ID: 1117152116

View in Genome Browser
Species Human (GRCh38)
Location 14:52900369-52900391
Sequence ATACATATAAAAAAGCATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 674
Summary {0: 1, 1: 0, 2: 5, 3: 55, 4: 613}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117152116 Original CRISPR ATACATATAAAAAAGCATGA GGG Intronic
900485949 1:2922933-2922955 ATACCCTTAAAAAACCATGAGGG + Intergenic
902076312 1:13789713-13789735 ATCCATAAAAAAAATCATAAAGG + Intronic
903119023 1:21202334-21202356 ATATATATATCAAAGCATGGTGG - Intergenic
903313218 1:22477124-22477146 ATAAATATATATAATCATGAGGG - Intronic
903449506 1:23443190-23443212 ATACAAATAAAAAAGATTGAAGG - Intronic
904521553 1:31099892-31099914 ATACATTTTAAAAGGTATGAAGG + Intergenic
904766885 1:32856507-32856529 ATTCAAATAAAAAAGTAAGAGGG - Exonic
905644337 1:39614804-39614826 ATACATAGACAAAACCATGGTGG + Intergenic
905956218 1:41999192-41999214 ATACTTAGAAAAAAGTATTATGG - Intronic
906021990 1:42637791-42637813 ACAAACATAAAAAAGCTTGAAGG - Intronic
906099213 1:43246467-43246489 ATACACATACAAAAGAATTAAGG + Intronic
906181683 1:43825962-43825984 ATAGATATTAAAAAGAATAATGG + Intronic
906564296 1:46787144-46787166 AAACAAAAACAAAAGCATGATGG + Intronic
907088930 1:51706645-51706667 ATATATATATAAAAGCAAAAAGG - Intronic
907287019 1:53387894-53387916 ACACATACAAAAAAGCCTGATGG - Intergenic
908901536 1:68961853-68961875 ATAAATAGATCAAAGCATGAAGG - Intergenic
909184197 1:72464812-72464834 GTGCCTATAAGAAAGCATGATGG + Intergenic
909434887 1:75629727-75629749 ATACAGATGAAAAACCATGCTGG + Intergenic
911395149 1:97296882-97296904 ATAAATATAAAAAAGCACAGTGG + Intronic
911972659 1:104457345-104457367 ATAAATATAAAAATTAATGATGG - Intergenic
912328848 1:108797708-108797730 ATACACACAAAAAAACTTGATGG - Intronic
915384054 1:155472976-155472998 ATACATATAAAAATTCACAAAGG + Intronic
916206671 1:162321742-162321764 ATATATATATAAAAGCAACATGG + Intronic
916881217 1:169021147-169021169 ATACATATAATTAAGCCTGTTGG - Intergenic
916923138 1:169489707-169489729 AGTAATATAAAAAAGCATGAAGG + Intergenic
916979763 1:170121302-170121324 ATTCATATAAAAGAGAATGGAGG - Intergenic
918348351 1:183627398-183627420 ACAGATATGAAAAAGCAAGAAGG + Exonic
918480471 1:184972697-184972719 TTACATATACAAAAGTACGAGGG - Intronic
919197255 1:194301937-194301959 ATTTATATAAGAAAACATGAAGG + Intergenic
919705775 1:200673853-200673875 TTACATAAAGAAAAGCTTGAAGG - Intergenic
920149839 1:203896529-203896551 ATACATAAAGAAAAACCTGATGG + Intergenic
921006695 1:211100650-211100672 ATAAATATATAAATACATGAGGG - Intronic
921196010 1:212759061-212759083 ATATACATACAAAAGAATGAAGG + Intronic
921464012 1:215463670-215463692 ATATACATAAAAAAAGATGAAGG - Intergenic
922356091 1:224777439-224777461 ATGTATATATAAAAGCCTGAAGG + Intergenic
922440352 1:225651352-225651374 ATATATATATAAAAGCAAAATGG + Intronic
922967369 1:229701881-229701903 ATACATAAAGCAAAACATGATGG + Intergenic
923583420 1:235241468-235241490 ATATAAATATAAAGGCATGACGG - Intronic
924024655 1:239819563-239819585 ATAAATATATAAAAGCCTGTAGG + Intronic
924281195 1:242439032-242439054 AAACATGTAAACAAACATGAGGG - Intronic
924737805 1:246774413-246774435 ATAAATAAATAAAAGCATTAGGG + Intergenic
1063243365 10:4193716-4193738 TTACATATGAAAAAGAATGTTGG - Intergenic
1063284259 10:4666090-4666112 ATTCATAGGAAAAAGAATGAAGG - Intergenic
1064196703 10:13249519-13249541 ATAGATATACAAAAGAAGGAAGG + Intergenic
1064627923 10:17280610-17280632 ATGCTTGTACAAAAGCATGAAGG + Intergenic
1064775770 10:18774907-18774929 ATACTTTTAAAATAGAATGATGG + Intergenic
1065146066 10:22769551-22769573 ATACATATAACAGTTCATGAAGG + Intergenic
1066071094 10:31814169-31814191 ATACATATATAAAAGCTGAATGG - Intronic
1066087334 10:31983778-31983800 AAATATATAAAAAAGGATTATGG + Intergenic
1066668439 10:37811452-37811474 AAAAATAAAAAAAACCATGAAGG + Intronic
1067139370 10:43643711-43643733 TTACATTTATAAAAGCCTGATGG + Intergenic
1067968252 10:50939657-50939679 ATTTATTTTAAAAAGCATGAGGG - Intergenic
1068285249 10:54925101-54925123 ATACAAATAACAAATCAAGATGG - Intronic
1069109270 10:64425078-64425100 ATACATATAAATAATCATATGGG - Intergenic
1069307124 10:66984676-66984698 ATACAAGAAAAAAAGCATAAAGG - Intronic
1069426243 10:68290984-68291006 ATATAAACAAATAAGCATGATGG - Intronic
1069614140 10:69795967-69795989 ATGCATATACAAGAGCATGTAGG - Intergenic
1071425694 10:85547046-85547068 ATACAGATATAGCAGCATGAGGG + Intergenic
1071989092 10:91082428-91082450 CCACATATAAAATAGAATGATGG + Intergenic
1072738324 10:97894697-97894719 ATATATATGTAAAAGCATCAGGG - Intronic
1073412731 10:103355626-103355648 ATACATATGATAAAGAATTAAGG + Intergenic
1073711750 10:106051137-106051159 ATACATATAACAAAACATCATGG - Intergenic
1074104519 10:110378528-110378550 ATATATATAAAAAAACAGTATGG - Intergenic
1075041370 10:119109524-119109546 TTACATTTAAAATAGCAGGAAGG + Intronic
1075218806 10:120565856-120565878 AGACATATGAAAAATAATGAAGG - Intronic
1075481698 10:122787809-122787831 ACACATATAAAAAAGCAGCTGGG + Intergenic
1075563297 10:123483958-123483980 ATACATATATACATACATGAAGG - Intergenic
1075756529 10:124816259-124816281 ATCTATTTAAAAAAGCATCATGG - Intronic
1076175532 10:128365024-128365046 ATCCATATAAGAAACCTTGAAGG + Intergenic
1076205338 10:128594937-128594959 ATACATAAAAGAAAGCAAGATGG - Intergenic
1077124712 11:927358-927380 ATACACATTAAAAATTATGAGGG - Intronic
1077559362 11:3248459-3248481 ATACATATCAGAAAGGAAGAAGG + Intergenic
1077565254 11:3294262-3294284 ATACATATCAGAAAGGAAGAAGG + Intergenic
1078877586 11:15413601-15413623 ATTCATATAAAAATGCATGGGGG + Intergenic
1079313499 11:19387823-19387845 TTACAGAAAAAAAAGCATAATGG + Intronic
1079432056 11:20400716-20400738 AAATATAAAAAAAAGAATGAAGG - Intronic
1079543250 11:21601804-21601826 ATACATATATAAAATCAATATGG + Intergenic
1079901831 11:26196674-26196696 ATACATATAAAAGTATATGAGGG - Intergenic
1081114941 11:39188683-39188705 ATAAAAAAAAAAAAGCTTGAAGG - Intergenic
1081369267 11:42278901-42278923 AAACATTTAAAAAAGAATGAAGG + Intergenic
1081504708 11:43703767-43703789 ATACAAATAAAAAATGATAAAGG - Intronic
1081951119 11:47043839-47043861 CTAGATATAAAAAGGCATGGTGG + Intronic
1082281119 11:50272355-50272377 ATACTAATAACAAATCATGAAGG - Intergenic
1083041938 11:59697001-59697023 ATACCTAAAAGAAAGCATAAAGG - Intergenic
1084018314 11:66400675-66400697 ATACCTATAAAAAATCCTGCAGG + Intergenic
1084467262 11:69332865-69332887 ATACAAAACAAAAATCATGATGG - Intronic
1084756670 11:71243933-71243955 AAACATTTAAAGAAGAATGAAGG + Intronic
1085432585 11:76466498-76466520 ATCCCTCTAAAACAGCATGAAGG - Intronic
1085537879 11:77236090-77236112 ATAGAAAAAAAATAGCATGATGG + Intronic
1085584055 11:77683981-77684003 ATACAGATTAAAAAGAATGCTGG + Intronic
1085696506 11:78709268-78709290 ATAAGAATAGAAAAGCATGAAGG - Intronic
1086749110 11:90468070-90468092 ATGCAAATAAAAAATCATTAAGG + Intergenic
1086965510 11:93023847-93023869 ATACATAATAAAAAGTCTGAAGG + Intergenic
1087205781 11:95392394-95392416 AGAAGTATAAGAAAGCATGAGGG + Intergenic
1087335940 11:96844939-96844961 ATATATATAAAAAAAAGTGATGG + Intergenic
1087375174 11:97330649-97330671 ATACATATCAAAAAGCAAAAAGG - Intergenic
1087900030 11:103630165-103630187 ATGAATTTTAAAAAGCATGAAGG - Intergenic
1088926549 11:114308536-114308558 ATGCATCTATAAAAGCCTGAGGG - Intronic
1089736106 11:120551199-120551221 ATACATATACAAAAGCAAACAGG - Intronic
1090008278 11:123022054-123022076 ATACAGTTAAAAAAGCAATAAGG + Intergenic
1090158026 11:124462232-124462254 ATACATATATAAAATCTTGTAGG + Intergenic
1090594523 11:128307052-128307074 AAACATATAAGTAAGCATGTAGG + Intergenic
1091543994 12:1488283-1488305 ATACAGATTAAAAAGCAAAAAGG - Intronic
1092470915 12:8779881-8779903 ATACATACATAAAAGAATTAGGG - Intronic
1092900892 12:13058423-13058445 ATACACATAAAAAACCAAAAAGG - Intronic
1093208855 12:16283631-16283653 ATACATAAAATAAACCATTATGG - Intergenic
1093258181 12:16899074-16899096 TTATATATATAAAAGCATAAAGG - Intergenic
1093513919 12:19962549-19962571 ATACTAAAAAAAAAGGATGAGGG - Intergenic
1093612165 12:21174243-21174265 ATAAATAAAGAAACGCATGAAGG + Intronic
1093620547 12:21284232-21284254 AGCCATAAAAAAAAGAATGAGGG + Intronic
1093843235 12:23932143-23932165 AGTGATATAAAAAAGAATGATGG + Intronic
1094211907 12:27901761-27901783 ATAGATGTAACAAAGCATGATGG - Intergenic
1094249748 12:28346622-28346644 ATACAAATAAAATAGCTAGATGG + Intronic
1094478129 12:30858027-30858049 ATGCACATCAAAAAGCATGCAGG + Intergenic
1094708898 12:32941522-32941544 ATACATATTTAAAAGAATTATGG - Intergenic
1095616980 12:44202288-44202310 ATGCACATAAAAAGGTATGATGG + Intronic
1096249292 12:50017832-50017854 AAATATATAAAAAAGCACAAAGG + Intronic
1096884688 12:54705166-54705188 ATACAAAGAAAAAGTCATGAAGG - Intergenic
1097235933 12:57539614-57539636 ATGCATATGAAAAACCATGGTGG + Intronic
1097929935 12:65171634-65171656 ATGAATATAAAAAAGCAGCAAGG + Intronic
1098463446 12:70759731-70759753 CAACACATACAAAAGCATGAAGG + Intronic
1098583117 12:72125292-72125314 ATACATATAAACAACCTGGAAGG - Intronic
1099022978 12:77429475-77429497 ATACATTTCAAAAAACATCAGGG - Intergenic
1100060070 12:90564811-90564833 ATAAATAAAAAAAAGAAAGATGG - Intergenic
1100108015 12:91201582-91201604 TTACATACAAAAAACAATGAGGG - Intergenic
1100323249 12:93517120-93517142 ATATATATCAAATAGCTTGAAGG - Intergenic
1100655774 12:96643368-96643390 ATACAATAAAAAAAGAATGATGG - Intronic
1100835549 12:98563707-98563729 ATCCATATGTAAAAGAATGAAGG + Intergenic
1102549729 12:113683029-113683051 GTACACATAAAACAGCATCATGG - Intergenic
1103020491 12:117530100-117530122 ATAAAGATAACAAAGCAGGATGG + Intronic
1103138948 12:118532134-118532156 AAAAATATAGAAAAGCATAAAGG + Intergenic
1103493493 12:121342350-121342372 ATCCACATGCAAAAGCATGAAGG + Intronic
1103531030 12:121601895-121601917 ATAAATAAAAAAAAGAAGGAAGG - Intergenic
1103688532 12:122752136-122752158 AAACATAAAGAAAAGGATGAAGG + Intergenic
1103757658 12:123222367-123222389 ACAAATATAAAAAAGGATGCTGG + Intronic
1103810472 12:123609526-123609548 ATTAAAAAAAAAAAGCATGATGG - Intronic
1104195403 12:126532548-126532570 ACACATCTTAAAAACCATGAGGG - Intergenic
1105488376 13:20860341-20860363 ATAAATATAAATAAATATGAAGG + Intronic
1105616206 13:22015271-22015293 ATACATGTCAAAAAGATTGAAGG + Intergenic
1105879951 13:24595694-24595716 ATAAATATAAAAAGGAATAAAGG + Intergenic
1105919904 13:24953417-24953439 ATAAATATAAAAAGGAATAAAGG - Intergenic
1106003492 13:25747146-25747168 ATACATATAAGAAAACTGGAAGG + Intronic
1106811859 13:33365924-33365946 AAACATATTTAAAAACATGAGGG - Intergenic
1106826716 13:33530457-33530479 AGACATAAAAAAATGTATGAAGG - Intergenic
1107631361 13:42346037-42346059 ATCCATTTCATAAAGCATGAGGG - Intergenic
1108016473 13:46081716-46081738 ATACTCATAAAAAGGCATCAAGG + Intronic
1108157823 13:47604515-47604537 ATAAAAAAAAAAAAGCAAGAGGG + Intergenic
1108275180 13:48801006-48801028 ATCAATATAAAAACTCATGAAGG + Intergenic
1108347606 13:49561752-49561774 CTACAAAAAAAAAAGCAAGAAGG + Intronic
1109196536 13:59383674-59383696 ACACATATATAAATGCATAAAGG + Intergenic
1109406921 13:61912465-61912487 ATAAGAATAAAAAAACATGAAGG - Intergenic
1109799385 13:67356575-67356597 AAACATGTAAAAAAGAATTACGG - Intergenic
1109920098 13:69045476-69045498 ATACATATAAGAATACATGTAGG - Intergenic
1110097422 13:71545775-71545797 ATACTTTTAAAAAATCATGATGG - Intronic
1110154086 13:72292710-72292732 ATACAAATAAAACAGTAAGATGG + Intergenic
1110227427 13:73134200-73134222 ATACATAGAAAAAAGTTGGATGG + Intergenic
1110329418 13:74254090-74254112 ATGCATATAATTATGCATGAAGG - Intergenic
1110372543 13:74756167-74756189 AAAAACATGAAAAAGCATGAAGG + Intergenic
1110610911 13:77486479-77486501 AAAAATATAATAAAGCATTATGG + Intergenic
1111154666 13:84307293-84307315 AGACATTTAATAAAGCAGGAGGG - Intergenic
1111425421 13:88073938-88073960 ACCCATTTATAAAAGCATGAAGG - Intergenic
1111743812 13:92240021-92240043 TTTCATATAAAAAAGCTAGAAGG - Intronic
1112134221 13:96558102-96558124 ATAGAGATAAAAAAGCAAAAAGG - Intronic
1112142469 13:96660706-96660728 ATAAATATTAGAAACCATGATGG + Intronic
1114883651 14:26819264-26819286 ATACATATACATAAACATGTTGG + Intergenic
1114919203 14:27305856-27305878 GCACAAATACAAAAGCATGAGGG + Intergenic
1115165982 14:30449093-30449115 ATACATTTAAAAAAGTTAGAGGG - Intergenic
1115413956 14:33109605-33109627 AAACATATAAACAAACATGCAGG - Intronic
1116040426 14:39679837-39679859 GTACACATAAAAAAGCATTCAGG - Intergenic
1117152116 14:52900369-52900391 ATACATATAAAAAAGCATGAGGG + Intronic
1117689294 14:58289694-58289716 ATACATACAAACAAGGAGGAAGG + Intronic
1119067075 14:71539711-71539733 ATACAAATTGAAAAGCCTGAGGG - Intronic
1119067482 14:71543200-71543222 ATAAAGATAAAAAAGAGTGATGG - Intronic
1120960272 14:90118186-90118208 ACACATATGTAGAAGCATGATGG - Intronic
1122439584 14:101721162-101721184 ATATATATATGAAATCATGAAGG + Intergenic
1122953324 14:105058206-105058228 AAAAATATAAACAGGCATGATGG + Intronic
1125490595 15:40145793-40145815 ATCCATACAAAACAGCATGGGGG + Intergenic
1125912162 15:43450637-43450659 AAACCTGTAAAAAAGCAAGATGG - Intronic
1126381485 15:48051922-48051944 AGACAAAGAAAAAAGCAAGAGGG + Intergenic
1126420971 15:48471635-48471657 ATTCACATAAAAATACATGAGGG + Intronic
1126606146 15:50478752-50478774 CTATATAAAAAACAGCATGAGGG + Intronic
1127202389 15:56669845-56669867 ATATATATATAAAATAATGAGGG - Intronic
1127907055 15:63383634-63383656 AAAAAAAAAAAAAAGCATGAAGG - Intergenic
1128205871 15:65851713-65851735 ATACATGTAAAAAATTATGCAGG + Intronic
1128247572 15:66143536-66143558 ATACCTGTAAGAAAGCCTGAAGG - Intronic
1128921093 15:71610916-71610938 ACACATATAAATATGCATGTAGG - Intronic
1130698508 15:86155486-86155508 ATACAGATAAAAAGTCAGGAGGG + Intronic
1131176157 15:90211071-90211093 AGACATCTATAAAAGCAGGAAGG + Intronic
1131619016 15:94047309-94047331 AAATATATGAAAAAGCATGAGGG + Intergenic
1131944583 15:97606029-97606051 TTTCATTTAAAAAAGCATGCTGG + Intergenic
1132225619 15:100138914-100138936 ATACATTTTAAAAAACAAGAAGG + Intronic
1132469700 16:95399-95421 ATACAGATAAAAAACCTGGAGGG + Intronic
1133470327 16:6069007-6069029 ATTTATAAAAAAAAGAATGAAGG + Intronic
1133594528 16:7278651-7278673 ATTCATATCAAAAAGTCTGAAGG + Intronic
1133812494 16:9171499-9171521 ATACATATAAATAGGTAGGATGG + Intergenic
1133827977 16:9295846-9295868 ATAAATAAAAAAAAAAATGAGGG + Intergenic
1134832280 16:17333324-17333346 ACAAATATGAAAAAGCATTAAGG + Intronic
1135533638 16:23275851-23275873 AAACAGATAAACAAGGATGAGGG + Intergenic
1136077176 16:27825147-27825169 ATGGAAATAAAAGAGCATGAGGG + Intronic
1136219311 16:28818168-28818190 AAATATATAAAGAAGTATGATGG - Intergenic
1137321647 16:47389597-47389619 ATAATTATAACAAAGTATGATGG + Intronic
1138176821 16:54907621-54907643 AAAAAAATAAAAAAGCATGTTGG + Intergenic
1139158460 16:64473975-64473997 ATAGATAAAAAAATGCATGAAGG - Intergenic
1139678512 16:68541591-68541613 ATATATATAAAAACGCAGGCCGG - Intronic
1139766162 16:69232060-69232082 TTCTATATATAAAAGCATGAAGG + Intronic
1139780003 16:69343274-69343296 ACACATCTAAAAAAGCAAAATGG - Exonic
1140698558 16:77559897-77559919 AAAAATATAAAAAAGCATAAAGG - Intergenic
1140698621 16:77560229-77560251 ATGCACATAATAAAGCATAAAGG - Intergenic
1140878906 16:79179500-79179522 AAACAAAAACAAAAGCATGAAGG - Intronic
1142345304 16:89550165-89550187 AAACAAACAAAAAAGAATGACGG - Intronic
1142668497 17:1475968-1475990 ATGCATAGAAAAAGGCAGGAGGG + Intronic
1143074571 17:4329803-4329825 ATACCTTTAAAAAAGCCTAATGG - Intronic
1143838803 17:9714379-9714401 GTACAGATGAAAAAGAATGAAGG + Intronic
1144020667 17:11238611-11238633 ATACAGGTAAAAAATGATGAAGG - Intergenic
1144039321 17:11394714-11394736 AGACATATATAAAAGAATAACGG + Intronic
1146142033 17:30376771-30376793 ATGTAAATAAACAAGCATGAGGG - Intergenic
1146779044 17:35650252-35650274 AAAAATATAAAAAATCATCAGGG - Intronic
1147032681 17:37653055-37653077 AAATCTATAAAAAAGAATGAGGG + Intergenic
1147683023 17:42265982-42266004 ATATATATGACAAAGCATTATGG - Intronic
1148096537 17:45056457-45056479 ATATATATAAAAAAGAGTGCAGG - Intronic
1148138864 17:45314047-45314069 AGACATGTAGAAAAGCAAGAAGG + Intronic
1148375555 17:47142125-47142147 ATCTATATAAAAAACAATGAAGG + Intronic
1148950885 17:51311251-51311273 ATACAAACAAAAATGCATGCTGG - Intergenic
1151238333 17:72737983-72738005 ATAAAAATAAAAATGCATGCTGG - Intronic
1151516585 17:74600062-74600084 TTACATATAAGAAAGCAGGAAGG + Intergenic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1153946869 18:10026151-10026173 ATACACATGGAAATGCATGAAGG - Intergenic
1154151763 18:11911736-11911758 ACAGATATAATAAAGCATCACGG + Intergenic
1154931711 18:21004396-21004418 ATACATATAAAAGTGCATTGTGG - Intronic
1155375092 18:25148506-25148528 ATACTTAAAAGAAAGCAGGAAGG - Intronic
1155389952 18:25324821-25324843 AAACATAGAAGAATGCATGATGG + Intronic
1155481581 18:26294584-26294606 GTACATATAAAAATGCAAAAGGG - Intronic
1155626180 18:27837571-27837593 AGACTCATAAAAAAGCAAGATGG + Intergenic
1155728040 18:29114513-29114535 ATACATAAAAATAAGCAAGATGG + Intergenic
1155744874 18:29342447-29342469 ATACAAATTAAAAAGTATAAGGG - Intergenic
1156608454 18:38697413-38697435 ATAAAAATAAAAAAGAATGGTGG - Intergenic
1156625698 18:38905421-38905443 GTGCATATATAAAAGAATGAAGG - Intergenic
1156873166 18:41972202-41972224 ACAAATATGAACAAGCATGAAGG - Intronic
1157022303 18:43799306-43799328 ATACAAATAAAACTGCATGAAGG + Intergenic
1157838653 18:50933470-50933492 AGACATATAGGAAAACATGAGGG - Intronic
1158133796 18:54183445-54183467 ATTCAGAAAAAAAAGTATGAAGG + Intronic
1159251198 18:65879199-65879221 ATAAAAATATAAAACCATGAAGG - Intronic
1160198824 18:76779232-76779254 ATCCTTATAAAAAAGGTTGAAGG + Intergenic
1160365150 18:78318234-78318256 AGACATCAACAAAAGCATGAAGG - Intergenic
1160700413 19:504129-504151 ATCAATATAAAATAGTATGAAGG + Intronic
1161779472 19:6281421-6281443 ATACATGTACCAAAGCATCAAGG + Intergenic
1165614894 19:37191030-37191052 ATACATAAAAAAAAGTAAGATGG - Intronic
1166443280 19:42835040-42835062 GTAAATATAAAAGAGCATGCAGG - Intronic
1166550807 19:43664920-43664942 ATACATACAAACATGCAGGATGG + Intronic
1166617597 19:44264663-44264685 ATACATATAAAATAGTATGGGGG - Intronic
1166955841 19:46464274-46464296 ATAAAAATAAAAAAGCAAGGAGG - Intergenic
1168014955 19:53565508-53565530 ATAAAAATAAAAAAGGATAAAGG - Intronic
926328851 2:11808401-11808423 ATACAGATTCAAAAGTATGATGG - Intronic
926706327 2:15840316-15840338 ATAGATGTAGAAAAGAATGAGGG + Intergenic
926710906 2:15879759-15879781 GTACTTATAAAAAAGAATGAAGG + Intergenic
927304369 2:21553824-21553846 ATGCATGTAAAGAAGCATGCAGG - Intergenic
928718339 2:34089572-34089594 TAACCTATAAAAATGCATGAAGG + Intergenic
929472795 2:42212708-42212730 AAAGATATAGAAATGCATGAAGG - Intronic
929606968 2:43241079-43241101 AAACATAAAAAAAAGGAAGAGGG - Intronic
930132020 2:47861747-47861769 ATAGATACAAACAAGGATGACGG + Intronic
930600448 2:53436742-53436764 ATACATATTAAAATGAAGGATGG - Intergenic
930643870 2:53883045-53883067 ATACATATAAGAAAGGTTAATGG + Intronic
931170294 2:59796211-59796233 CTAGATATAAAAAAACAGGAGGG - Intergenic
932676701 2:73787893-73787915 TCACATATAAAAGAGCAGGATGG + Intronic
932677286 2:73792790-73792812 TCACATATAAAAGAGCAGGATGG + Intronic
932677871 2:73797688-73797710 TCACATATAAAAGAGCAGGATGG + Intronic
932678457 2:73802588-73802610 TCACATATAAAAGAGCAGGATGG + Intronic
932679041 2:73807488-73807510 TCACATATAAAAGAGCAGGATGG + Intronic
933056594 2:77677823-77677845 ACACATATAAAAATGATTGATGG - Intergenic
933518998 2:83347455-83347477 ATATAAATAAAAGAGCAGGAGGG + Intergenic
933926670 2:87098627-87098649 ACACATATAAAAATGATTGATGG - Intergenic
934636635 2:95995320-95995342 ATGCTTAGAAAAAGGCATGATGG + Intergenic
936276627 2:111103323-111103345 ATAAAAATAAAAAAGCATGTAGG + Intronic
936498478 2:113045333-113045355 ATACATAAAAAGAAGGATGACGG - Intronic
936498681 2:113047965-113047987 ACACATAGAAAACAGCAAGATGG + Intronic
936594563 2:113835535-113835557 ATACATATATCAAAACATCAAGG - Intergenic
936763739 2:115818433-115818455 GTACACATAAATAAGCATAAAGG + Intronic
937543402 2:122987091-122987113 ATAAATAAATGAAAGCATGATGG + Intergenic
937544624 2:123002136-123002158 ACCCATAGAATAAAGCATGATGG - Intergenic
937601106 2:123733903-123733925 ATCCGTATAAAAAAGAATGAAGG - Intergenic
937758389 2:125568942-125568964 ATATATATGAAACAGCATTATGG + Intergenic
937918397 2:127112343-127112365 GTAAATATCAAGAAGCATGATGG + Intergenic
938760154 2:134417904-134417926 ATGCATTTAAAAAATCATGAGGG - Intronic
939130077 2:138224802-138224824 TTACATAAAAAGAGGCATGATGG - Intergenic
939745642 2:145963135-145963157 ATACATAAAGAAAACCAAGAGGG + Intergenic
939779694 2:146430591-146430613 ATGCATCTAAAAAATCAAGAGGG + Intergenic
940018067 2:149127588-149127610 ATACATATATACAAGGAAGAGGG - Intronic
940683147 2:156811457-156811479 ATAGAAATACAAAGGCATGAGGG + Intergenic
940692604 2:156937936-156937958 ATACAAAAAAAAACCCATGAGGG + Intergenic
940702703 2:157065747-157065769 ATAAGTATAAAATAGGATGATGG + Intergenic
940939891 2:159547403-159547425 ATACACAGAAAAAACCATGGAGG - Intronic
940947074 2:159629844-159629866 ATAAAAATTAAAAAGTATGAGGG + Intergenic
941008692 2:160273272-160273294 ACACAAACAAAAAAGCATGAAGG - Exonic
942180523 2:173376346-173376368 ATTCATATGCAAAAGAATGAAGG - Intergenic
942452222 2:176115628-176115650 ATACATATTAAGAAGAATCAGGG - Intronic
942823009 2:180138739-180138761 AAACAGATTTAAAAGCATGAGGG + Intergenic
942924910 2:181420191-181420213 ATACGTATAACACAGCATGAGGG + Intergenic
942927044 2:181446411-181446433 ATACCTATATTAAAGCATCAGGG + Intergenic
943052566 2:182933979-182934001 ATATATATAAAACAGCAGGTTGG - Intronic
943138419 2:183945826-183945848 ATATATATATAAAAGCAGGAGGG + Intergenic
943924538 2:193756618-193756640 ATAATTATAAAAAAGCTTGAAGG - Intergenic
944237978 2:197457500-197457522 GAAAATATAAAAAAGCAAGATGG - Intronic
944556621 2:200893766-200893788 ATAAATATAAAAAAGCACTTGGG - Intronic
944665042 2:201952714-201952736 ATACATACAAAAAAGCAGAGAGG + Intergenic
944825566 2:203479662-203479684 TTACATATAAAACAGTATGACGG + Intronic
946149974 2:217757777-217757799 ATACAGATATAAATGCATGAAGG + Intergenic
946710809 2:222503553-222503575 ATACTGAAAAAAAAGCATGATGG - Intronic
946894040 2:224304851-224304873 TTAAATATAAAAAACAATGATGG - Intergenic
947165119 2:227253897-227253919 ATACTTAAAAAAAAGCTTGCAGG + Intronic
947417719 2:229915340-229915362 ATACATTTTAAAAAGAATTAGGG - Intronic
947452097 2:230217917-230217939 AAGCATAAATAAAAGCATGAGGG + Intronic
949069034 2:242012400-242012422 AAACAAATAAAAAAGAAAGATGG - Intergenic
1168838274 20:892293-892315 ACACATACAAAAAAGCATAGAGG + Intronic
1169115234 20:3060133-3060155 ATAAATAAATAAAAGCATGCAGG - Intergenic
1169400003 20:5271751-5271773 ACCCTTATAAAAAAGCTTGAAGG - Intergenic
1169405817 20:5320278-5320300 ATACATATTAAAAAGCCTTGAGG + Intergenic
1169764608 20:9135570-9135592 ATACCTATAAAAAATCAAGGTGG - Intronic
1169823232 20:9737091-9737113 AGACAAAAAAAAAAGCCTGATGG + Intronic
1170285279 20:14701392-14701414 ATACTTCTAAAAAAGGATGCTGG + Intronic
1170390912 20:15873671-15873693 AAATATATAAAAAAGAAAGAAGG + Intronic
1172802127 20:37583192-37583214 ATAAATAAAAATAAACATGATGG + Intergenic
1173845306 20:46184543-46184565 ACACAAATAAAAAAGTATGTTGG - Intronic
1176999257 21:15591643-15591665 ATAGAGAGAAAGAAGCATGAAGG - Intergenic
1177502555 21:21976752-21976774 AAACATATAAAAGAGACTGATGG + Intergenic
1177628585 21:23698459-23698481 ATATATATAAAAAAACAGAATGG + Intergenic
1177924571 21:27198016-27198038 ATACAAATAAGAAAGCATACAGG - Intergenic
1177934209 21:27321818-27321840 ATACATCTAATAATGCATTATGG + Intergenic
1178136404 21:29632756-29632778 ATATTTATAAAATAGCATCAGGG - Intronic
1178739083 21:35180187-35180209 TTACATAGGAAAAAACATGAAGG + Intronic
1179027209 21:37689308-37689330 ATACATACTAAAAAGTCTGATGG + Intronic
1180658585 22:17445952-17445974 ATACAAATAAAAAACCAACATGG - Intronic
1180846783 22:18987316-18987338 ATACATATAAATAAGTAGGCTGG + Intergenic
1182704484 22:32268125-32268147 ATACATATATAAAAGACTCAGGG - Intergenic
1184025788 22:41855187-41855209 TTACATAGAAAAAAGAATGCAGG + Intronic
950141323 3:10618018-10618040 ATATATAGATAAAAGCAGGAAGG + Intronic
950458692 3:13108019-13108041 AAAATTATAAAAAAGCATAAAGG + Intergenic
950694230 3:14685305-14685327 GTACAAGTATAAAAGCATGAAGG + Intronic
950932443 3:16804088-16804110 AAAGATATAAACAAGTATGATGG + Intronic
950974331 3:17225140-17225162 ATACATATAAAATAACAGGCCGG + Intronic
950995903 3:17495276-17495298 ATACAAATAAAAAAGGAAGCAGG - Intronic
951104756 3:18729946-18729968 ATATAGATACATAAGCATGAAGG - Intergenic
951206023 3:19926654-19926676 ATAAAAATAAAAAAGCAGGCTGG - Intronic
951257416 3:20466434-20466456 ATACATACACATAAGCATGCAGG - Intergenic
952572021 3:34729255-34729277 AAAAAAAAAAAAAAGCATGAAGG + Intergenic
953572781 3:44084930-44084952 ATACTTTTAAAAAATCATCAAGG + Intergenic
953886796 3:46718566-46718588 ATACATTTAAAAAGTCATGTGGG + Intronic
953898030 3:46818149-46818171 ATACATGTAAACATGAATGACGG - Intergenic
954955372 3:54513971-54513993 GTGCATATAAACAGGCATGACGG - Intronic
956420412 3:69080966-69080988 ATACAAAGAAAAAAGTATAAAGG + Intergenic
956730360 3:72190831-72190853 ACACAAAAAAAAAAGGATGAGGG - Intergenic
956853000 3:73248643-73248665 TTTCATATAAAAAAGCCTGTTGG + Intergenic
957449648 3:80362494-80362516 AAAAACATAAAAAAGAATGAAGG - Intergenic
958189605 3:90168287-90168309 ATACAGATTAAAAAACATTATGG + Intergenic
958858596 3:99417856-99417878 ATACAAAAAAAATAGCATGAAGG + Intergenic
959055938 3:101567796-101567818 ATAAATATACAAAACCATGGGGG - Intergenic
959133007 3:102381452-102381474 ACAAATAAAAAAAAGAATGAAGG - Intronic
960380012 3:116948371-116948393 ATAAATAGAAAAAAAAATGAGGG - Intronic
960855482 3:122098206-122098228 ATAAATATAAGTCAGCATGAGGG + Intronic
960874097 3:122279783-122279805 ATACAATGAAAAAAGAATGATGG - Intronic
960902352 3:122565110-122565132 ATTCATAAAAAAAGGCAGGAAGG - Intronic
962106077 3:132390980-132391002 ATAGATTGAAAAAAACATGAGGG - Intergenic
963299414 3:143582035-143582057 ATAAAGAAAGAAAAGCATGAAGG + Intronic
963531077 3:146474087-146474109 ATACATATACAAAAGTAAGCAGG - Intronic
963639299 3:147838788-147838810 ATACTTCTAAGAAAGCATGATGG + Intergenic
963727081 3:148934784-148934806 CTAAATGTAAAAGAGCATGAGGG - Intergenic
964302671 3:155306459-155306481 ATCCATATAAAAAAGTATGATGG - Intergenic
964331848 3:155611404-155611426 ATACAAATAAAAAAACAAAAAGG + Intronic
965216693 3:165873243-165873265 ATAAAAATAAAAAACAATGAAGG - Intergenic
965493398 3:169367502-169367524 ATAAATATTTAAAAGCAAGAAGG + Intronic
965718371 3:171631850-171631872 ATAAATATAGAAAAAAATGATGG + Intronic
965767192 3:172143329-172143351 TTACCTGTAAAAATGCATGAGGG + Intronic
965972898 3:174584932-174584954 AGATTTATAAAAGAGCATGAGGG - Intronic
966316273 3:178649719-178649741 ATACAAATAAAAAATGATAAAGG - Intronic
966407890 3:179617953-179617975 ATTCAGATAATAAAACATGATGG - Intronic
966709948 3:182961500-182961522 ATAAATATAAACACGCATGGGGG + Intronic
967554953 3:190845924-190845946 TTACATATAATAAAGAATGTTGG + Intergenic
967692988 3:192498463-192498485 TTACAGATAAAAATGCATGTAGG + Intronic
967693002 3:192498618-192498640 TTACAGATAAAAATGCATGTAGG + Intronic
968243562 3:197116946-197116968 ATACATATTTTAAAGCATAATGG - Intronic
968526944 4:1064223-1064245 ATACATATGACAAAGCAGGTGGG + Intronic
969266321 4:6066444-6066466 ATGCATATTAAAAAGCAAGGAGG - Intronic
969555965 4:7910423-7910445 ATAGAAATAAAAAAACATTAAGG + Intronic
969980820 4:11152130-11152152 ATACAGATTAAAAAGCAAGTTGG - Intergenic
970098576 4:12493425-12493447 ATAAATAAAAGAATGCATGAAGG + Intergenic
970320414 4:14870025-14870047 AGAAATATTAAAAAGCATAAAGG - Intergenic
970403318 4:15738587-15738609 ATAAAAATAAAAAACCTTGATGG + Intergenic
970874053 4:20849101-20849123 ATACAAATAAACATGCATAAAGG - Intronic
971673275 4:29592115-29592137 AAACATATAAATAAGAATGAGGG + Intergenic
971700145 4:29962128-29962150 ATTCAAACAGAAAAGCATGATGG + Intergenic
971845970 4:31917813-31917835 GGACATATGAAGAAGCATGATGG - Intergenic
971967448 4:33578686-33578708 TTACATAGAAAATAGAATGAAGG - Intergenic
972443649 4:39121622-39121644 ATAAATAAAGAAAAGCATTAAGG + Intronic
972674854 4:41250336-41250358 ATTTATATAAGAAAGCATGCTGG - Intergenic
972802646 4:42493503-42493525 ACACATATCAAAAAGTATTATGG + Intronic
973261933 4:48173834-48173856 ACTCATCTAGAAAAGCATGAAGG + Intronic
974296530 4:60006974-60006996 ATACATGTAAAAATACATGTAGG + Intergenic
974348745 4:60716828-60716850 TTACATATGAAAAGGCAAGATGG + Intergenic
975776243 4:77790417-77790439 GTAAATACCAAAAAGCATGATGG + Intronic
976143237 4:82015124-82015146 ATACATATAAAGAAGCAAGAAGG + Intronic
976253404 4:83076390-83076412 ATATATATAAAAAAGTAAAATGG + Intergenic
976278784 4:83306384-83306406 ATACATAAATAAAATCAAGATGG - Intronic
976441687 4:85083104-85083126 ATACGTATAAAAAAATAGGAAGG - Intergenic
976502955 4:85813525-85813547 ATACATATGAAAAAGACTGTAGG - Intronic
976528520 4:86121633-86121655 ATACATATATCAAAATATGATGG - Intronic
976800247 4:88982366-88982388 ATACATTTAAAATTGCATTAAGG - Intronic
976840347 4:89425625-89425647 ATAAATAAAAAAAGACATGAAGG + Intergenic
977116008 4:93029923-93029945 ATGCAAATAAAACTGCATGAGGG + Intronic
977149915 4:93498324-93498346 TTCCTTATAAAAAAGCTTGATGG - Intronic
977200209 4:94106316-94106338 ATACATATGAAAAAACATACAGG + Intergenic
977398811 4:96505524-96505546 TTGCACATAAAAAAGCATTAAGG + Intergenic
977735873 4:100414884-100414906 ATAGATATAAAAAACCATGTGGG - Intronic
977876953 4:102161500-102161522 AGACATACAAAAATGCATAATGG + Intergenic
977967761 4:103173921-103173943 ATATATAGAAAACAGTATGACGG + Intronic
978437878 4:108705154-108705176 ATATATATAAAACAGCATGACGG - Intergenic
978581904 4:110240046-110240068 ATACATATAGAAAAGAATGATGG - Intergenic
978835066 4:113139429-113139451 ATTAAAATAAAAAAGCAAGATGG - Intronic
979176839 4:117675748-117675770 ATAGATATAAAACAAAATGAAGG + Intergenic
980309919 4:131113422-131113444 ATACATTTTTGAAAGCATGAAGG + Intergenic
980364292 4:131779210-131779232 ATACATATTAAATATCATGAAGG + Intergenic
980718351 4:136658523-136658545 AAAAAAAAAAAAAAGCATGAAGG - Intergenic
981480159 4:145230129-145230151 ATACATAAAAAAAAAAAAGAAGG + Intergenic
981983599 4:150827336-150827358 AGACAAATAAAAAAGCAAAAAGG + Intronic
982272986 4:153610382-153610404 ATAAATAAAATAAAGCATCATGG - Intronic
982324186 4:154112071-154112093 AGACATATAAAAAATGATGAAGG + Intergenic
982685731 4:158486571-158486593 AGACATACAAAAAAGAAAGATGG - Intronic
982808143 4:159791827-159791849 ATACATAAAATAAAGCTTGGAGG + Intergenic
983246036 4:165288197-165288219 ATCCACATAGAAAAGAATGAAGG - Intronic
983283516 4:165710556-165710578 ATACAGATACAGGAGCATGAAGG - Intergenic
984101061 4:175486674-175486696 ATTCATATATAAAAACATTAAGG - Intergenic
984260940 4:177443059-177443081 ATACATTTAAAAAGGAATGGAGG - Intergenic
984739563 4:183147215-183147237 ATACATATATATAAGCATCTGGG - Intronic
984863710 4:184262667-184262689 ATATATAGAAAAAAGCTGGAGGG + Intergenic
985869963 5:2546460-2546482 ACACAGATGAAAATGCATGAAGG + Intergenic
986211904 5:5681954-5681976 TTACATATAATAAAACATTAAGG - Intergenic
986852988 5:11834507-11834529 ATACATGTAACAAAACATCATGG + Intronic
986972127 5:13349203-13349225 ATACATATAAAGAAATATTAAGG - Intergenic
987047465 5:14121321-14121343 ATAAAAATAAAAAAGCATATAGG - Intergenic
987515704 5:18905182-18905204 ATACTTAAAAATAAGCATTATGG - Intergenic
987593668 5:19967573-19967595 ATACTTATATAAAATCATGTTGG + Intronic
987632248 5:20489474-20489496 TTACAAAGAAAAAAGTATGAAGG - Intronic
987804649 5:22748295-22748317 TTACATATAAAAGAACTTGATGG + Intronic
987832472 5:23113840-23113862 ATTCATTTAAAAAATCATGTTGG - Intergenic
988127579 5:27061397-27061419 ATATATACAGAAAATCATGAGGG - Intronic
988728857 5:33950201-33950223 AAAAACAAAAAAAAGCATGAGGG + Intronic
989189549 5:38657068-38657090 CTACATAAAAATAAGCATGCTGG + Intergenic
989205797 5:38807755-38807777 ATTCTGATAAAAAAGCATCATGG - Intergenic
989606906 5:43253141-43253163 ATATATATATAAAGGAATGAAGG - Intronic
989953465 5:50329417-50329439 ATAAATAAAAATAAGGATGATGG - Intergenic
990045703 5:51428257-51428279 TTACATATATAAAAATATGATGG - Intergenic
990122009 5:52466413-52466435 ATACAAATATAAAACCGTGAAGG + Intergenic
990344470 5:54857841-54857863 ATACATGTGAAAAATCATAAAGG + Intergenic
991052012 5:62283142-62283164 ATACTCATAATAAAACATGAAGG - Intergenic
991173477 5:63656819-63656841 ATACATGAAAAATACCATGATGG - Intergenic
991181556 5:63757186-63757208 AGAAATACAAGAAAGCATGAAGG + Intergenic
991341476 5:65615467-65615489 ATAAATATATAAAAGGTTGATGG + Intronic
991473223 5:66991879-66991901 ACACACAGAAAAAAGCAGGAAGG - Intronic
991608260 5:68424729-68424751 ATACACATAATACAGCATAAAGG - Intergenic
991698199 5:69293297-69293319 ATTCATTAAGAAAAGCATGAGGG - Intronic
992255019 5:74912507-74912529 ATACGTACAACAAAGCATTAAGG - Intergenic
992382408 5:76251172-76251194 ACACATAAAACAAAGCATCACGG + Intronic
992552950 5:77876476-77876498 ATACATTTAGAAAATCATGATGG + Intergenic
993254003 5:85564391-85564413 GTAAATATAACAAAGCATAAAGG - Intergenic
993580713 5:89657441-89657463 ATACATACAAAAAAGAATGCTGG - Intergenic
993707118 5:91183606-91183628 AAAAATAGAAAAAAACATGAAGG - Intergenic
994383897 5:99104967-99104989 ATACAGATACAAAAGAATGAGGG + Intergenic
994760720 5:103849453-103849475 ACACATATTAAGAAGCATGCTGG + Intergenic
994785606 5:104157777-104157799 ATACATATATAAAAGCAATTTGG + Intergenic
995138734 5:108708673-108708695 ATACATAGAAAAATTCAAGAAGG + Intergenic
995253061 5:110016422-110016444 ATATATATAAAATAAAATGAGGG + Intergenic
995403222 5:111764835-111764857 ACACATATAAAGAATTATGAAGG + Intronic
995579440 5:113580117-113580139 ATCCTTATAAAAGAGCTTGATGG - Intronic
995626380 5:114081569-114081591 ATCCATATGCAAAAGAATGACGG + Intergenic
997052935 5:130403970-130403992 ATATATATATAAAATGATGATGG - Intergenic
997066866 5:130570814-130570836 AAACTTATAAAAAAGCAAGAGGG - Intergenic
997991135 5:138545093-138545115 ATACAAATGAAAGCGCATGACGG - Intergenic
998455244 5:142267222-142267244 AAACATTTAAAGAAGCATGTTGG - Intergenic
998866824 5:146513723-146513745 ATACAAAATAAAAAGCATAAGGG - Exonic
998881507 5:146649837-146649859 ATTAATATAAAGAGGCATGATGG + Intronic
998907016 5:146916431-146916453 AGACAGATAAAGAAGAATGAAGG - Intronic
998963758 5:147515161-147515183 AAAAATATAGAAATGCATGAAGG - Intergenic
999047581 5:148485757-148485779 ATAAACATAATAAAGAATGAGGG + Intronic
999844864 5:155468491-155468513 ATACACTCAAAATAGCATGAAGG - Intergenic
999854854 5:155583104-155583126 ATAAATAGAAAAAAGGATCATGG + Intergenic
1000092904 5:157945808-157945830 AAATATATAAAAAAGAAGGAAGG - Intergenic
1000101308 5:158019660-158019682 ATACTTAAAAAAAACAATGAGGG - Intergenic
1000200266 5:159002665-159002687 ATATATATAGAAAAGGAGGAAGG + Intronic
1000278099 5:159757177-159757199 ATACATCTAGAAATGCAAGAGGG - Intergenic
1000299465 5:159942770-159942792 ATACATAGAAAAAAACTGGAAGG + Intronic
1000355998 5:160396448-160396470 GTCCATATAAAAAAGCAAAATGG + Intronic
1001501816 5:172242750-172242772 ATAGATATACTAAAGCATCATGG - Intronic
1001519051 5:172377718-172377740 ATACATATACTCCAGCATGATGG + Intronic
1002502274 5:179654739-179654761 AAACGAACAAAAAAGCATGAAGG - Intergenic
1003067690 6:2917746-2917768 TTACACATAAAAAAGCAAGGTGG + Intergenic
1004113557 6:12745512-12745534 ACACATATAAACAATCATGTGGG + Intronic
1004226933 6:13794082-13794104 ACACATATAAAGAAGCAGGTAGG - Intronic
1004322228 6:14640859-14640881 AGACATATAAATAAGGGTGATGG - Intergenic
1004401883 6:15296386-15296408 GAACAAATAAAAAAGTATGAAGG - Intronic
1004933525 6:20485143-20485165 GTACATATAAAAAATAATAACGG + Intronic
1005117019 6:22350369-22350391 ATAAATATAAGAAAGCAAGATGG - Intergenic
1005388643 6:25311194-25311216 AAACACAAAAAAAACCATGACGG + Intronic
1005410194 6:25537031-25537053 ACTTATACAAAAAAGCATGAAGG - Intronic
1005755085 6:28918985-28919007 ATAAAAATAAAAATGGATGATGG - Intronic
1005888481 6:30116054-30116076 ATAGAAATAAAAAAGAATCAGGG + Intergenic
1006117604 6:31783518-31783540 ATAAATAAATAAAAGCATGAAGG + Intronic
1006757821 6:36432113-36432135 ATAGATATAATATATCATGAGGG + Intronic
1007423209 6:41732019-41732041 ATAAAAATAAAAAAGCAGGGTGG - Intronic
1007763475 6:44147819-44147841 ATACATATAAAGAAGCTTAGAGG + Intronic
1008309261 6:49945648-49945670 ACAAATACAAAAAAACATGAAGG + Intergenic
1008529278 6:52440475-52440497 ATACATATACATATACATGAAGG - Intronic
1008935231 6:56984771-56984793 ATACAAAACAAAAAGCTTGAAGG + Intronic
1009053511 6:58307364-58307386 ATCCATTTAAAAAATTATGATGG + Intergenic
1009237604 6:61143181-61143203 ATCCATTTAAAAAATTATGATGG - Intergenic
1009595781 6:65734102-65734124 ATAGATTTAGAAAAGTATGAAGG + Intergenic
1009983819 6:70758537-70758559 ATAAAAATAAAAACACATGAAGG + Intronic
1010283907 6:74052422-74052444 CTACATATAAAAAAGTGTGCAGG - Intergenic
1010785879 6:80000442-80000464 ATACATTTAAAAAAAAATTATGG + Intergenic
1011275223 6:85624624-85624646 ATGCATATAACAAATTATGAAGG + Intronic
1011309955 6:85970815-85970837 CTAAATCTAAAAAGGCATGATGG - Intergenic
1011499403 6:87971281-87971303 ATACAAACAAATAATCATGAAGG - Intergenic
1011732801 6:90283366-90283388 AGAAAAAAAAAAAAGCATGAGGG - Intronic
1012426924 6:99124889-99124911 ATATATATAAAAAAAAATGGGGG + Intergenic
1012585656 6:100919119-100919141 AAACAAATAAAAAACCATGAGGG - Intergenic
1013255985 6:108386117-108386139 ATAAATAAATAAAAGAATGAAGG + Intronic
1013500389 6:110743642-110743664 CTACAAAAAAAAAAGAATGAAGG + Intronic
1013501726 6:110758958-110758980 ATACTTAAAAAAAAAAATGATGG + Intronic
1013602256 6:111715864-111715886 ACATAAACAAAAAAGCATGAAGG + Intronic
1014127343 6:117792136-117792158 ACAAATATCAAAAAACATGATGG + Intergenic
1014733286 6:125060194-125060216 ATAAATATAAAATAGGAAGATGG + Intronic
1014766336 6:125410696-125410718 ATAAAAATAAAAAAGAAAGATGG + Intergenic
1015094251 6:129395834-129395856 AAACATATACAAAGGCATGGAGG + Intronic
1015208403 6:130667826-130667848 ATACACAAAAAAAAGAAGGAAGG + Intergenic
1015867618 6:137742937-137742959 ATACATTTAAAAAATAATCATGG - Intergenic
1016546069 6:145225872-145225894 ATGCATATAATAAACCACGAAGG - Intergenic
1016635604 6:146286281-146286303 ATACATATAAAAATACAAAATGG + Intronic
1016954375 6:149612205-149612227 AAACATTTAAAAAAGAATTAAGG + Intronic
1017121266 6:151026225-151026247 ATGAATTTAATAAAGCATGAAGG + Intronic
1017394830 6:153986106-153986128 ATACAGATAAAAATGCATGAAGG - Intergenic
1017798096 6:157865689-157865711 ATACATAAAAAATAGTAAGATGG - Intronic
1018304053 6:162435918-162435940 ATACAAACAAAAAATCATGGTGG + Intronic
1019272005 7:155292-155314 ATACTTATAGAAAAGCCAGAGGG + Intergenic
1021211141 7:17854053-17854075 GTACCTACAAAAAAGAATGAAGG + Intronic
1021269530 7:18568492-18568514 AAAAATATAAATAAGAATGATGG - Intronic
1022280684 7:28906184-28906206 ATACATAGAAAAATTCAGGAAGG + Intergenic
1022319278 7:29273318-29273340 ATATATATATATATGCATGATGG - Intronic
1022484066 7:30764463-30764485 AAACATATAACCATGCATGAAGG + Intronic
1022578632 7:31524695-31524717 AAACATATAAAAAAGCTTATGGG - Intronic
1022881537 7:34592862-34592884 ATAAATATAAGAAAACATGAAGG - Intergenic
1023278980 7:38550531-38550553 ATAATTTTAAAAAAGAATGAGGG - Intronic
1023398706 7:39775323-39775345 ATAAATATAGCCAAGCATGATGG + Intergenic
1024663651 7:51523159-51523181 ATATGCATAAAAAAGCATCATGG + Intergenic
1024819252 7:53307768-53307790 AAACATATACAAAAGCTTGTAGG + Intergenic
1025217776 7:57073264-57073286 ATACATATCAAACTGCAAGATGG - Intergenic
1025628690 7:63246902-63246924 ATACATATCAAACTGCAAGATGG - Intergenic
1025653575 7:63497198-63497220 ATACATATCAAACTGCAAGATGG + Intergenic
1026769432 7:73185473-73185495 ATACATATGAATAAACATTAAGG - Intergenic
1027010301 7:74738857-74738879 ATACATATGAATAAACATTAAGG - Intronic
1027077741 7:75207180-75207202 ATACATATGAATAAACATTAAGG + Intergenic
1027159073 7:75789243-75789265 ATACATATAGAAAAGTACGCAGG - Intronic
1028254259 7:88573635-88573657 ATACAAATAGATAAGCATAATGG - Intergenic
1029914430 7:104192645-104192667 AGACACATGAAAAAGCATAATGG + Intronic
1030387837 7:108887554-108887576 ATAAATATACATAAACATGATGG - Intergenic
1031418333 7:121519723-121519745 TTACAGATAAGAAAGCCTGAGGG - Intergenic
1031433338 7:121701018-121701040 AAACTTAAAAAAAAGCTTGAAGG - Intergenic
1031699809 7:124910089-124910111 ACACATATAAAAAACCTGGAAGG + Intronic
1031765787 7:125775188-125775210 GTACATAGAAAAAAACATTAAGG + Intergenic
1031772996 7:125869550-125869572 TTAAATATAATAAAGCATGCAGG + Intergenic
1032372527 7:131372198-131372220 ATACATGTTATAAAGCATGAAGG - Intronic
1032629379 7:133631029-133631051 GTACATTTAAAAAAGGTTGATGG + Intronic
1032648385 7:133851246-133851268 AAACACATAAATAAGCAAGATGG + Intronic
1032880229 7:136082398-136082420 ATACATATCCAAATGCTTGAAGG - Intergenic
1033118523 7:138647073-138647095 ATACATATTTAAGAGGATGATGG + Intronic
1033187051 7:139237280-139237302 ATAAAAATAAAAATGAATGATGG - Intronic
1033412688 7:141133548-141133570 ATAAAAATAAAAAAGAATAAAGG + Intronic
1033940408 7:146645469-146645491 ATACATATTATAGAACATGACGG - Intronic
1033994624 7:147330315-147330337 ATGCATAGGAAAAGGCATGATGG - Intronic
1035485758 7:159224572-159224594 ATACAAATTTAAGAGCATGATGG + Intergenic
1035598002 8:876112-876134 ATACATATGAAAAAGCTTGGTGG - Intergenic
1037018817 8:13942814-13942836 ATACAAATAAAATACCATAAAGG - Intergenic
1038907290 8:31919355-31919377 ATACAATAAAAAAAGCAAGAAGG + Intronic
1038980488 8:32754169-32754191 ATAAATATAAAAAAGCCAGCTGG - Intronic
1040040215 8:42908978-42909000 CTGAATTTAAAAAAGCATGAAGG + Intronic
1040849317 8:51882241-51882263 GTACACACAAAAAAGCATGAGGG + Intronic
1040948367 8:52909565-52909587 ATAAATTTAAAAAATCATGAAGG + Intergenic
1041834859 8:62200101-62200123 ATAAATAAATAAAAGCATAAAGG + Intergenic
1041962757 8:63637629-63637651 AAAAATAAAAAAAAGCATTATGG - Intergenic
1042758814 8:72249307-72249329 AAACATATATAATACCATGAAGG - Intergenic
1043110773 8:76178251-76178273 ATAGGTATAAAAAAGCAATATGG - Intergenic
1043400224 8:79877303-79877325 TCACAAATTAAAAAGCATGATGG - Intergenic
1043411564 8:80003205-80003227 ATACATATAACTCAACATGAAGG + Intronic
1043709053 8:83391515-83391537 ATACATACAAAAAAGAAGCAAGG - Intergenic
1043709775 8:83402398-83402420 TTAACTATAAAATAGCATGATGG + Intergenic
1043729644 8:83659482-83659504 ATAAACATATAAAAGCATTAGGG + Intergenic
1044519544 8:93182852-93182874 ATACATATAATAAATCATTTTGG + Intergenic
1044530392 8:93300679-93300701 CAAAAAATAAAAAAGCATGATGG + Intergenic
1045860603 8:106811588-106811610 AAACAGAGAGAAAAGCATGAAGG - Intergenic
1045930961 8:107625982-107626004 ATAAAAATAAAAAAGAAAGAAGG + Intergenic
1046262851 8:111792900-111792922 TTATATATTAAATAGCATGATGG - Intergenic
1047253803 8:123200655-123200677 AAAAATATAAAAAATCAGGAGGG + Intronic
1047288570 8:123509116-123509138 ATTAATATAATAAAGAATGAAGG - Intronic
1047825309 8:128567264-128567286 ACTCAAATAAACAAGCATGAAGG + Intergenic
1049366572 8:142239975-142239997 ATACAGATCAAAAAGTAAGAAGG + Intronic
1050108617 9:2191673-2191695 ATATTTATAAGAAAGCATGTGGG - Intronic
1050200625 9:3141891-3141913 AAACATATATAAAAAGATGAGGG + Intergenic
1050541064 9:6670702-6670724 GTACAGAAGAAAAAGCATGAAGG - Intergenic
1052024479 9:23559272-23559294 CAAAATAGAAAAAAGCATGAAGG + Intergenic
1052024497 9:23559478-23559500 AGACAAATATAATAGCATGAGGG - Intergenic
1052043692 9:23770218-23770240 ATACATATAGAGAAGAATAAGGG + Intronic
1052286566 9:26792659-26792681 AAACAAACAAAAAAGCCTGAGGG - Intergenic
1052690910 9:31815851-31815873 ATACAAATAATAAGGCTTGAAGG - Intergenic
1053527301 9:38843076-38843098 ATACAAAGGGAAAAGCATGATGG + Intergenic
1053628646 9:39905097-39905119 ATACATATTAAATATCATGAAGG + Intergenic
1053777421 9:41561243-41561265 ATACATATTAAATATCATGAAGG - Intergenic
1054199524 9:62067507-62067529 ATACAAAGGGAAAAGCATGATGG + Intergenic
1054215241 9:62345605-62345627 ATACATATTAAATATCATGAAGG - Intergenic
1054638831 9:67520850-67520872 ATACAAAGGGAAAAGCATGATGG - Intergenic
1054672239 9:67809744-67809766 ATACATATTAAATATCATGAAGG + Intergenic
1054728870 9:68680147-68680169 ATAAAGATAAAAAAGCGGGAAGG - Intergenic
1055042883 9:71894302-71894324 ATACATATAAAACTGGATTAAGG + Intronic
1055349801 9:75374780-75374802 ATACAGATAAGAAATAATGAGGG - Intergenic
1055385586 9:75758734-75758756 TTACATATGAAAAATCTTGAAGG + Intergenic
1055688462 9:78804194-78804216 GTACATAAAAAAGAGCATGTTGG - Intergenic
1055995194 9:82149767-82149789 AGACAGAAAAAAAAGCAGGAGGG - Intergenic
1056197605 9:84243510-84243532 ATACAAATAAAATAGGAAGAAGG - Intergenic
1056479753 9:86989452-86989474 ATACAGATGAAAGAGCATGGTGG - Intergenic
1057470645 9:95352986-95353008 ATACACCTAAGAAATCATGAGGG + Intergenic
1057682477 9:97202176-97202198 ATAGATATAAAAAAACAGGTAGG + Intergenic
1058065465 9:100544077-100544099 ATATATATATATCAGCATGAAGG - Intronic
1058512914 9:105739059-105739081 ATCCACATACAAAAGAATGAAGG - Intronic
1058540958 9:106012134-106012156 ATACCTAACAAACAGCATGAAGG + Intergenic
1058587820 9:106529670-106529692 ATACACTGACAAAAGCATGAAGG + Intergenic
1185922062 X:4104296-4104318 ATAAAAATGAAAAAGAATGAAGG + Intergenic
1186053490 X:5624962-5624984 ATACATATTTAAAAACATCATGG - Intergenic
1186494857 X:10004508-10004530 ATATATTTTAAAATGCATGAAGG - Intergenic
1186936511 X:14456462-14456484 ATACATACAAAACAGCTAGATGG - Intergenic
1186946342 X:14572327-14572349 ATAGATAGAAAAATGAATGATGG - Intronic
1186971742 X:14852739-14852761 ATACAAATAAAAAAGTTTAATGG + Intronic
1186992844 X:15088145-15088167 ATATAAACAAATAAGCATGATGG - Intergenic
1187178271 X:16916741-16916763 AAACATATAACAAGGCAAGAGGG + Intergenic
1187331567 X:18344983-18345005 ATACATATATAAAAGCCTTAGGG - Intronic
1187407620 X:19017948-19017970 ATACATAGAAAAAAACAGGGAGG - Intronic
1187519775 X:20003235-20003257 ATACATATAAAAAATAAAGCTGG + Intergenic
1187821150 X:23289749-23289771 ACACATACAAAAAAGCACAATGG + Intergenic
1188270433 X:28133118-28133140 ATCCAGATAAAAATGAATGATGG - Intergenic
1188316558 X:28681744-28681766 ATACATATATCAAAACATCAAGG + Intronic
1188549753 X:31350085-31350107 TTATATACACAAAAGCATGAGGG + Intronic
1188572243 X:31601877-31601899 ATAAAAAGAAAAAAGCATCAAGG + Intronic
1188854786 X:35180526-35180548 ATTCATATATAAAATAATGAAGG + Intergenic
1188992734 X:36842941-36842963 ATACATATAAAAAAGTTTGGGGG + Intergenic
1190395721 X:49980298-49980320 ATACTTTTAAAAAAGCATTTTGG - Intronic
1190514048 X:51204782-51204804 ATATATAAATAAAAGGATGATGG + Intergenic
1190520869 X:51278681-51278703 ATACATAGAGAAAAGTATGAAGG - Intergenic
1190718433 X:53125418-53125440 ACAGAAATAAAAAAGTATGATGG - Intergenic
1190930364 X:54943796-54943818 ATAAAAATAAAAAAGAAAGACGG + Intronic
1193079905 X:77396245-77396267 ATAGATATACACATGCATGATGG - Intergenic
1193139435 X:78010957-78010979 ATACATATTAACTAGCATTAAGG + Intronic
1193397709 X:81004582-81004604 AAAAATATAAAAAAACAAGAAGG - Intergenic
1193500817 X:82272568-82272590 ATAAAAATAAAGAATCATGAGGG + Intergenic
1194893033 X:99404227-99404249 ATACATTAAAAAAAGTAAGAAGG + Intergenic
1195790666 X:108581519-108581541 ATAACTAAAAAAGAGCATGAGGG - Intronic
1196560941 X:117147318-117147340 ATAATAATAAAAAAGAATGATGG + Intergenic
1196815175 X:119659863-119659885 ATAAAAATAAAAAAGGATGCTGG - Intronic
1197050530 X:122052705-122052727 ATACAAATAAAACAACATCAAGG - Intergenic
1197266225 X:124375241-124375263 ACACACATAAAAAAGCAGCAGGG + Intronic
1197309918 X:124892078-124892100 TGACATAGAATAAAGCATGATGG + Intronic
1197427964 X:126321878-126321900 ACACATATAAAAAAACTTGTCGG - Intergenic
1197546632 X:127833050-127833072 ATACATATATCAAAACATCATGG - Intergenic
1198143796 X:133833650-133833672 ACGCATATAACAAAGGATGAGGG + Intronic
1198740839 X:139840846-139840868 ATACAAAAAAAAAAGACTGAAGG + Intronic
1198887972 X:141360332-141360354 ATATATATCAAATTGCATGAAGG - Intergenic
1199340796 X:146675064-146675086 ATCAATAAAAAAAATCATGATGG - Intergenic
1201668350 Y:16486148-16486170 ATACATAGATAGATGCATGATGG - Intergenic
1202065621 Y:20936437-20936459 AAACATTTAAAAATGCATAAAGG + Intergenic
1202341937 Y:23878760-23878782 ATTCATATCAAAAAGTAGGAAGG - Intergenic
1202528831 Y:25791325-25791347 ATTCATATCAAAAAGTAGGAAGG + Intergenic