ID: 1117156820

View in Genome Browser
Species Human (GRCh38)
Location 14:52950635-52950657
Sequence GCCGGCGCTGCGAATTCGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 22
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 21}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117156820_1117156834 7 Left 1117156820 14:52950635-52950657 CCCACCGAATTCGCAGCGCCGGC 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1117156834 14:52950665-52950687 TGGGAGGTGGTGGAGGACCCGGG 0: 1
1: 0
2: 3
3: 68
4: 578
1117156820_1117156832 0 Left 1117156820 14:52950635-52950657 CCCACCGAATTCGCAGCGCCGGC 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1117156832 14:52950658-52950680 CACGGGCTGGGAGGTGGTGGAGG 0: 2
1: 1
2: 11
3: 82
4: 868
1117156820_1117156836 15 Left 1117156820 14:52950635-52950657 CCCACCGAATTCGCAGCGCCGGC 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1117156836 14:52950673-52950695 GGTGGAGGACCCGGGGCTTTCGG 0: 1
1: 0
2: 2
3: 24
4: 263
1117156820_1117156840 27 Left 1117156820 14:52950635-52950657 CCCACCGAATTCGCAGCGCCGGC 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1117156840 14:52950685-52950707 GGGGCTTTCGGCAGAAACTCGGG 0: 1
1: 0
2: 0
3: 6
4: 126
1117156820_1117156833 6 Left 1117156820 14:52950635-52950657 CCCACCGAATTCGCAGCGCCGGC 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1117156833 14:52950664-52950686 CTGGGAGGTGGTGGAGGACCCGG 0: 1
1: 0
2: 9
3: 87
4: 881
1117156820_1117156841 30 Left 1117156820 14:52950635-52950657 CCCACCGAATTCGCAGCGCCGGC 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1117156841 14:52950688-52950710 GCTTTCGGCAGAAACTCGGGAGG 0: 1
1: 0
2: 0
3: 0
4: 46
1117156820_1117156835 8 Left 1117156820 14:52950635-52950657 CCCACCGAATTCGCAGCGCCGGC 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1117156835 14:52950666-52950688 GGGAGGTGGTGGAGGACCCGGGG 0: 1
1: 0
2: 3
3: 51
4: 559
1117156820_1117156830 -3 Left 1117156820 14:52950635-52950657 CCCACCGAATTCGCAGCGCCGGC 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1117156830 14:52950655-52950677 GGCCACGGGCTGGGAGGTGGTGG 0: 1
1: 0
2: 13
3: 135
4: 2160
1117156820_1117156839 26 Left 1117156820 14:52950635-52950657 CCCACCGAATTCGCAGCGCCGGC 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1117156839 14:52950684-52950706 CGGGGCTTTCGGCAGAAACTCGG 0: 1
1: 0
2: 0
3: 5
4: 51
1117156820_1117156828 -6 Left 1117156820 14:52950635-52950657 CCCACCGAATTCGCAGCGCCGGC 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1117156828 14:52950652-52950674 GCCGGCCACGGGCTGGGAGGTGG 0: 1
1: 1
2: 2
3: 53
4: 591
1117156820_1117156827 -9 Left 1117156820 14:52950635-52950657 CCCACCGAATTCGCAGCGCCGGC 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1117156827 14:52950649-52950671 AGCGCCGGCCACGGGCTGGGAGG 0: 1
1: 0
2: 2
3: 17
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117156820 Original CRISPR GCCGGCGCTGCGAATTCGGT GGG (reversed) Intronic