ID: 1117156822

View in Genome Browser
Species Human (GRCh38)
Location 14:52950639-52950661
Sequence CGTGGCCGGCGCTGCGAATT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 25
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 24}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117156822_1117156830 -7 Left 1117156822 14:52950639-52950661 CCGAATTCGCAGCGCCGGCCACG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1117156830 14:52950655-52950677 GGCCACGGGCTGGGAGGTGGTGG 0: 1
1: 0
2: 13
3: 135
4: 2160
1117156822_1117156832 -4 Left 1117156822 14:52950639-52950661 CCGAATTCGCAGCGCCGGCCACG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1117156832 14:52950658-52950680 CACGGGCTGGGAGGTGGTGGAGG 0: 2
1: 1
2: 11
3: 82
4: 868
1117156822_1117156835 4 Left 1117156822 14:52950639-52950661 CCGAATTCGCAGCGCCGGCCACG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1117156835 14:52950666-52950688 GGGAGGTGGTGGAGGACCCGGGG 0: 1
1: 0
2: 3
3: 51
4: 559
1117156822_1117156841 26 Left 1117156822 14:52950639-52950661 CCGAATTCGCAGCGCCGGCCACG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1117156841 14:52950688-52950710 GCTTTCGGCAGAAACTCGGGAGG 0: 1
1: 0
2: 0
3: 0
4: 46
1117156822_1117156836 11 Left 1117156822 14:52950639-52950661 CCGAATTCGCAGCGCCGGCCACG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1117156836 14:52950673-52950695 GGTGGAGGACCCGGGGCTTTCGG 0: 1
1: 0
2: 2
3: 24
4: 263
1117156822_1117156834 3 Left 1117156822 14:52950639-52950661 CCGAATTCGCAGCGCCGGCCACG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1117156834 14:52950665-52950687 TGGGAGGTGGTGGAGGACCCGGG 0: 1
1: 0
2: 3
3: 68
4: 578
1117156822_1117156840 23 Left 1117156822 14:52950639-52950661 CCGAATTCGCAGCGCCGGCCACG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1117156840 14:52950685-52950707 GGGGCTTTCGGCAGAAACTCGGG 0: 1
1: 0
2: 0
3: 6
4: 126
1117156822_1117156828 -10 Left 1117156822 14:52950639-52950661 CCGAATTCGCAGCGCCGGCCACG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1117156828 14:52950652-52950674 GCCGGCCACGGGCTGGGAGGTGG 0: 1
1: 1
2: 2
3: 53
4: 591
1117156822_1117156839 22 Left 1117156822 14:52950639-52950661 CCGAATTCGCAGCGCCGGCCACG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1117156839 14:52950684-52950706 CGGGGCTTTCGGCAGAAACTCGG 0: 1
1: 0
2: 0
3: 5
4: 51
1117156822_1117156842 27 Left 1117156822 14:52950639-52950661 CCGAATTCGCAGCGCCGGCCACG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1117156842 14:52950689-52950711 CTTTCGGCAGAAACTCGGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 57
1117156822_1117156833 2 Left 1117156822 14:52950639-52950661 CCGAATTCGCAGCGCCGGCCACG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1117156833 14:52950664-52950686 CTGGGAGGTGGTGGAGGACCCGG 0: 1
1: 0
2: 9
3: 87
4: 881
1117156822_1117156843 30 Left 1117156822 14:52950639-52950661 CCGAATTCGCAGCGCCGGCCACG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1117156843 14:52950692-52950714 TCGGCAGAAACTCGGGAGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117156822 Original CRISPR CGTGGCCGGCGCTGCGAATT CGG (reversed) Intronic
900386429 1:2412994-2413016 CGCGGCCGGCGCTGGGAGCTCGG - Intronic
1077773343 11:5244755-5244777 CGTGGCCCGTGCTGGGCATTAGG + Intergenic
1078464559 11:11540622-11540644 CTTGGCCTGCCCTGCGATTTGGG + Intronic
1101504000 12:105330488-105330510 CGTGGCCGGCGCAGCGGGGTGGG - Intronic
1113594576 13:111521833-111521855 CGTGGTCGGCACTGGGAACTGGG + Intergenic
1117156822 14:52950639-52950661 CGTGGCCGGCGCTGCGAATTCGG - Intronic
1130076758 15:80695998-80696020 CGTGGCAGGCGCTGCGCACCCGG + Exonic
1139451314 16:67029674-67029696 CGCGGGCGGCGCCGCGGATTTGG + Intronic
1140223084 16:73058134-73058156 CGAGGCCCGCGCGGCGAGTTTGG - Intronic
1144775773 17:17783819-17783841 CGGGGCCGGCTCTGACAATTAGG - Intronic
1161006773 19:1941121-1941143 CGTGGCCGCGGCTGCGCAGTGGG + Intergenic
1161481199 19:4511532-4511554 GGTGACCGGTGCTGCGAATGTGG - Exonic
1161481238 19:4511730-4511752 GGTGACCGGTGCTGCGAATGTGG - Exonic
931492369 2:62762407-62762429 CGTGTCTGGAGCTGCAAATTTGG - Intronic
948220797 2:236268120-236268142 TGTCGCCGGAGCTGGGAATTAGG - Intergenic
952812021 3:37412387-37412409 CGTGGCTGGAGCTGAGAATGGGG + Intronic
967244432 3:187471274-187471296 CGTGACCGGCGCTGGGGTTTTGG + Intergenic
969531644 4:7733936-7733958 CGTGGCCGGCGCTCCTGATGTGG - Intronic
1002549284 5:179975032-179975054 CCTGGCTGGCGCTCCGCATTCGG - Intronic
1007614332 6:43171514-43171536 CGCGGCCGCCGCTGCGAACCCGG - Exonic
1019492420 7:1321611-1321633 CGCAGCCGGCCCTGCCAATTAGG - Intergenic
1022190773 7:28014980-28015002 AGTGGCAGGAGCTGAGAATTTGG - Intronic
1025093160 7:56079433-56079455 CATGGCCGGCCCTGCGGATGAGG + Intronic
1043954131 8:86342381-86342403 CGGGGCCGCCGCTGAGATTTGGG - Intergenic
1187419495 X:19122371-19122393 CGTGGCCGGCTGTGCGAGTCTGG + Intronic