ID: 1117156821

View in Genome Browser
Species Human (GRCh38)
Location 14:52950636-52950658
Sequence GGCCGGCGCTGCGAATTCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 28
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 26}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117156821_1117156833 5 Left 1117156821 14:52950636-52950658 CCACCGAATTCGCAGCGCCGGCC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1117156833 14:52950664-52950686 CTGGGAGGTGGTGGAGGACCCGG 0: 1
1: 0
2: 9
3: 87
4: 881
1117156821_1117156834 6 Left 1117156821 14:52950636-52950658 CCACCGAATTCGCAGCGCCGGCC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1117156834 14:52950665-52950687 TGGGAGGTGGTGGAGGACCCGGG 0: 1
1: 0
2: 3
3: 68
4: 578
1117156821_1117156830 -4 Left 1117156821 14:52950636-52950658 CCACCGAATTCGCAGCGCCGGCC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1117156830 14:52950655-52950677 GGCCACGGGCTGGGAGGTGGTGG 0: 1
1: 0
2: 13
3: 135
4: 2160
1117156821_1117156827 -10 Left 1117156821 14:52950636-52950658 CCACCGAATTCGCAGCGCCGGCC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1117156827 14:52950649-52950671 AGCGCCGGCCACGGGCTGGGAGG 0: 1
1: 0
2: 2
3: 17
4: 265
1117156821_1117156842 30 Left 1117156821 14:52950636-52950658 CCACCGAATTCGCAGCGCCGGCC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1117156842 14:52950689-52950711 CTTTCGGCAGAAACTCGGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 57
1117156821_1117156835 7 Left 1117156821 14:52950636-52950658 CCACCGAATTCGCAGCGCCGGCC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1117156835 14:52950666-52950688 GGGAGGTGGTGGAGGACCCGGGG 0: 1
1: 0
2: 3
3: 51
4: 559
1117156821_1117156840 26 Left 1117156821 14:52950636-52950658 CCACCGAATTCGCAGCGCCGGCC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1117156840 14:52950685-52950707 GGGGCTTTCGGCAGAAACTCGGG 0: 1
1: 0
2: 0
3: 6
4: 126
1117156821_1117156828 -7 Left 1117156821 14:52950636-52950658 CCACCGAATTCGCAGCGCCGGCC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1117156828 14:52950652-52950674 GCCGGCCACGGGCTGGGAGGTGG 0: 1
1: 1
2: 2
3: 53
4: 591
1117156821_1117156836 14 Left 1117156821 14:52950636-52950658 CCACCGAATTCGCAGCGCCGGCC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1117156836 14:52950673-52950695 GGTGGAGGACCCGGGGCTTTCGG 0: 1
1: 0
2: 2
3: 24
4: 263
1117156821_1117156841 29 Left 1117156821 14:52950636-52950658 CCACCGAATTCGCAGCGCCGGCC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1117156841 14:52950688-52950710 GCTTTCGGCAGAAACTCGGGAGG 0: 1
1: 0
2: 0
3: 0
4: 46
1117156821_1117156839 25 Left 1117156821 14:52950636-52950658 CCACCGAATTCGCAGCGCCGGCC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1117156839 14:52950684-52950706 CGGGGCTTTCGGCAGAAACTCGG 0: 1
1: 0
2: 0
3: 5
4: 51
1117156821_1117156832 -1 Left 1117156821 14:52950636-52950658 CCACCGAATTCGCAGCGCCGGCC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1117156832 14:52950658-52950680 CACGGGCTGGGAGGTGGTGGAGG 0: 2
1: 1
2: 11
3: 82
4: 868

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117156821 Original CRISPR GGCCGGCGCTGCGAATTCGG TGG (reversed) Intronic
900334303 1:2153963-2153985 GGCTGGCGCTGCAGAATCGGTGG - Intronic
919484456 1:198129799-198129821 GACCGGCGCTCAGCATTCGGAGG + Intergenic
922539461 1:226408047-226408069 GGCCGGTGCGGCGTGTTCGGTGG - Exonic
1077141284 11:1026025-1026047 GGCCAGCGCTTCGTATTCGACGG - Exonic
1083890184 11:65592103-65592125 GGGCGGCGCTGGGAGTTGGGAGG + Intronic
1097007186 12:55927820-55927842 GGGCGGCGCCGGGGATTCGGCGG + Exonic
1117156821 14:52950636-52950658 GGCCGGCGCTGCGAATTCGGTGG - Intronic
1133784335 16:8963320-8963342 GGCCGGGGCTGCGAGCCCGGCGG + Exonic
1136458381 16:30395257-30395279 GGCCGGCGGCCCGAACTCGGTGG - Exonic
1140223083 16:73058131-73058153 GGCCCGCGCGGCGAGTTTGGAGG - Intronic
1142698940 17:1648244-1648266 GGCCTGCGCTGGGAACTGGGAGG - Intronic
1147786294 17:42980790-42980812 GTCCGGCCCGGCGAATCCGGCGG - Exonic
1157292573 18:46420388-46420410 GCCCGGCCCTGTGAATACGGTGG - Intronic
1158434963 18:57428867-57428889 GGGCGGCGCTGCCGACTCGGAGG - Intergenic
1160453186 18:78979294-78979316 GGCGGGCGCTCCGGAGTCGGTGG + Intergenic
1166007085 19:39915363-39915385 GGCCGGCGCTTCGACTTCATGGG - Exonic
1168110866 19:54190705-54190727 GGGCGGGGCTGCGGATTCGGTGG + Intronic
1181571231 22:23768591-23768613 GGCCGGCCCGGGGAATCCGGTGG - Intronic
953464384 3:43105991-43106013 GGCGGTCGCTGCGAACCCGGCGG - Exonic
956761299 3:72447206-72447228 GGCCGGCGCCGCGAGGGCGGAGG + Intergenic
972265316 4:37453907-37453929 GGCGGCCGCTGCGAGCTCGGCGG + Intergenic
1002441269 5:179265672-179265694 GGCCGGCGCTGGGAAAGCCGAGG - Intronic
1003603769 6:7541843-7541865 GGCCGGCGCGGAGAAAGCGGAGG - Exonic
1015795152 6:137003955-137003977 AGCAGGCGCTGGGAATTCTGGGG - Intronic
1027001487 7:74657608-74657630 GGGCGGCGCTGCGGATGCGCAGG + Intergenic
1035153389 7:156893191-156893213 GGCGGGCGCCGCGCAGTCGGGGG + Exonic
1047381723 8:124371574-124371596 GGCCGAAGCTCCGGATTCGGAGG + Intronic
1048553988 8:135457643-135457665 CGCCGGCGCTGGGTACTCGGCGG + Exonic