 TACAGGCGTGAGCCATCACGCGG + Intergenic
913181799 1:116329695-116329717 AACAAGCAGGATCCCACACCAGG + Intergenic
913410868 1:118550013-118550035 TACAGGCGTGAGCCACCACATGG - Intergenic
913438533 1:118872476-118872498 TACAGGCATGAGCCACCATCCGG + Intergenic
913600032 1:120414084-120414106 TACAAGCATGAGCCACCCACTGG - Intergenic
913940553 1:125100265-125100287 TACAAGCATGAACCACCATACGG - Intergenic
913944068 1:125140610-125140632 TACAAGCATGAACCACCATACGG + Intergenic
913955129 1:143283138-143283160 TACAAGCATGAACCACCATATGG - Intergenic
913982308 1:143532302-143532324 TACAAGCATGAACCACCATATGG + Intergenic
914087030 1:144462577-144462599 TACAAGCATGAGCCACCCACTGG + Intergenic
914311580 1:146471624-146471646 TACAAGCATGAGCCACCCACTGG - Intergenic
914436804 1:147667713-147667735 TACAGGCGTGAGCCAGCACCCGG - Intronic
914590835 1:149104475-149104497 TACAAGCATGAGCCACCCACTGG + Intergenic
914763062 1:150614626-150614648 TACAGGCATGAGCCACCACCTGG + Intronic
915411452 1:155704004-155704026 TACAGGCATGTGCAACCACCTGG - Intronic
915435067 1:155898389-155898411 TACAGGCATGAGCCACCACCTGG - Intronic
915452455 1:156015701-156015723 TACAGGCATGAGCCACCATATGG + Intronic
915735262 1:158080635-158080657 TACACGCCTGGGCAAACACCTGG + Intronic
916177179 1:162052115-162052137 TATAGGCATGAGCCACCACCTGG + Intergenic
917334431 1:173913497-173913519 TACAAGCATGAGCCACTGCACGG - Intronic
917996698 1:180446763-180446785 TACAGGCATGAGACTGCACCTGG - Intronic
918193022 1:182194185-182194207 TACAAGCATGAGCCATTTCATGG - Intergenic
918413190 1:184282034-184282056 TACAGGCATGAGCCACCCGCCGG - Intergenic
918610931 1:186490951-186490973 TACAGGCCTGAGCCACCACCTGG + Intergenic
920320396 1:205117383-205117405 TACAGGCATGAGCCACCACACGG - Intronic
920514292 1:206573183-206573205 TACAGGCATGAGCCACCACACGG - Intronic
921109595 1:212021566-212021588 TACAAGCATGAGCCACCTATGGG - Intronic
921827594 1:219691242-219691264 TACAGGCATGAGCTTGCACCTGG - Intronic
922238375 1:223738299-223738321 TAGAAGCATGACACCACACCTGG + Intronic
922453370 1:225754639-225754661 TACAGGCATGAGCCACCACATGG + Intergenic
923172860 1:231432974-231432996 TACAGGCATGCACCACCACCTGG - Intergenic
923681093 1:236119328-236119350 TACAGGCGTGAGCTACCACCCGG + Intergenic
924662409 1:246033508-246033530 TACAGGTGTGAGCCAGCACCCGG - Intronic
1063442489 10:6084250-6084272 TACAGGCATAAGCCTGCACCTGG - Intergenic
1063453405 10:6166366-6166388 TACAGACATGAGCCACCGCCCGG + Intronic
1064074673 10:12259181-12259203 TACAGGCATGAGCCACCAGCTGG + Intergenic
1065013178 10:21437781-21437803 TACAGGCGTGAGCCACCACCCGG + Intergenic
1065019525 10:21493412-21493434 TACAGGCGTGAGCAACCACCCGG - Exonic
1065302240 10:24333298-24333320 TACAGGCATGAGCCACCACAGGG + Intronic
1065826834 10:29580051-29580073 TACAGGCATAAGCCACCACCAGG - Intronic
1066779605 10:38929589-38929611 TACAAGCATGAGCCACCATATGG + Intergenic
1066951617 10:42124049-42124071 TACAAGCATGAACCACCATATGG - Intergenic
1067017267 10:42767676-42767698 TACCGGCATGAGCCACCACCCGG - Intergenic
1067691056 10:48502606-48502628 CACCAGCATGTGCAAACACCTGG - Intronic
1067714449 10:48678620-48678642 AAGAACCATGAGCCATCACCAGG - Intergenic
1068880606 10:62044638-62044660 TACAGTCATGAGCCACCACCAGG + Intronic
1069324085 10:67209322-67209344 TATAAGCATGAGCCACCGCACGG + Intronic
1069453023 10:68532364-68532386 TACAGGCATGAGCCACAACCAGG + Intergenic
1069520959 10:69120839-69120861 TACAGGCATGCCCCACCACCTGG + Intergenic
1069542986 10:69309524-69309546 TACAGGCATGAGCCACCTCGCGG - Intronic
1069711576 10:70492730-70492752 TACAGGTGTGAGCCACCACCTGG + Intronic
1070066613 10:73041267-73041289 TACAAGCATGAGCCCGTGCCTGG - Intronic
1070125373 10:73617313-73617335 TACAGGCATGCGCCACCGCCTGG - Intronic
1070128800 10:73642440-73642462 TACAGGCGTGAGCCACCGCCAGG + Intergenic
1070293936 10:75142708-75142730 TACAGGCATGAGCCACCACCCGG + Intronic
1070294202 10:75145218-75145240 TACAGGCGTGAGCCACCACCTGG + Intronic
1071304476 10:84286196-84286218 TACAGGCATGAGCCAACATGTGG - Intergenic
1071467722 10:85956568-85956590 CACATGCATGAGCCCAAACCAGG - Intronic
1071555259 10:86596580-86596602 TACAGGCATGTGCCACCAACGGG - Intergenic
1071684236 10:87737680-87737702 TACAAGCATGCCACCACACCTGG - Intronic
1072077351 10:91990829-91990851 TACAGGCATGAGCCACTGCCTGG - Intronic
1072161546 10:92771526-92771548 TACAGGCGTGAGCCATCACCCGG + Intergenic
1072432777 10:95388253-95388275 TACAGGCATGAGCCACTGCCCGG + Intronic
1072991849 10:100203032-100203054 TACAGGCGTGAGTCACCACCTGG + Intronic
1073200048 10:101727916-101727938 TACAGGCATGAGCCATCCACCGG - Intergenic
1074074648 10:110111770-110111792 TACAGGCATGCGCCACCACCCGG - Intronic
1074187638 10:111110688-111110710 TACAGGCATGAGACTGCACCTGG + Intergenic
1074514412 10:114152063-114152085 TACAGGCATAAGCCACTACCTGG - Intronic
1075056953 10:119226120-119226142 TACAGGCATGAGCCAGCACCCGG + Intronic
1075163621 10:120046274-120046296 TACAGGCGTGAGCCTGCACCTGG + Intergenic
1077747514 11:4923799-4923821 AATAAGCATGAGCCAGCACATGG + Exonic
1078052595 11:7980014-7980036 TACAGGCATGAGCCACCGCCTGG + Intronic
1078198681 11:9159459-9159481 TACAGGCATGCACCACCACCTGG + Intronic
1079210921 11:18460157-18460179 TACAGGCATGAGCCACTGCCTGG - Intronic
1079668991 11:23142570-23142592 TACAGGCATGAGCCACTGCCCGG - Intergenic
1080653290 11:34239604-34239626 TACAGGTCTGAGCCACCACCCGG + Intronic
1080947636 11:36992916-36992938 TACAGGCGTGAGCCACCACCCGG - Intergenic
1081092324 11:38887563-38887585 TACAGGTGTGAGCCACCACCTGG + Intergenic
1081143984 11:39538016-39538038 TACAGGCGTGAGACCACACCTGG + Intergenic
1082080267 11:48007382-48007404 TACAGGCATGAGCCACCACACGG + Intronic
1083149794 11:60784674-60784696 TGCAGGCATGAGCCACCGCCCGG + Intergenic
1083472243 11:62891664-62891686 TACAAGCATGAGCCACCAGTTGG - Intergenic
1083554602 11:63615941-63615963 TACAGGCGTGAGCCACCACTCGG + Intronic
1083671545 11:64302844-64302866 TACAGGCGTGAGCCACCACTTGG + Intronic
1083757206 11:64797978-64798000 TACAGGCATGAGCCACACCCGGG + Intronic
1083867366 11:65463704-65463726 TACAGGCGTGAGCCACCACATGG - Intergenic
1084181016 11:67445936-67445958 TACAGGTGTGAGCCACCACCCGG + Intergenic
1084279164 11:68075658-68075680 TACAGGCATGAGCCACCGCCTGG - Intronic
1084293623 11:68194897-68194919 TATAGGCATAAGCCACCACCTGG - Intronic
1084895888 11:72267758-72267780 TACAGGCATTAGCCAGCACCTGG + Intergenic
1085021513 11:73213119-73213141 GAAAAGCATGAGCCAACATGGGG + Intergenic
1085961141 11:81463732-81463754 TACAAGCATAAGCCAGCACATGG - Intergenic
1086348367 11:85920996-85921018 TACAGGCATGAGCCACCGACCGG + Intergenic
1086982933 11:93218607-93218629 CACAGGCATGAGCCATCGCCCGG - Intergenic
1087264212 11:96043019-96043041 TACAGGCATGAGCCACCACCCGG + Intronic
1088366005 11:109040613-109040635 TACAGGTGTGAGCCACCACCTGG - Intergenic
1088622322 11:111698464-111698486 TACAGGTGTGAGCCACCACCTGG - Intronic
1089239539 11:117064872-117064894 TACAGGCGTGAGCCACCGCCTGG - Intronic
1089449126 11:118579394-118579416 TACAGGCATGAGCCACCGCCCGG - Intronic
1090028404 11:123186796-123186818 TACAGGCATGAGCCAGAGCCTGG + Intronic
1090270748 11:125384408-125384430 TACAGGCGTGAGCCACCACCCGG - Intronic
1090377343 11:126300478-126300500 TACAGGTATGAGCCACCACGTGG + Intronic
1091927125 12:4361890-4361912 TACAGGCATGAGCCACCACCCGG + Intergenic
1092278174 12:7078352-7078374 TACAGGCATGTGCCACCACCTGG + Intergenic
1092337157 12:7643284-7643306 TACAGGCGTGAGCCACCGCCTGG - Intergenic
1092376698 12:7961636-7961658 TACAGGCGTGAGCGAACCCCAGG + Intergenic
1092668214 12:10830923-10830945 TACAGGCCTGAGCCCGCACCCGG + Intronic
1093064633 12:14644206-14644228 TACAGGCATGAGCCATCACGGGG - Intronic
1093853679 12:24071707-24071729 TACAGGCATGAGCCACTGCCCGG + Intergenic
1094584445 12:31764842-31764864 TACAGGCATGAGCCATCCACAGG + Intergenic
1094587811 12:31794102-31794124 TACAGGCGTGAGCCACCGCCCGG - Intergenic
1094698197 12:32842514-32842536 TACAGGCATGAGCCATTGCCTGG + Intronic
1094749661 12:33391210-33391232 TACAGGCGTGAGCCAACGCCTGG + Intronic
1095050485 12:37549813-37549835 TACAGGCTTGAGCCAGCGCCTGG - Intergenic
1096247714 12:50002744-50002766 TACAGGCATGAGCCATCGCCTGG - Intronic
1096820956 12:54233905-54233927 TGCAGGCGTGAGCCAGCACCCGG - Exonic
1096821086 12:54235337-54235359 TACAGGCGTGAGCCACCGCCGGG - Exonic
1097063920 12:56306280-56306302 TACAGGCATGAGCCACTGCCTGG - Intronic
1097921055 12:65074540-65074562 TACAGGCATGAGCCAGCACCTGG - Intronic
1098337539 12:69419495-69419517 TACAGGTGTGAGCCACCACCTGG + Intergenic
1098716962 12:73841357-73841379 TACAGGTGTGAGCCACCACCCGG - Intergenic
1099412789 12:82351593-82351615 TACATGTACGTGCCAACACCTGG - Intronic
1099483335 12:83196171-83196193 TACAGGCATGAGCCACCTCCCGG - Intergenic
1099611653 12:84879599-84879621 TACAGGCGTGAGCCACCGCCTGG + Intronic
1100080768 12:90847289-90847311 TACAGGCATGAGCCACCATGCGG + Intergenic
1100200035 12:92288356-92288378 TACAGGCGTGAGCCACCGCCCGG + Intergenic
1101340591 12:103839515-103839537 TACAGGCGTGAGCTCACACCTGG + Intronic
1101470441 12:104991944-104991966 TGGAAACATGAGCTAACACCAGG - Intronic
1101528879 12:105556655-105556677 TACAGGCATGAGCCACCACGTGG + Intergenic
1101770840 12:107749507-107749529 TACAGGTGTGAGCCAACACATGG + Intronic
1101953529 12:109194578-109194600 TACAGTCATGAGCCACCCCCTGG + Intronic
1102159641 12:110758080-110758102 TACAGGCGTGAGCCTGCACCTGG - Intergenic
1102685667 12:114722669-114722691 TACAGGCATGAGCCACCACAGGG + Intergenic
1103336808 12:120195787-120195809 TACAGGCATGTGCCACCACTCGG - Intergenic
1103487754 12:121294893-121294915 TACAGGCATGAGCTGCCACCTGG - Intronic
1103645418 12:122388492-122388514 TACAGGCGTGAGCCACCACCCGG + Intronic
1103652921 12:122447014-122447036 TACAAGCGTGAGTCACCGCCTGG + Intergenic
1103818209 12:123676001-123676023 TACAGGCATGAGCCACCACCTGG - Intronic
1104683957 12:130772281-130772303 AAGAAGCATGTGCCAACAACTGG + Intergenic
1105233672 13:18525009-18525031 TACAAGCATGAGCCACCATATGG + Intergenic
1105379864 13:19876947-19876969 TACAGGCGTGAGCCACCGCCTGG - Intergenic
1105951157 13:25230446-25230468 TACAGGCATGAGCCACGGCCTGG + Intergenic
1106405991 13:29473889-29473911 TAATAGCATTAGACAACACCTGG - Intronic
1107064826 13:36201743-36201765 TACACGCATGAGCCAATCCCTGG + Intronic
1107209392 13:37835008-37835030 TACAGGCATGAACCACCAGCAGG + Intronic
1107470884 13:40689972-40689994 TACAAGGATGAGACAACATTGGG + Intergenic
1107515031 13:41120679-41120701 TACAGACATGAGCCACCGCCTGG + Intergenic
1107917165 13:45164455-45164477 TACAGGCATGAGCCACTACCTGG - Intronic
1109113999 13:58357673-58357695 TACAGGCATGAGCCACCTTCGGG + Intergenic
1109263321 13:60168293-60168315 TACAGGCGTGAGCCACCGCCCGG + Intergenic
1109440856 13:62370959-62370981 TATAGGCATGAGCCGCCACCTGG + Intergenic
1110639170 13:77802188-77802210 TACAGGTGTGAGCCACCACCTGG - Intergenic
1110741309 13:79000449-79000471 TACAGGCATGAGCCACCATAAGG - Intergenic
1111057027 13:82964669-82964691 TACAGGCATGAGCCACCACCAGG - Intergenic
1112281639 13:98067997-98068019 TATAAGCATGAGCCACCGCCTGG - Intergenic
1112309493 13:98305607-98305629 TACAGGCGTGAGCCACCACGCGG + Intronic
1112863308 13:103862207-103862229 TACAGGCATGCGCCACCACGCGG + Intergenic
1114192869 14:20453744-20453766 TACAGGCATGAGCCACCGCTCGG - Intronic
1114445572 14:22785450-22785472 TACAGGCGTGAGCCAGCGCCTGG - Intronic
1114488650 14:23081487-23081509 TACAGGCATGAGCCACTGCCTGG - Intronic
1114497713 14:23145186-23145208 TACAGGCAGGAGCCACCGCCCGG + Intronic
1115211687 14:30972931-30972953 TACAGGCGTGAGCCCGCACCCGG - Intronic
1115251139 14:31349245-31349267 TACAGGCATGTGCCACCACCCGG - Intronic
1115341476 14:32297272-32297294 TACAGGCATGAGCCACCAGATGG - Intergenic
1115590680 14:34861888-34861910 TACAAGAAACAGCTAACACCGGG + Intronic
1115591152 14:34866345-34866367 TACAGGCATGTGCCACCACGTGG - Intronic
1116254617 14:42535527-42535549 TACAGGTGTGTGCCAACACCCGG - Intergenic
1116335239 14:43648897-43648919 TACAGGCGTGAGCCACCGCCTGG + Intergenic
1117151165 14:52889851-52889873 TACAAGCATGAGCCAACACCTGG - Intronic
1117231556 14:53724581-53724603 TACAGGCATGAGCCTACCCCTGG + Intergenic
1117349656 14:54869012-54869034 TACAGGCATGCACCACCACCTGG + Intronic
1117400741 14:55356586-55356608 TACAGGCATGCGCCACCACGTGG + Intronic
1117544704 14:56783149-56783171 TACAGGCATGAGCCACCTCACGG - Intergenic
1118076105 14:62300768-62300790 AACAAGCAAGAGACAACACTTGG - Intergenic
1118625273 14:67653062-67653084 TACAGGCATGAGCCACCGCACGG + Intronic
1118834524 14:69467493-69467515 TACAGGCATGAGCCACCACACGG - Intergenic
1119067148 14:71540403-71540425 TACAGACATGAGCCACCACCAGG - Intronic
1119197858 14:72731023-72731045 TACAGGCATGTGCCACCATCTGG - Intronic
1119395162 14:74320859-74320881 TACAAGCGTGAGCCATTGCCTGG + Intronic
1119469646 14:74887014-74887036 TACAAGCATGAGCCACTGCCCGG + Intronic
1119515106 14:75241844-75241866 TACAGGTATGAGCCACCACTCGG - Intronic
1119663933 14:76470826-76470848 TACAGGCATGTGCCAACATGTGG + Intronic
1121769404 14:96519201-96519223 TACAGGGGTGAGCCCACACCTGG + Intronic
1121816317 14:96931840-96931862 TACAGGCGTGAGCCACCGCCTGG + Intergenic
1122155001 14:99745339-99745361 CACAGGCATGAGCCATCATCCGG + Intronic
1122322991 14:100866725-100866747 TTCCACCATCAGCCAACACCAGG - Intergenic
1122460698 14:101892230-101892252 TACAGGTATGAGCCACCGCCTGG + Intronic
1122727764 14:103770236-103770258 TACAGGCATGAGCTACCACCTGG - Intronic
1122753215 14:103955064-103955086 CACAGGCATGAGCCCACACCCGG + Intronic
1122993894 14:105252197-105252219 TACAGGCATGAGACCGCACCTGG - Intronic
1202937658 14_KI270725v1_random:106666-106688 TACAAGCATGAGCCACCATATGG - Intergenic
1123395554 15:19931221-19931243 TACAAGCATGAACCACCATATGG + Intergenic
1123459980 15:20460794-20460816 TACAGGCATGAGCCACTGCCTGG + Intergenic
1123658082 15:22539625-22539647 TACAGGCATGAGCCACTGCCTGG - Intergenic
1123814138 15:23959680-23959702 TACAGGCATGAGCCACCGCAAGG - Intergenic
1124196301 15:27633322-27633344 TACAGGCGTGAGCTACCACCTGG + Intergenic
1124266206 15:28236564-28236586 TACAGGCATGAGCCACTGCCTGG + Intronic
1124311944 15:28634117-28634139 TACAGGCATGAGCCACTGCCTGG - Intergenic
1124478603 15:30058620-30058642 TACAGGCGTGAGCCACCGCCTGG + Intergenic
1124941357 15:34221472-34221494 TACAGGCATGAGCCCACACCTGG - Intergenic
1125545818 15:40503949-40503971 TACAGGCATGACCCACCACCCGG - Intergenic
1125806752 15:42499866-42499888 TACAGGCATGAACCACCGCCCGG - Intronic
1125830771 15:42715781-42715803 TACAGGCATGAGCCACCGCCCGG + Intronic
1125858558 15:42975169-42975191 TACAGGTGTGAGCCACCACCCGG + Intronic
1125952903 15:43768746-43768768 TACAGGCATGAGCCACCGCTTGG - Intronic
1126092030 15:45061328-45061350 TCCAAACATGAGGCATCACCTGG + Intronic
1126317216 15:47383039-47383061 TACAGGCATGAGCCACCACCTGG + Intronic
1126319510 15:47407087-47407109 TACAGGCATGAGCCACCCCCCGG - Intronic
1126575408 15:50191782-50191804 TACAGGCATGAGCCACTGCCTGG - Intronic
1126625223 15:50679956-50679978 TACAAGCGTGAGCCACCGCCCGG - Intronic
1126626991 15:50694823-50694845 AACAAGCATGCGCCACCACACGG + Intergenic
1126776003 15:52101031-52101053 TACAGGCATGAGTCACCGCCTGG - Intergenic
1128030845 15:64478652-64478674 TACAAGTATGAGCCACCACATGG + Intronic
1129210063 15:74063252-74063274 TACAGGCACGTGCCACCACCAGG - Intergenic
1129403960 15:75302150-75302172 TACAGGCAAGTGCCACCACCAGG + Intergenic
1129476971 15:75792179-75792201 TACAGGCACGTGCCACCACCAGG + Intergenic
1129512203 15:76132652-76132674 TACAGGCATGCGCCACCACCTGG - Intronic
1130128928 15:81119789-81119811 TACAAGCATGAACCACCATGGGG - Intronic
1130289112 15:82581115-82581137 TACAGGCATGAGCCAATGCCTGG + Intronic
1130516131 15:84627119-84627141 AACAGGCATGAGCCACCACTCGG + Intronic
1130517722 15:84639048-84639070 TACAGGCCTGAGCCACCACGGGG + Intergenic
1130826499 15:87552245-87552267 TACAGGCGTGAGCCACCACTAGG + Intergenic
1131085481 15:89572482-89572504 TACAGGCATGAGCCACCACCCGG - Intergenic
1131149307 15:90036998-90037020 CACAAGCAAGAGCCAGCTCCAGG + Intronic
1131185542 15:90270949-90270971 TACAGGCATGAGCTACCACGTGG - Intronic
1131764617 15:95661969-95661991 TACAGGTATGAGCCACCACGTGG - Intergenic
1132488778 16:213040-213062 TACAGGCGTGAGCGCACACCTGG + Intronic
1132781754 16:1630425-1630447 TACAGGCACGAGCCACCACCTGG + Intronic
1133362452 16:5185337-5185359 TACAGTCATGAGGCACCACCCGG - Intergenic
1133780618 16:8936241-8936263 GATACGCATGGGCCAACACCTGG + Intronic
1134438257 16:14281524-14281546 TACAGGCATGTGCCACCACGTGG - Intergenic
1134618265 16:15668538-15668560 TATAGGCATGAGCCACCACCTGG + Intronic
1135028502 16:19017542-19017564 TACAGGCATGAACCACCACCTGG - Intronic
1135257660 16:20954080-20954102 TACAAGCATGCCACCACACCCGG - Intronic
1135406638 16:22203009-22203031 TACAGGCATAAGCCACCGCCTGG + Intergenic
1135433849 16:22411334-22411356 TACAAGCTTGAGCCATGCCCAGG + Intronic
1136015199 16:27393965-27393987 GACAGGCATGAGCCACCACCTGG - Intergenic
1136491026 16:30608555-30608577 TACAGGCATGAGCCACCAGCCGG + Intronic
1136621106 16:31428817-31428839 TACAGGCATGAGCCACTACACGG + Intergenic
1136697998 16:32103402-32103424 TACAAGCATGAACCACCATATGG + Intergenic
1136704387 16:32173985-32174007 TACAGGCATGAGCCACCGCCTGG + Intergenic
1136763525 16:32755421-32755443 TACAGGCATGAGCCACCGCCTGG - Intergenic
1136769598 16:32824465-32824487 TACAAGCATGAACCACCATATGG - Intergenic
1136798495 16:33046688-33046710 TACAAGCATGAACCACCATATGG + Intergenic
1136804575 16:33114965-33114987 TACAGGCATGAGCCACCGCCTGG + Intergenic
1136935815 16:34463399-34463421 TACAAGCATGAACCACCATATGG - Intergenic
1136948741 16:34689128-34689150 TACAAGCATGAACCACCATATGG + Intergenic
1136964003 16:34885171-34885193 TACAAGCATGAACCACCATATGG + Intergenic
1136968137 16:34939758-34939780 TACAAGCATGAACCACCATATGG + Intergenic
1137093149 16:36219635-36219657 TACAAGCATGAACCACCATATGG + Intergenic
1137219998 16:46439599-46439621 TACAAGCATGAACCACCATATGG - Intergenic
1137232607 16:46581022-46581044 TACAAGCGTGAGCCACCGCCTGG + Exonic
1137277916 16:46949192-46949214 TACAGGCGTGAGCCACCGCCCGG + Intergenic
1138380239 16:56595707-56595729 TACAGGCATGTACCACCACCTGG - Intergenic
1138566499 16:57837190-57837212 TATAGGCAAGAGCCACCACCTGG - Intronic
1138814432 16:60188019-60188041 TACAAGCATGCAACCACACCAGG + Intergenic
1139441224 16:66968441-66968463 TACAGGCATGAGGCTGCACCCGG + Intronic
1139587420 16:67913042-67913064 TACAGGCATGTGCCCACACCTGG - Intronic
1139646358 16:68333911-68333933 TACAGGCATGCACCACCACCTGG + Intronic
1139750075 16:69104569-69104591 TACAGGCGTGAGCCTGCACCCGG + Intergenic
1139781219 16:69352977-69352999 TAAGAGCATGAGCCCCCACCGGG - Intronic
1140051596 16:71486223-71486245 TACAGGCGTGTGCCCACACCTGG - Intronic
1140184215 16:72752244-72752266 TACAGGCGTGAGCCACCACCTGG + Intergenic
1140313583 16:73872508-73872530 TACAGGCATGAGCCACTGCCAGG + Intergenic
1140523366 16:75601479-75601501 TACAGGCGTGAGCCACCGCCTGG - Intronic
1141003863 16:80334092-80334114 TACAGGCGTGAACCACCACCTGG - Intergenic
1141321546 16:83014588-83014610 TACAGGCATGGGCCACCACTCGG - Intronic
1203065674 16_KI270728v1_random:1015742-1015764 TACAGGCATGAGCCACCGCCTGG - Intergenic
1203072015 16_KI270728v1_random:1086570-1086592 TACAAGCATGAACCACCATATGG - Intergenic
1142587568 17:983233-983255 TACAGGCATGAGCCACCACCCGG + Intergenic
1142615773 17:1134135-1134157 TACAGGCGTGAGTCACCACCCGG - Intronic
1142729281 17:1840559-1840581 TACAGGCGTGAGCCACCACCTGG + Intronic
1142853611 17:2717491-2717513 TACAGGCGTGAGCCACCGCCCGG - Intergenic
1142950416 17:3473771-3473793 TACAAGCATGAGACCACACCTGG + Intronic
1142988480 17:3712669-3712691 TACAGGCATGAGCCAAATCCGGG - Intergenic
1142999307 17:3781630-3781652 TACAGGCGTGAGCCAAGGCCCGG + Intronic
1143657501 17:8304395-8304417 TACAGGCATGCGCCACCGCCAGG + Intergenic
1143704317 17:8686636-8686658 TACAGGTATGAGCCACCACCCGG + Intergenic
1144184081 17:12779807-12779829 TACAGGCATGAGCCACCGCCCGG + Intergenic
1144697198 17:17312992-17313014 TACAGGTGTGAGCCAGCACCCGG - Intronic
1145305539 17:21672603-21672625 TACAGGCATGAGCCAGAGCCTGG + Intergenic
1145371120 17:22306912-22306934 TACAGGCATGAGCCAGCGCCTGG - Intergenic
1145692175 17:26753639-26753661 TACAAGCATGAACCACCATATGG + Intergenic
1145708915 17:26950258-26950280 TACAAGCATGAGCCACCATATGG + Intergenic
1145742585 17:27288018-27288040 TACAGGCATGAGCCACCACTTGG + Intergenic
1145766466 17:27461354-27461376 TACAAGTGTGAGCCACCTCCTGG + Intronic
1145840759 17:27992238-27992260 TACAGGCATGAGCAACCACACGG + Intergenic
1146048023 17:29526554-29526576 TACAGGCATGCACCACCACCTGG + Intronic
1146110692 17:30086468-30086490 TACAGGTGTGAGCCACCACCTGG - Intronic
1146139862 17:30356317-30356339 TACAGGCATGAGCCCATGCCTGG + Intergenic
1146407548 17:32552350-32552372 TACAGGCATGAGCCACAGCCTGG + Intronic
1146606573 17:34263583-34263605 TACAGGCACGCGCCACCACCCGG + Intergenic
1146851390 17:36224848-36224870 TATAGGCATAAGCCACCACCTGG - Intronic
1146867300 17:36348721-36348743 TATAGGCATAAGCCACCACCTGG - Intronic
1146894964 17:36534561-36534583 TTCAAGCAAGAGCCAAGAGCTGG + Intronic
1147070177 17:37949332-37949354 TATAGGCATAAGCCACCACCTGG - Intergenic
1147081698 17:38028858-38028880 TATAGGCATAAGCCACCACCTGG - Intronic
1147097649 17:38152828-38152850 TATAGGCATAAGCCACCACCTGG - Intergenic
1147610435 17:41798885-41798907 TATAGGAATGAGCCACCACCAGG - Intergenic
1147737965 17:42653049-42653071 TACAGGCATGTGCCACCACCCGG + Intergenic
1147930996 17:43981143-43981165 TACAAGCATGAGACCATGCCTGG + Intronic
1147943215 17:44065157-44065179 TACAGGCCTGAGCCACCGCCCGG - Intronic
1148005931 17:44429532-44429554 TACAGGCGTGAGCCACCACGTGG - Intronic
1148731770 17:49841159-49841181 TACAGGCATGAGCCACTGCCTGG + Intronic
1148750865 17:49945062-49945084 TACAAGCATGAGCCACCGCACGG - Intergenic
1148838303 17:50478259-50478281 TAAGGGCATGAGCCACCACCAGG - Intergenic
1148903473 17:50896064-50896086 TACAGGCGTGAGCCACCACTAGG + Intergenic
1149287783 17:55185144-55185166 TACAGGCATGAACCACCACCTGG + Intergenic
1149745061 17:59088778-59088800 TACAGGTATGAGCCACTACCTGG + Intronic
1149789395 17:59464017-59464039 TACAGGCATGCGCCACCACCTGG - Intergenic
1150045605 17:61910318-61910340 TACAGGCGTGAGCCACCACTGGG - Intronic
1150098395 17:62399441-62399463 TACAGGCGTGAGCCACCGCCTGG + Intronic
1150180953 17:63120536-63120558 TACAAGCATGAGTCACCACCTGG - Intronic
1150715145 17:67566477-67566499 TACAGGCATGAGCCACCCACAGG + Intronic
1150777068 17:68089723-68089745 TACAGGCATGCGCCGCCACCTGG + Intergenic
1151231397 17:72687767-72687789 AACAAGCATATGCCAAGACCCGG + Intronic
1151515660 17:74593546-74593568 TACAGGCGTGTGCCACCACCTGG - Exonic
1151749949 17:76031308-76031330 TACAAGCGTGAGCCACTGCCCGG - Intergenic
1152175701 17:78785800-78785822 TACAGGCATGAGCCTGCTCCTGG + Intergenic
1152316725 17:79585278-79585300 TACAGGCGTGAGCCATCATCTGG - Intergenic
1152560441 17:81076004-81076026 TACTAGCAAGAGGGAACACCCGG - Intronic
1152942648 17:83181070-83181092 TACAACCATCAGACAAGACCAGG - Intergenic
1203183701 17_KI270729v1_random:91186-91208 TACAAGCATGAACCACCATATGG + Intergenic
1153023086 18:648931-648953 TACAGGCATGAGCCACTGCCTGG + Intronic
1153255131 18:3162748-3162770 TACAGGCGTGAGCCCACGCCCGG - Intronic
1153280179 18:3407577-3407599 TACAGGCATGAGCCCACGCCTGG - Intergenic
1153684506 18:7532038-7532060 TACATACAAGAGCCAACAACAGG + Intergenic
1153753811 18:8260437-8260459 TACAGGCATGAACCACCTCCTGG + Intronic
1154228824 18:12534832-12534854 TACAGGCATGAGCCTGCACCTGG + Intronic
1154265972 18:12879277-12879299 TACAGGGATGAGCCACCGCCTGG + Intronic
1154307458 18:13241068-13241090 TACAGGCATGTGCCACTACCCGG + Intronic
1154364944 18:13699080-13699102 TACAGGCGTGAGCCACCGCCTGG + Intronic
1154519348 18:15210451-15210473 TACAAGCATGAGCCACCATATGG - Intergenic
1155482793 18:26307832-26307854 TACAAGCGTGAGCATACACAAGG - Intronic
1156298578 18:35815621-35815643 TATAAGCATGTGACCACACCAGG + Intergenic
1156740641 18:40323415-40323437 TAAAAGGATAAGCCACCACCTGG + Intergenic
1157665186 18:49480047-49480069 TACAGGCATGAGCCACTGCCTGG - Intronic
1157731162 18:50005690-50005712 TACAGGCATGAGCCACTGCCTGG + Intronic
1158356772 18:56629921-56629943 TACAGGCATGAGCCATCATCGGG - Intronic
1158987885 18:62837265-62837287 TACAAGTGTGAGCCTGCACCTGG + Intronic
1158999430 18:62958062-62958084 TACAGGCTTGCGCCACCACCTGG + Intronic
1160203381 18:76813463-76813485 TACAGGCATGAGCCAACATCCGG + Intronic
1160803503 19:980901-980923 TACAGGCATGAGCCACCGCCTGG - Intergenic
1160932897 19:1578906-1578928 TACAGGCATGAGCCTCTACCTGG - Intronic
1160934988 19:1590344-1590366 TACAGGCATGAGCCACTGCCTGG - Intronic
1161289638 19:3486247-3486269 TACAGACATGAGCCACCACCTGG - Intergenic
1161624960 19:5320984-5321006 TACAGGCATGAGCCAGCACCGGG - Intronic
1161714876 19:5869926-5869948 TATAGGCATGTGCCAGCACCTGG - Intronic
1161828303 19:6584582-6584604 TACAGGCATGAGCCACTGCCTGG - Intronic
1162024353 19:7885178-7885200 TACAGGCATGCGCCACCACTCGG - Intergenic
1162047126 19:8007451-8007473 TACAGGCATGAGCCACCACCCGG + Intronic
1162082495 19:8226628-8226650 TACAGGCATGAGCCACTACACGG - Intronic
1162289174 19:9765791-9765813 TACAGGCATGAGCCACCCCCTGG - Intronic
1162447479 19:10732323-10732345 TACAGGCATGAGCCACCGCCCGG - Intronic
1162692132 19:12441519-12441541 TACAGGCACGCGCCACCACCCGG + Intronic
1162845410 19:13388529-13388551 TACAGGCGTGAGCCACCCCCTGG + Intronic
1163011092 19:14426750-14426772 TACAGGCATGAGCCAATCGCTGG + Intergenic
1163136249 19:15313395-15313417 TACAGGCATGAGCCACCGCTCGG - Intronic
1163150650 19:15411378-15411400 TACAGGCATGAGCCACTGCCCGG - Intronic
1163162579 19:15474058-15474080 TACAGTCGTGAGCCATCACCCGG - Intronic
1163414342 19:17176877-17176899 CCCAAGCATGTGCCAGCACCAGG + Intronic
1163452711 19:17388159-17388181 TACAGGCGTGAGCCACCCCCGGG + Intergenic
1163985527 19:20944335-20944357 TACAGGCATGAGCCACTGCCTGG + Intronic
1164698720 19:30266323-30266345 TATAGGCATGAGTCACCACCTGG + Intronic
1164836691 19:31359564-31359586 TACAGGCATGAGCCACCACAGGG - Intergenic
1165182078 19:33980002-33980024 TACAGGCATGAGCCACCGCCTGG - Intergenic
1165347934 19:35260566-35260588 TACAGGCATGAGCCACTGCCCGG + Intronic
1165418205 19:35708129-35708151 TTGAAGTATGGGCCAACACCAGG - Intronic
1166129348 19:40736778-40736800 TATAGGCATGATCCCACACCTGG + Intronic
1166352363 19:42205805-42205827 TACAGGCATGAGCCACCGCCTGG - Intronic
1166719477 19:44988903-44988925 TACAGGCGAGAGCCACCACCAGG - Intronic
1166837346 19:45675608-45675630 TACAGGCATGAGCCACTGCCGGG - Intronic
1166908283 19:46131661-46131683 TACAGGCATGAGCCAAGAAGGGG - Intergenic
1167034571 19:46987101-46987123 TACAAGCATGAGCCAAGTGCTGG + Intronic
1167110222 19:47456386-47456408 TACAAGCATGAGCCATCATCCGG - Intronic
1167252523 19:48407910-48407932 TACAGGCATGAGCCACAGCCCGG - Intronic
1167905620 19:52658267-52658289 TACAGGCATGAGCCAGAACCTGG - Intronic
1168397693 19:56063062-56063084 TACAGGCATGAACCACCACACGG - Intergenic
1168607327 19:57770295-57770317 TACAGGCATGCGCCACCACGGGG + Intronic
1168663388 19:58184227-58184249 TACAAGCAAGAGCCTTAACCTGG - Intronic
1168676441 19:58281291-58281313 CCCCAGCATCAGCCAACACCTGG - Intronic
1168697630 19:58413774-58413796 TACAGGCGTGAGCCACCACCCGG + Intronic
1202682159 1_KI270712v1_random:16496-16518 TACAAGCATGAACCACCATACGG + Intergenic
925570279 2:5303172-5303194 TACAGGCATGTGCCACCACCAGG - Intergenic
926003494 2:9353287-9353309 TACAGGCATGAGCCACTGCCTGG - Intronic
926011101 2:9408613-9408635 TACAGGCATGAGCCACCATGTGG + Intronic
926175882 2:10591726-10591748 TGCAGGCATGAACCACCACCTGG - Intronic
926673737 2:15601409-15601431 TAGAAGCATAAGCCACAACCTGG - Intronic
926704835 2:15829651-15829673 TATAGGCATGAGCCACCACCAGG - Intergenic
926753453 2:16217941-16217963 TACAGGCATGAACCACCGCCTGG - Intergenic
927170250 2:20363243-20363265 TACAGGCATGAGCCACCCCCGGG - Intergenic
927955072 2:27202224-27202246 TACAGGCATGAGCCACCGCTCGG - Intronic
927977298 2:27348526-27348548 TACAGGCATGAGCCTGTACCTGG - Intronic
928282355 2:29959779-29959801 TACAGGCGTGAGCTACCACCTGG - Intergenic
928582579 2:32723938-32723960 TAAAGGCATGAGCCACCAGCTGG + Intronic
929157364 2:38800042-38800064 TACAGGCATACGCCACCACCCGG - Intronic
929214621 2:39398765-39398787 TATAGGCATGAGCCAATGCCTGG - Intronic
929594381 2:43167170-43167192 TACAGGCGTGAGCCACCACAAGG - Intergenic
929637147 2:43535401-43535423 TACAGGCGTGAGCCACCGCCTGG - Intronic
929741295 2:44603364-44603386 TACAGGCATGAGCCACCAACTGG + Intronic
929857046 2:45646246-45646268 TACAGGCATGAGCCACCAGGTGG + Intergenic
930087432 2:47507733-47507755 TACAGGCGTGAGCCTCCACCTGG + Intronic
930705274 2:54499025-54499047 GAAAAGCATGAGCCAACAGGAGG - Intronic
931018656 2:58016633-58016655 TACAGCCGTGAGCCACCACCTGG + Intronic
931337920 2:61367350-61367372 TACAGACACGAGCCACCACCTGG - Intronic
931354160 2:61519420-61519442 TACAGGCATGAGCCACTGCCTGG - Intronic
931691092 2:64835490-64835512 TACAGGCATGAGCCACCGCAGGG + Intergenic
931693671 2:64856378-64856400 TACAGGCGTGAGCCACCCCCCGG - Intergenic
932476433 2:72009241-72009263 TACAGGCATGAGTCACCACGTGG + Intergenic
932612728 2:73211740-73211762 TACATGTGTGAGCCACCACCCGG + Exonic
932668313 2:73715670-73715692 TACAGGCATGTGCCACCACCCGG + Intergenic
932723797 2:74160205-74160227 TACAGGCACGAGCCACCACACGG - Intronic
933406015 2:81860516-81860538 TACAGGCATAAGCCCACACCTGG - Intergenic
934249606 2:90338582-90338604 TACAAGCATGAACCACCACATGG - Intergenic
934259970 2:91464865-91464887 TACAAGCATGAACCACCACATGG + Intergenic
934303274 2:91796784-91796806 TACAAGCATGAGCCACCATATGG + Intergenic
934329985 2:92055971-92055993 TACAAGCATGTGCCACCATATGG - Intergenic
934468209 2:94285885-94285907 TACAAGCATGAGCCACCATATGG - Intergenic
935547849 2:104419510-104419532 TACAGGCGTGAGCCAACGCCAGG - Intergenic
936052777 2:109237955-109237977 TACAAGCATGAGCCATTGCGTGG - Intronic
936544832 2:113382085-113382107 GAAAAGTATGAGCAAACACCTGG + Intergenic
937270251 2:120645355-120645377 TACAGGCTTGAGCCCACACCCGG + Intergenic
937367513 2:121274671-121274693 TACAGGCATGAGCCACTGCCTGG - Intronic
937445089 2:121950632-121950654 TACAGGCATGAGCCACTGCCTGG + Intergenic
938297563 2:130187901-130187923 TACAAGCATGGGGCCACACCTGG - Intronic
938459207 2:131486763-131486785 TACAAGCATGGGGCCACACCTGG + Intronic
938519335 2:132051080-132051102 TACAAGCATGAGCCACCATATGG - Intergenic
938829606 2:135037271-135037293 TACAGGCGTGAGCCATCACCTGG + Intronic
938830125 2:135042225-135042247 TACAGGCGTGAGCCACTACCTGG - Intronic
938837935 2:135127148-135127170 TACAGGCATGAGCCACCGCGCGG + Intronic
938845603 2:135205624-135205646 TACAGGTATGAGCCAACGCCTGG + Intronic
939147372 2:138432280-138432302 TACAAGCATGAGCCACTGCCTGG - Intergenic
941278293 2:163518177-163518199 TACAAGCATGAGCCAACATGTGG - Intergenic
941321667 2:164063257-164063279 TACAGGCATGTGCCACCACACGG + Intergenic
941985547 2:171507425-171507447 TACAGGCATGACCCACCACACGG + Intergenic
942267022 2:174238351-174238373 TATAGGCATGCGCCACCACCAGG - Intronic
943431561 2:187809268-187809290 TACAGGCATGAGTCTGCACCTGG - Intergenic
943898084 2:193393765-193393787 TACAGGCATGAGCCATTGCCTGG - Intergenic
944510984 2:200465755-200465777 TACAGGTGTGAGCCATCACCTGG - Intronic
944622714 2:201533487-201533509 TACAATGATGAGCCAAGAACAGG - Intronic
944714727 2:202367274-202367296 TACAGGCGTGAGCCACCGCCCGG + Intergenic
944889926 2:204106885-204106907 TACAGGCATGAGCCACTGCCCGG + Intergenic
945076706 2:206047052-206047074 TACAGGCGTGAGCCACCGCCTGG + Intronic
946210106 2:218140758-218140780 TACAGGCGTGAGCCCACACCTGG - Intergenic
947687307 2:232099488-232099510 TACAGGCATGAGCCACTGCCTGG + Intronic
947688154 2:232109168-232109190 TACAGGCATGAGCCACCGCCTGG - Intronic
948005424 2:234604102-234604124 TACAGGCATGAGCCAAAAACTGG - Intergenic
948101668 2:235379567-235379589 TACAAACATGAGCCACTGCCCGG - Intergenic
948129623 2:235590994-235591016 TACAGGCGTGAGCCACCGCCCGG + Intronic
948406070 2:237720523-237720545 TACAGGCATGACACCACACCTGG + Intronic
948468189 2:238162118-238162140 TCCAAGCAGGAGGCAGCACCAGG - Intronic
1169184458 20:3602686-3602708 TACAGGCATGAGCCACCGCCCGG - Intronic
1169379245 20:5092573-5092595 TACAGGCATGTGCCACCACCTGG - Intronic
1170363507 20:15574142-15574164 TCCAAGCATGTGCAGACACCAGG + Intronic
1170529785 20:17279528-17279550 TACAGGCGTGAGCCACCACTGGG - Intronic
1170587025 20:17742553-17742575 TATAGGCATGAGCCGTCACCCGG - Intergenic
1170777165 20:19385910-19385932 TACAGGCATGAGCCACCACCTGG + Intronic
1171507842 20:25653415-25653437 TACAGGCGTGAGCCACCGCCAGG + Intergenic
1171523054 20:25790092-25790114 TACAGGCATGAGCCAGAGCCTGG + Intronic
1171530792 20:25852069-25852091 TACAGGCATGAGCCAGAGCCTGG + Intronic
1171544998 20:25993330-25993352 TACAGGCATGATCCAGCACCTGG - Intergenic
1171553773 20:26065791-26065813 TACAGGCATGAGCCAGAGCCTGG - Intergenic
1171967193 20:31539518-31539540 TACAGGCATGAGCCACCACCTGG - Intronic
1172723923 20:37021716-37021738 TACAGGCATGAGCCTGCGCCCGG + Intronic
1173724337 20:45286894-45286916 AACAGGCATGAGCCATCGCCTGG + Intergenic
1173907594 20:46640220-46640242 TACAAGAAAGTGCCGACACCTGG - Intronic
1173911975 20:46677187-46677209 TACAAGCACAAGCCACCACCTGG + Intronic
1174519255 20:51117083-51117105 TACAGGCGTGAGCCATCACTTGG - Intergenic
1175829460 20:61954090-61954112 TACAGGCATGCACCACCACCTGG - Intronic
1176777656 21:13153284-13153306 TACAAGCATGAGCCACCATATGG + Intergenic
1177435629 21:21048626-21048648 TACAGGCGTGAGCTACCACCTGG + Intronic
1177952404 21:27554764-27554786 TATAATCATGAGGAAACACCAGG - Intergenic
1178444318 21:32624750-32624772 TATAGGCGTGAGCCACCACCTGG + Intergenic
1178827360 21:36028045-36028067 TACAGGCATGCGCCAAGAGCTGG - Intergenic
1178879059 21:36434177-36434199 TACAGGCATGAGCCACCACCCGG + Intergenic
1178981083 21:37266191-37266213 TACAAGCGTGAGCCACCGCGCGG + Intronic
1180682778 22:17639993-17640015 TACAGGCATGCGCCACCACGCGG + Intronic
1180850433 22:19016612-19016634 GACAAGCATGAGCCGCCGCCTGG - Intergenic
1181160265 22:20956074-20956096 TACAGGCATGAGCCACCACCTGG + Intergenic
1181256186 22:21564307-21564329 TACAGGCATGAGTCACCACAAGG + Intronic
1181867729 22:25872622-25872644 TACAAGCAAGTGGCAACACCAGG - Intronic
1182272199 22:29161839-29161861 TTACAGCATGAGCCACCACCCGG - Intronic
1182375708 22:29846190-29846212 TAGAGGCATGAGCCACTACCTGG - Intergenic
1183255848 22:36761669-36761691 TACAAGCCTGAGCCACCAACAGG + Intronic
1183404205 22:37622354-37622376 TACAGGCATGAGCCACTGCCTGG + Intronic
1183609602 22:38890624-38890646 TACAGGCATGAGCCACTGCCTGG - Intergenic
1183825551 22:40383951-40383973 TAAAAGCAGGAGCCAAGGCCAGG + Intronic
1184042109 22:41950420-41950442 TACAGGCGTGAGCCACCACCTGG - Intergenic
1184624390 22:45712228-45712250 TTCAAGAATGAGCCCAAACCTGG - Intronic
1184804984 22:46788941-46788963 CAGAAACATGAGCCCACACCCGG - Intronic
1185367322 22:50442688-50442710 TACAGGCATCCGCCACCACCAGG + Intronic
1203237535 22_KI270732v1_random:19805-19827 TACAAGCATGAGCCACCATATGG + Intergenic
1203290263 22_KI270735v1_random:30260-30282 TACAAGCATGAGCCACCATATGG - Intergenic
1203323118 22_KI270737v1_random:88280-88302 TACAAGCATGAACCACCATATGG - Intergenic
949262027 3:2114175-2114197 TACAGGTGTGAGCCACCACCTGG - Intronic
949307488 3:2659184-2659206 TACAGGTCTGAGCCACCACCTGG - Intronic
949410462 3:3757746-3757768 TACAGGCATGAGCCACCACGTGG + Intronic
949925087 3:9034548-9034570 TACATGCATGGGCAAAAACCAGG + Intronic
950029300 3:9841611-9841633 TATAGGCATGAGCCACCACGCGG + Intronic
950533506 3:13566635-13566657 TACAACCATCAGACAGCACCAGG + Intronic
951245183 3:20332272-20332294 TACAGGCATGAGCCACCGCCTGG + Intergenic
952142303 3:30493613-30493635 TACAGGCGTGAGCCGCCACCTGG + Intergenic
952420234 3:33123768-33123790 TACAAGCATGTGACTACACCTGG + Intronic
954030081 3:47812938-47812960 TACAGGCGTGAGCCACCAGCAGG + Intronic
954205980 3:49059238-49059260 TACAGGCGTGAGCCATCACAAGG + Intronic
954268735 3:49490843-49490865 TACAGACATGAGCCACAACCTGG + Intronic
954270793 3:49507073-49507095 TACAGGCATGAGCCACTGCCAGG - Intronic
954544697 3:51423214-51423236 TACAGGCATGAGACCACGCCTGG - Intronic
954770465 3:52963268-52963290 TACAGGCATGACCCACCGCCCGG + Intronic
954910716 3:54105027-54105049 CACAAGCATGTGCCACCACACGG + Intergenic
955683735 3:61528928-61528950 TACAGGCCTGAGCCACCACTGGG - Intergenic
955742959 3:62111722-62111744 TATAGGCGTGAGCCACCACCGGG + Intronic
955873791 3:63468528-63468550 TACAGGCGTGAGCCACCACGTGG - Intronic
956746989 3:72318180-72318202 TACAGGCATGAGCCACCGTCCGG - Intergenic
956784085 3:72628070-72628092 CACAGGCATCAGCAAACACCTGG - Intergenic
958108733 3:89112111-89112133 TACAACCATGATCTAACACGTGG - Intronic
958734709 3:97995117-97995139 TACAGGCATGCACCACCACCTGG + Intronic
959383569 3:105673342-105673364 TACAGGCATGAGCCTGTACCTGG + Intronic
959527319 3:107391602-107391624 TACAGGCATGAGCCACCACCAGG + Intergenic
959904168 3:111692316-111692338 TACAGGCGTGAGCCACCGCCCGG + Intronic
960727728 3:120687421-120687443 TATAGGCGTGAGCCAGCACCTGG + Exonic
962584320 3:136826310-136826332 TACAGGCATGAGCCACCACGAGG + Intronic
963166243 3:142207056-142207078 TGCCAGAATGAGCCAACAGCGGG + Intronic
963238111 3:142975122-142975144 TACAGGCAAGTGCCACCACCTGG - Intronic
963891383 3:150639455-150639477 TACAGGCATGAGTCACCATCTGG - Intergenic
964356806 3:155858702-155858724 TACAGGCGTGAGCCACCGCCCGG - Intergenic
965030475 3:163359170-163359192 TACAGGCACGTGCCACCACCTGG - Intergenic
965295715 3:166943128-166943150 TACAGGCATGCGCCACCAGCAGG - Intergenic
965527662 3:169738773-169738795 TACAGGCGTGAGCCACCACCTGG + Intergenic
965558002 3:170037600-170037622 TACAGGCATGAGCCACCGCCTGG + Intergenic
965977458 3:174642032-174642054 TACAGGCATGAGCCACTGCCGGG + Intronic
966430808 3:179830070-179830092 TACAGGCTTGAGCCACCGCCCGG + Intronic
966568240 3:181408009-181408031 TACAGGCATGAGCCACCGCCAGG - Intergenic
967012799 3:185452510-185452532 TACAGGCATGAGCCATTGCCTGG + Intronic
967224643 3:187279333-187279355 TTCAACAATCAGCCAACACCAGG - Intronic
968110782 3:196044909-196044931 TACAAGCGTGAGCCACCGCCCGG - Intronic
968192091 3:196675925-196675947 GACAGGCGTGAGCCACCACCTGG + Intronic
968264995 3:197355967-197355989 TCCAGGCATGAGGCAACACCTGG - Intergenic
968821782 4:2858709-2858731 TACAGGCATGAGCCACTGCCTGG - Intronic
968841408 4:3009145-3009167 TATAGGCGTGAGCCACCACCCGG - Intronic
969381895 4:6806457-6806479 TACAGGCATGAGCCACCGCCAGG - Intronic
969832006 4:9805421-9805443 TACAGGCATGAGCCACCTCAGGG - Intronic
969939916 4:10721899-10721921 TACAGGCATGAGCCACTGCCTGG - Intergenic
970388371 4:15580360-15580382 TACAGGCATGAGCCACTGCCTGG - Intronic
970992967 4:22234637-22234659 TACAGGCGTGAGCCACCGCCTGG + Intergenic
971311993 4:25533077-25533099 TACAGGCATGAGCCACTGCCCGG + Intergenic
971330669 4:25678654-25678676 CACAGGCGTGAGCCACCACCAGG + Exonic
972454463 4:39239896-39239918 TACAGGCATGAGCCACCACTGGG - Intronic
972668761 4:41194014-41194036 TACAAGCTTGAGCCACTGCCTGG - Intronic
972780249 4:42280874-42280896 TACCGGCGTGAGCCACCACCTGG + Intergenic
973131382 4:46652895-46652917 TACAAGAATGGGCTAACACAGGG - Intergenic
973325029 4:48851531-48851553 TACAGGCATGCGCCACCACTTGG - Intronic
973767149 4:54173146-54173168 TACAAGCATGCACCACCACGCGG + Intronic
974110298 4:57518136-57518158 TACAGGCATGAGCCACTATCTGG - Intergenic
974297831 4:60025577-60025599 TACAGGTGTGAGCCACCACCTGG + Intergenic
974639047 4:64606125-64606147 AACACTCATCAGCCAACACCTGG + Intergenic
974737316 4:65953426-65953448 TGCAAGCATGAGCCAATAAATGG - Intergenic
975542438 4:75528771-75528793 TACAGGTATGAGCCACCACCCGG - Exonic
975891753 4:79037418-79037440 TACAACCAAGAGAAAACACCTGG - Intergenic
976881810 4:89934405-89934427 CACAGTCATGAGCTAACACCAGG + Intronic
977298104 4:95233658-95233680 TACAGGCCTGAGCCACCACATGG - Intronic
977937360 4:102822658-102822680 TACAGGCGTGAGCCACCACGTGG - Intronic
978002279 4:103571169-103571191 TACAAGCGTGAGCCACTACCTGG - Intergenic
980041466 4:127945456-127945478 TACAGGCATGTGCCACCACGTGG + Intronic
980812182 4:137896212-137896234 TACAGGCATGAGCCATCACGCGG - Intergenic
981947476 4:150365147-150365169 TACAAGCATGCCACCACACCCGG + Intronic
982010052 4:151097882-151097904 TACAGGCATGAGCCACCACCTGG + Intergenic
982154836 4:152508413-152508435 TACAAGCGTGAGCCACTGCCTGG - Intronic
982200942 4:152959674-152959696 TACAGGCATGAGTCACTACCTGG + Intronic
982528620 4:156509694-156509716 TACAGGCATGTGCCACCACACGG - Intergenic
982989310 4:162250627-162250649 TACAGGCGTGAGCCACCGCCTGG - Intergenic
983083710 4:163417773-163417795 TACAGGCATGTGACCACACCTGG - Intergenic
983251029 4:165346766-165346788 TACAAGCCAGAGCCAGAACCAGG + Intergenic
983565479 4:169146501-169146523 TACAGGTGTGAGCCACCACCCGG + Intronic
984262076 4:177454036-177454058 TACAGGCGTGAGCCACCGCCTGG + Intergenic
987364668 5:17138224-17138246 TACAGGCGTGAGCCACCGCCTGG + Intronic
987439563 5:17939695-17939717 TACAGGCATGAGCCACTGCCCGG + Intergenic
987664474 5:20919424-20919446 TACAGGTGTGAGCCACCACCCGG - Intergenic
987798407 5:22660691-22660713 TACAGGCATGAGCCACTGCCTGG + Intronic
988758207 5:34282768-34282790 TACAGGCGTGAGCCACCACCCGG + Intergenic
989180076 5:38567802-38567824 TATAGGCATGAGCCACCACCTGG + Intronic
990178905 5:53138557-53138579 TACAAGCATCAGCCAAACCTGGG + Intergenic
990210128 5:53473924-53473946 AACAAGTATCAGCCTACACCAGG + Intergenic
990539567 5:56758597-56758619 TACAGGCGTGAGCCACCGCCTGG - Intergenic
991982647 5:72249406-72249428 TACAGGCGTGAGCCACCACGCGG - Intronic
992330005 5:75706824-75706846 TACAAGCATGAGCCACTGCCTGG + Intronic
992713241 5:79482720-79482742 TACAGGTATGAGCTACCACCTGG - Intronic
992747947 5:79837387-79837409 TACAGGCATGAGCCACCCACTGG + Intergenic
993178886 5:84523183-84523205 TACAGGCATAAGCCACCACATGG - Intergenic
994327562 5:98466385-98466407 TACAGGCCTGAGCCACCGCCTGG - Intergenic
994697425 5:103090011-103090033 TACAGGCATGAGCCACTGCCTGG - Intronic
995792082 5:115899561-115899583 TACAGGTGTGAGCCACCACCTGG + Intronic
997118958 5:131154812-131154834 TACAGGCGTGAGCCCACACCTGG + Intergenic
997543339 5:134683161-134683183 TATAGGCGCGAGCCAACACCTGG + Intronic
997994870 5:138577402-138577424 TACAGGCGTGAGCCACCGCCTGG - Intergenic
998282534 5:140825563-140825585 TACAGGCATGTGCCCACACCTGG + Intronic
998448329 5:142215565-142215587 TACAGGCATGCTACAACACCTGG - Intergenic
998469010 5:142368786-142368808 TACAAGCATGTCACCACACCTGG + Intergenic
998665086 5:144287907-144287929 TACAGGCATGAGACAATGCCTGG + Intronic
998948087 5:147362804-147362826 TACAGGCATGAGCCAGTGCCTGG - Intronic
998968927 5:147570226-147570248 TACAGGCGTGAGCCACCGCCTGG + Intergenic
999199273 5:149804529-149804551 TACAGGCATGCTCCACCACCTGG - Intronic
999457617 5:151730844-151730866 TACAGGCAGGTGCCACCACCTGG + Intergenic
999603222 5:153289880-153289902 TCCAGGCATGAGCCACCACATGG + Intergenic
1000001328 5:157141864-157141886 TACAGGCGTGAGCCACCACACGG + Intronic
1000332964 5:160220332-160220354 TACAGGTGTGAGCCATCACCTGG - Intronic
1000924785 5:167180248-167180270 TACAGGCATGTGCCACCACACGG + Intergenic
1001063485 5:168515424-168515446 TACAGGCATGAGCCAATTACAGG + Intronic
1001387349 5:171350790-171350812 TACAGGCGTGAGCCACCACCTGG + Intergenic
1001502165 5:172245569-172245591 TACAGGCATGCGCCACCACGTGG - Intronic
1002042713 5:176526472-176526494 TACAGGCATGAGCCACCGGCTGG + Intergenic
1002358653 5:178652080-178652102 TACAGGCGTGAGCCACCGCCCGG - Intergenic
1002498334 5:179631334-179631356 TATAGGCATGAGCCACCACACGG - Intronic
1003334193 6:5155220-5155242 TACAGGCATGCGCCACCGCCTGG + Intronic
1003597421 6:7486743-7486765 TACAGGCGTGAGCCACCACGCGG + Intergenic
1003603419 6:7539416-7539438 TACAGGCATGAGCCACCGCACGG + Intergenic
1004328753 6:14701673-14701695 TACAGGCGTGAGCCACCACATGG + Intergenic
1004402005 6:15297410-15297432 TACAAGCATGAGCCACCGCCCGG + Intronic
1004688887 6:17975014-17975036 TACCAGCATCAGCCATCACCTGG + Intronic
1005045998 6:21643080-21643102 TATAGGCATGAGCCACCGCCTGG - Intergenic
1005074774 6:21896330-21896352 TACAGGCATGAGCCACCATGCGG - Intergenic
1005516981 6:26564346-26564368 TACAGGCGTGAGCCACCACTGGG - Intergenic
1005620475 6:27615320-27615342 TACAGGCATGAGCCACCACCCGG + Intergenic
1005645480 6:27833865-27833887 TACAGGCATGTGACACCACCTGG - Intergenic
1006103860 6:31704092-31704114 TACAGGCATGAGCCATGGCCTGG - Intronic
1006686521 6:35839289-35839311 TACAGGCCTGAGCCACCACCTGG + Intronic
1006697839 6:35946509-35946531 TACAGGCGTGAGGCCACACCTGG + Intronic
1006858444 6:37152809-37152831 TACAGGCATGAGCCACCGCACGG - Intergenic
1006891766 6:37434749-37434771 TACAGGCATGTGCCACCACCCGG + Intronic
1007549340 6:42717080-42717102 TACAAGCATGAGCCCGCACCTGG + Intronic
1007643481 6:43362645-43362667 TACAGGCATGCGCCACCACTGGG + Intronic
1008330162 6:50235743-50235765 TACAGGCATGTGCCACCACACGG - Intergenic
1008908439 6:56706723-56706745 TACAGGTATGAGCCACCACATGG - Intronic
1009528689 6:64781434-64781456 TACAGGCGTGAGCCACCGCCCGG - Intronic
1010222438 6:73459505-73459527 TGCCAGAATGAGCCAACAGCGGG + Intergenic
1010228630 6:73514919-73514941 TACAGGCGTGAGCCATGACCTGG + Intergenic
1011255249 6:85414135-85414157 TATAGGCATGCGCCACCACCAGG + Intergenic
1012387441 6:98698455-98698477 TACAGGCGTGAGCCACCGCCTGG + Intergenic
1013061206 6:106635728-106635750 TACAGGCGTGTGCCACCACCTGG - Intronic
1013298220 6:108779184-108779206 TACAGGCGTGAGCCACCACCTGG - Intergenic
1013398960 6:109772595-109772617 TACAAGCATGTGCCACCACCTGG + Intronic
1014043445 6:116855728-116855750 TACAGGCATGAGCCACCACACGG - Intergenic
1014154469 6:118094690-118094712 TACAGACATGAGCCACCACATGG - Intronic
1014515341 6:122371212-122371234 TACAGGCATGAACCAACATGTGG - Intergenic
1015942227 6:138463920-138463942 AACAAGCATCATACAACACCAGG - Intronic
1016960644 6:149669482-149669504 TGCAAGCATGAGCCTGCACCTGG - Intronic
1016995520 6:149960042-149960064 TACAAGCATGCGCCACCCACTGG - Intergenic
1017003093 6:150009457-150009479 TACAAGCATGCGCCACCCACTGG + Intergenic
1017012710 6:150073469-150073491 TACAAGCATGCGCCACCCACTGG + Intergenic
1017040102 6:150301190-150301212 TAAAAGAATGAGCTCACACCCGG + Intergenic
1017136240 6:151150086-151150108 TACAGGAATGAGCCACCACATGG - Intergenic
1017143802 6:151216006-151216028 TACAGGCATGAGCCACTGCCTGG + Intergenic
1017345258 6:153372146-153372168 TATAGGCATGAGCCACCACCTGG - Intergenic
1017713938 6:157194842-157194864 TACAGGCATGAGTCATCACCTGG - Intronic
1018273505 6:162105540-162105562 TACAGGCGTGTGCCACCACCTGG + Intronic
1018404432 6:163463399-163463421 TTCAAGTATGAGCCAACTTCTGG - Intronic
1018675733 6:166220871-166220893 TATAAGCAGGAGCTAACACTGGG + Intergenic
1019004012 6:168781034-168781056 TACAGGCATGAGCCACCAACTGG + Intergenic
1019167071 6:170104216-170104238 TACAGGCATGAGCCACCGCATGG + Intergenic
1019345440 7:527486-527508 TACAGGCGTGAGCCACCACAAGG + Intergenic
1019426732 7:981336-981358 TACTAGCATGAGCCAATGCCGGG - Intergenic
1019745111 7:2695439-2695461 TATAAGCCTGAGCCACCACATGG - Intronic
1020202930 7:6094312-6094334 TACAGGCATGCACCAGCACCTGG + Intergenic
1020229671 7:6308251-6308273 TACAGGCCTGAGCCACCGCCTGG - Intergenic
1020619317 7:10498691-10498713 TACAGGCATGAGCCAGCGCCGGG - Intergenic
1020890271 7:13869468-13869490 TACAGGTGTGAGCCACCACCTGG + Intergenic
1021088676 7:16454623-16454645 TCCAAACTTGATCCAACACCAGG - Intergenic
1021665134 7:22969439-22969461 TACAGGCATGAGCCAACGTCTGG + Intronic
1021685614 7:23182620-23182642 TACAGGCGTGAGCCACCGCCCGG - Intronic
1021705473 7:23363520-23363542 TACAGGCGTGACCCAGCACCTGG + Intronic
1022015329 7:26344442-26344464 TACAGGTGTGAGCCACCACCTGG + Intronic
1022551575 7:31244910-31244932 TACAGGCATGAGCCACTTCCTGG + Intergenic
1023193548 7:37609860-37609882 TACAGGCGTGAGCCACTACCCGG - Intergenic
1023848009 7:44134100-44134122 TACAAGCATGAGCCACTGCCTGG + Intergenic
1023872665 7:44271192-44271214 TACAGGCATGAGCCACCATCTGG + Intronic
1023922734 7:44642138-44642160 TATAGGCATGAGCCACCATCTGG - Intronic
1024805449 7:53134177-53134199 TACAGGCATGAGCCACCATATGG - Intergenic
1024946223 7:54809742-54809764 TACAGGCATGACCCCACACCTGG + Intergenic
1025051151 7:55736102-55736124 TATAGGCATGAGCCACCACTAGG + Intergenic
1025076746 7:55950520-55950542 TACAGGCATGAGCCACCAGTGGG - Intergenic
1025254125 7:57371797-57371819 TACAGACATGAGGCAACCCCAGG + Intergenic
1025283489 7:57645012-57645034 TACAGGCATGAGCCAGAGCCTGG + Intergenic
1025296406 7:57778395-57778417 TACAGGCGTGAGCCAGCACCTGG - Intergenic
1025474586 7:60903519-60903541 TACAAGCATGAACCACCATATGG + Intergenic
1025480742 7:60979573-60979595 TACAAGCATGAACCACCATATGG + Intergenic
1025488302 7:61079450-61079472 TACAAGCATGAACCACCATATGG - Intergenic
1025512417 7:61586355-61586377 TACAAGCATGAACCACCATATGG - Intergenic
1025551354 7:62253955-62253977 TACAAGCATGAACCACCATATGG - Intergenic
1025565664 7:62430996-62431018 TACAAGCATGAACCACCATGTGG + Intergenic
1025837731 7:65110923-65110945 TACAAGCATGAGCCACCATATGG + Intergenic
1025885341 7:65585072-65585094 TACAAGCATGAGCCACCATATGG - Intergenic
1025944979 7:66098768-66098790 TACAGGCATGAGCCACGGCCTGG - Intronic
1026055214 7:66977756-66977778 TACAGGCCTGAGCCACCGCCTGG + Intergenic
1026722479 7:72844101-72844123 TACAGGCCTGAGCCACCGCCTGG - Intergenic
1026917670 7:74131673-74131695 TACAGGCACCAGCCACCACCTGG + Intergenic
1027058568 7:75067351-75067373 TACAGGCATGAGCCACTGCCCGG - Intronic
1027364869 7:77446922-77446944 TACAGGCATGAGCCACCGCCTGG + Intergenic
1027505657 7:79015177-79015199 TACAAGCATGAGCCACCGTATGG - Intronic
1027762873 7:82302033-82302055 TATAGGCATGAGCCACCGCCTGG + Intronic
1028707700 7:93869692-93869714 TACAGGCTTGAGCCAGCGCCTGG + Intronic
1029422808 7:100479743-100479765 TACAGGCATGAGCCACCACCGGG - Intergenic
1029479560 7:100804274-100804296 TACAGGCGTGAGCCACCACCTGG + Intronic
1029533811 7:101143787-101143809 TACAGGCATGAGCCACTGCCTGG - Intergenic
1029589973 7:101500906-101500928 TACAGGCGTGAGCCACCGCCCGG - Intronic
1030142169 7:106316272-106316294 TACAGGCATGAGCCACCACCTGG - Intergenic
1030351800 7:108497886-108497908 TACAAGAATGAGCCACTGCCTGG - Intronic
1030871131 7:114757724-114757746 TACAGGCATGAGCCACCGCAGGG + Intergenic
1031611788 7:123836751-123836773 TACAGGCATGAGCCACCACCTGG - Intronic
1032082672 7:128867843-128867865 TACAGGCATGAGCCACCGGCTGG + Intronic
1032131719 7:129234516-129234538 TACAGGCGCGAGCCCACACCTGG + Intronic
1032145342 7:129374664-129374686 TACAGGCATGTGCCACCACGCGG - Intronic
1032673829 7:134109865-134109887 TACAAGCATGAGCCACTGCCTGG + Intergenic
1032748129 7:134808381-134808403 TACAGGCATGAGCCACCACCTGG + Intronic
1033195747 7:139325913-139325935 TACAGGCGTGAGCCACCGCCCGG - Intergenic
1033651149 7:143345025-143345047 TACAGGCGTGAGCCACCGCCTGG + Intronic
1033668650 7:143468385-143468407 TACACGCATGAGCCACTACAAGG - Intergenic
1034006838 7:147482441-147482463 TACAGGCGTGAGCCACCACACGG - Intronic
1034173884 7:149085315-149085337 TACAGGTATGAGCCAGTACCTGG - Intronic
1034631716 7:152536174-152536196 TACAGGCGTGAGCCACCACCCGG - Intergenic
1034694038 7:153038495-153038517 TACAGGCATGAGCCACCCCTTGG + Intergenic
1034777581 7:153844136-153844158 TGCCAGAATGAGCCAACAGCGGG - Intergenic
1035124212 7:156596155-156596177 TACAGGCATAAGCCCACACTCGG + Intergenic
1035673463 8:1437690-1437712 TACAGGCATGAGCCACCGGCCGG - Intergenic
1036093420 8:5695541-5695563 CACAAGCATGAGCCACCACATGG - Intergenic
1036810583 8:11865732-11865754 TACAGGCATGAGCCACCGCGCGG - Intronic
1036932309 8:12968158-12968180 TACAGACATGAGCCACCACCTGG + Intronic
1037056823 8:14452822-14452844 TACAGGCGTGAGTCCACACCCGG - Intronic
1037084930 8:14836775-14836797 TACAGGCATGAGCCACATCCTGG + Intronic
1037099381 8:15024659-15024681 TACAGGCTTGAGCCACCACCCGG - Intronic
1037130472 8:15402591-15402613 TAAAAACTTGAGCCAAGACCTGG - Intergenic
1038550609 8:28465345-28465367 TACAGACATGAGCCACCACACGG - Intronic
1038575124 8:28698571-28698593 TACAGGCGTGAGCCACCACGCGG - Intronic
1038634853 8:29277508-29277530 TACAGGCATGAGCCACCACCTGG + Intergenic
1038942951 8:32325652-32325674 TATAGGCATGTGCCCACACCTGG + Intronic
1039016657 8:33156989-33157011 CACAGGCATGTGCCACCACCTGG - Intergenic
1039042910 8:33425058-33425080 TACAGGTGTGAGCCAGCACCCGG - Intronic
1040504705 8:48036708-48036730 TACAGGCATGAGCCACTGCCTGG + Intronic
1041418150 8:57636528-57636550 TACATGCCTGAGTCAACAACTGG + Intergenic
1042289241 8:67150674-67150696 TACAGGCGTGAGCCATCGCCTGG + Intronic
1042395267 8:68284976-68284998 TACAAGCATGTGCCACCACGCGG - Intergenic
1043097191 8:75990099-75990121 TACAGGCATGAGCCACCACCTGG - Intergenic
1043443777 8:80299845-80299867 TACAGGCATGAGCCTGCGCCCGG + Intergenic
1043767873 8:84160370-84160392 TTCAAGCATGAGATAACATCAGG - Intergenic
1045461523 8:102429732-102429754 CACAGGTGTGAGCCAACACCCGG + Intergenic
1045506134 8:102780038-102780060 TACAGGCATGAGCCACCGCGCGG - Intergenic
1045625817 8:104049145-104049167 TACAGGCGTGAGCCACCGCCCGG - Intronic
1046170212 8:110496363-110496385 AACAATCATGATCCAACCCCAGG + Intergenic
1046179036 8:110618560-110618582 TACAAGCATGCCACTACACCTGG + Intergenic
1046855990 8:119032624-119032646 TACAGGCATGAGCCACCGCGCGG - Intronic
1047240514 8:123083531-123083553 TACAGGCGTGAGCCACCGCCCGG + Intronic
1047323068 8:123807366-123807388 TACAGGCATGAGCCTGTACCTGG - Intronic
1047375456 8:124291834-124291856 TGCAGGCATGAGCCACCGCCCGG - Intergenic
1047412950 8:124639059-124639081 TACAGGCATGAGCCACCACCTGG - Intronic
1048396424 8:134018555-134018577 TACAGGCATGAGCCACCATATGG - Intergenic
1049027617 8:140006093-140006115 GACAAGCCTGAGTCAACACATGG + Intronic
1049729727 8:144170106-144170128 TACAGGCGTGAGCCACTACCTGG + Intronic
1050110203 9:2207612-2207634 TACAGGCATGCGCCACCACATGG + Intergenic
1050436880 9:5620358-5620380 TACAGGTATGAGCCACCACATGG + Intergenic
1050767295 9:9150747-9150769 TACAGGCATGAGCCAACAACCGG + Intronic
1050794840 9:9525130-9525152 TACAGGCGTGAGCCACCGCCCGG + Intronic
1051103157 9:13546129-13546151 TACAGGTGTGAGCCACCACCCGG - Intergenic
1051679047 9:19588683-19588705 TACAGGCATGAGCCACCACGCGG - Intronic
1052828596 9:33196343-33196365 TACAGGCGTGAGCCAACACCTGG - Intergenic
1052905314 9:33828527-33828549 TACAGGCATGTGCCACCACCGGG + Intronic
1052932918 9:34070417-34070439 TACAGGCATGAGCCACTGCCCGG - Intergenic
1053260265 9:36656890-36656912 TACAGGCATGAGCCACCATGGGG + Intronic
1053418741 9:37963504-37963526 TACATTCGTGAACCAACACCAGG - Intronic
1053698619 9:40663908-40663930 TACAAGCATGAACCACCATATGG - Intergenic
1053944624 9:43294145-43294167 TACAAGCATAAGCCACCATATGG - Intergenic
1054309908 9:63463309-63463331 TACAAGCATGAACCACCATATGG - Intergenic
1054408697 9:64787461-64787483 TACAAGCATGAACCACCATATGG - Intergenic
1054441854 9:65271275-65271297 TACAAGCATGAACCACCATATGG - Intergenic
1054488429 9:65750222-65750244 TACAAGCATGAACCACCATATGG + Intergenic
1055067781 9:72135884-72135906 TACAGGCATGAGCCACCACGCGG + Intronic
1055416895 9:76093233-76093255 TAGAAGCATGCACCACCACCCGG + Intronic
1055771766 9:79724563-79724585 TACAGGCATGAGCCACCACGTGG - Intronic
1056407603 9:86290564-86290586 TACAGGCATGAGCCACCGCCTGG - Intronic
1057017608 9:91666366-91666388 TACAGGCCAGAGCCACCACCTGG + Intronic
1057159785 9:92881332-92881354 TACAGGCATGAGCCACCGCATGG - Intergenic
1057340306 9:94195234-94195256 TACAGGCATGAGCCACCACATGG - Intergenic
1057345813 9:94249565-94249587 TACAGGCATGAGCCACCATGTGG - Intergenic
1057798210 9:98173028-98173050 TACAAGCGTGAGCCACCACCTGG - Intronic
1058378000 9:104347140-104347162 TACAGGCATGAGCCACCGCCCGG - Intergenic
1058494618 9:105542729-105542751 TACAGGCATGAGCCACTGCCTGG + Intronic
1059119231 9:111627176-111627198 TACAGGCGTGAGCCACCGCCCGG - Intergenic
1059181205 9:112214261-112214283 TACAGGCATGAGCCACCACCTGG - Intergenic
1059244527 9:112838163-112838185 TACAGGTATGAGCCACCACCAGG + Intronic
1059665072 9:116438667-116438689 TACAGGCGTGAGCCACCGCCCGG - Intronic
1059684267 9:116619662-116619684 TACAGGCATGTGCCACCACACGG + Intronic
1060011881 9:120050906-120050928 GGCCAGCAGGAGCCAACACCTGG + Intergenic
1060082308 9:120661236-120661258 TACAGGCATGAGCCACTGCCTGG - Intronic
1060296307 9:122345783-122345805 TACAGGCATTAGCCACCACCTGG - Intergenic
1060615404 9:125008410-125008432 TACAGGCATGAGCCACTGCCTGG + Intronic
1060649996 9:125317348-125317370 TACAGGCGTGAGCCACCGCCCGG - Intronic
1060704254 9:125783560-125783582 TACAGGCATCAGCCACCACGTGG + Intronic
1060730895 9:126036355-126036377 TACAGGCATGAGCCCGCACCTGG - Intergenic
1061056969 9:128228448-128228470 TATAGGCATGAGCCACCATCTGG + Intronic
1061236433 9:129345737-129345759 TACAGGCGTGAACCAACTCCCGG + Intergenic
1061470039 9:130816979-130817001 TACAGGCGTGAGCCACCGCCTGG + Intronic
1061547808 9:131314933-131314955 TACAGGCATGAGCCCGCTCCAGG + Intergenic
1062322977 9:135999397-135999419 TACAGGCATGAGCCACCGGCCGG + Intergenic
1062337157 9:136076731-136076753 TACAGGCATGAGCCACCACCAGG - Intronic
1062493091 9:136817784-136817806 TAGAAGTGTGAGCCAGCACCCGG - Intronic
1202780985 9_KI270717v1_random:37115-37137 TACAAGCATGAACCACCATATGG - Intergenic
1203581554 Un_KI270746v1:10968-10990 TACAAGCATGAGCCACCATATGG + Intergenic
1203587759 Un_KI270747v1:22723-22745 TACAAGCATAAGCCACCATATGG - Intergenic
1185489229 X:508140-508162 GACAGGCATGAGCCACCACTCGG + Intergenic
1185727359 X:2432846-2432868 TACAGGCATGAGCCACTGCCCGG - Intronic
1186083872 X:5964792-5964814 TACAGGCATATGCCACCACCTGG + Intronic
1186208976 X:7230161-7230183 TACAGACATGAGCCACCACCAGG + Intronic
1187342032 X:18429911-18429933 TACAGGCATGAGCCACCGCCAGG + Intronic
1187522813 X:20028414-20028436 GACAAGAATGAACCAAAACCAGG + Intronic
1187713756 X:22080977-22080999 TTCAAGCATGACCCAGCAACTGG + Intronic
1187829765 X:23369159-23369181 GACAAGCATGCGCAAACAGCTGG - Intronic
1188207103 X:27373759-27373781 TACTAAAATTAGCCAACACCTGG + Intergenic
1188315619 X:28669476-28669498 TACAGGCATGCGCCACCACAAGG - Intronic
1188400537 X:29738713-29738735 TACAAGTGTGAGCCACCACCTGG + Intronic
1188433003 X:30127858-30127880 TACAAGTATGCGCCACCACGGGG + Intergenic
1189810786 X:44778941-44778963 TACAAGCATGAGCCACCAGGTGG + Intergenic
1190311389 X:49119382-49119404 TACAGGCATGAGCCACTACCTGG + Intronic
1190328823 X:49223327-49223349 TACAGGCGTGAGCCACCACAGGG - Intronic
1190692409 X:52922197-52922219 TACAAGCGTGAGCCACCGCCCGG + Intergenic
1190800435 X:53783516-53783538 AACAAGCATGAGCCAAAGCAGGG + Intergenic
1192472514 X:71411355-71411377 TACAGGCATGAGCCACCACTAGG + Intronic
1192838282 X:74825826-74825848 TACAGGTGTGAGCCACCACCCGG + Intronic
1194773490 X:97933773-97933795 TACATGCATGAGCTACCACCAGG + Intergenic
1196524861 X:116719999-116720021 TACAGGCATGAGCCACCACGTGG + Intergenic
1197104691 X:122700351-122700373 TACAGGCGTGAGCCACCGCCTGG - Intergenic
1197742712 X:129907679-129907701 TACAGGCATGAGCCATCACCCGG - Intronic
1198009459 X:132536083-132536105 TACAGGCGTGAGCCACCGCCCGG - Intergenic
1198041926 X:132861066-132861088 TACAGGCATGAGCCACCACCTGG + Intronic
1198985089 X:142442117-142442139 TACATGCACGAACCACCACCTGG + Intergenic
1198985119 X:142442435-142442457 TACATGCACGAACCACCACCTGG + Intergenic
1200410264 Y:2853971-2853993 TACAGGCATGTGCCACCACCCGG + Intronic
1201390869 Y:13496120-13496142 TACAGGCATGCGCCACCACCTGG + Intergenic
1201452576 Y:14132328-14132350 GACCATCATGAGCCACCACCCGG - Intergenic
1201623195 Y:15982555-15982577 TGCCAGAATGAGCCAACAGCAGG - Intergenic