ID: 1117156826

View in Genome Browser
Species Human (GRCh38)
Location 14:52950646-52950668
Sequence CGCAGCGCCGGCCACGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 164}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117156816_1117156826 6 Left 1117156816 14:52950617-52950639 CCCCAAAGAAAGGCGAATCCCAC 0: 1
1: 0
2: 1
3: 8
4: 79
Right 1117156826 14:52950646-52950668 CGCAGCGCCGGCCACGGGCTGGG 0: 1
1: 0
2: 2
3: 18
4: 164
1117156818_1117156826 4 Left 1117156818 14:52950619-52950641 CCAAAGAAAGGCGAATCCCACCG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1117156826 14:52950646-52950668 CGCAGCGCCGGCCACGGGCTGGG 0: 1
1: 0
2: 2
3: 18
4: 164
1117156815_1117156826 7 Left 1117156815 14:52950616-52950638 CCCCCAAAGAAAGGCGAATCCCA 0: 1
1: 0
2: 2
3: 7
4: 221
Right 1117156826 14:52950646-52950668 CGCAGCGCCGGCCACGGGCTGGG 0: 1
1: 0
2: 2
3: 18
4: 164
1117156817_1117156826 5 Left 1117156817 14:52950618-52950640 CCCAAAGAAAGGCGAATCCCACC 0: 1
1: 0
2: 1
3: 5
4: 74
Right 1117156826 14:52950646-52950668 CGCAGCGCCGGCCACGGGCTGGG 0: 1
1: 0
2: 2
3: 18
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117156826 Original CRISPR CGCAGCGCCGGCCACGGGCT GGG Intronic