ID: 1117156827

View in Genome Browser
Species Human (GRCh38)
Location 14:52950649-52950671
Sequence AGCGCCGGCCACGGGCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 265}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117156815_1117156827 10 Left 1117156815 14:52950616-52950638 CCCCCAAAGAAAGGCGAATCCCA 0: 1
1: 0
2: 2
3: 7
4: 221
Right 1117156827 14:52950649-52950671 AGCGCCGGCCACGGGCTGGGAGG 0: 1
1: 0
2: 2
3: 17
4: 265
1117156820_1117156827 -9 Left 1117156820 14:52950635-52950657 CCCACCGAATTCGCAGCGCCGGC 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1117156827 14:52950649-52950671 AGCGCCGGCCACGGGCTGGGAGG 0: 1
1: 0
2: 2
3: 17
4: 265
1117156817_1117156827 8 Left 1117156817 14:52950618-52950640 CCCAAAGAAAGGCGAATCCCACC 0: 1
1: 0
2: 1
3: 5
4: 74
Right 1117156827 14:52950649-52950671 AGCGCCGGCCACGGGCTGGGAGG 0: 1
1: 0
2: 2
3: 17
4: 265
1117156821_1117156827 -10 Left 1117156821 14:52950636-52950658 CCACCGAATTCGCAGCGCCGGCC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1117156827 14:52950649-52950671 AGCGCCGGCCACGGGCTGGGAGG 0: 1
1: 0
2: 2
3: 17
4: 265
1117156818_1117156827 7 Left 1117156818 14:52950619-52950641 CCAAAGAAAGGCGAATCCCACCG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1117156827 14:52950649-52950671 AGCGCCGGCCACGGGCTGGGAGG 0: 1
1: 0
2: 2
3: 17
4: 265
1117156816_1117156827 9 Left 1117156816 14:52950617-52950639 CCCCAAAGAAAGGCGAATCCCAC 0: 1
1: 0
2: 1
3: 8
4: 79
Right 1117156827 14:52950649-52950671 AGCGCCGGCCACGGGCTGGGAGG 0: 1
1: 0
2: 2
3: 17
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117156827 Original CRISPR AGCGCCGGCCACGGGCTGGG AGG Intronic
900413918 1:2526427-2526449 GGCGCCGGGCGCGGGCTGCGGGG - Intronic
901942364 1:12673051-12673073 AGCGCCTGTCAGGGGGTGGGGGG + Intergenic
902465265 1:16613533-16613555 GGCGCAGGCGAGGGGCTGGGTGG - Intronic
902920726 1:19664948-19664970 AGAGGCGGCCGCGGGCCGGGCGG - Intergenic
903069083 1:20717791-20717813 AGCGCCGGCCACGGGGGGCGGGG + Exonic
903227110 1:21900073-21900095 ACCGCCGGAGACGGGCTGGAGGG - Intronic
903349811 1:22710901-22710923 AGCGCGCGCCCCGGGCTCGGGGG - Intronic
903413789 1:23168155-23168177 GGCGCGGGCCGCGGGCCGGGCGG - Intronic
905031219 1:34885632-34885654 AGCTCCGCCGACGGGCTGGACGG - Exonic
905168455 1:36097152-36097174 AGCCCCAGCCAAGGGCTGTGAGG + Exonic
910177743 1:84449068-84449090 AGGGCCTGTCAGGGGCTGGGGGG + Intergenic
914086861 1:144461605-144461627 GGCGCAGGCTATGGGCTGGGCGG - Intronic
914311748 1:146472608-146472630 GGCGCAGGCTATGGGCTGGGCGG + Intergenic
914845632 1:151282306-151282328 AGCGGCGGCCGCGGGGAGGGCGG + Exonic
916245707 1:162686369-162686391 AGGGCCTGTCACGGGGTGGGGGG - Intronic
918046921 1:180947211-180947233 AGAGCAGGCAACGGGTTGGGAGG + Exonic
1069646860 10:70006174-70006196 AGTGGTGGCCAGGGGCTGGGGGG + Intergenic
1070129838 10:73648324-73648346 GGCGCCGGCAAGGGGCTGGGTGG + Exonic
1070783482 10:79150351-79150373 AGCGCAGGCCAGAGGCAGGGCGG - Intronic
1070800663 10:79242973-79242995 AGTGCGGGCGGCGGGCTGGGGGG + Intronic
1073289971 10:102408747-102408769 AGAGGCGGGCACGGGCTGGGGGG - Intronic
1076006836 10:126954598-126954620 GGCGGCTGCCAGGGGCTGGGAGG - Intronic
1076374268 10:129972951-129972973 GGCGCCGGCTGCGGGCCGGGAGG + Intergenic
1076548632 10:131262836-131262858 AGCGGCTGCCAGGGGCTAGGGGG - Intronic
1077053154 11:576704-576726 CGCGCTGGCCGCGGGCCGGGAGG + Intronic
1077330285 11:1981197-1981219 AGTGAAGGCCACGGGTTGGGGGG - Intronic
1077387318 11:2276158-2276180 AGTGTGGGCCGCGGGCTGGGAGG + Intergenic
1077844843 11:6013229-6013251 AGCCCCTGCCACAGGCTGTGAGG - Intergenic
1079077996 11:17395564-17395586 TGAGCCGGCCTGGGGCTGGGTGG + Intronic
1080406896 11:31987563-31987585 AGCGCCAGCCCCGGGGTGGCGGG + Intronic
1081831526 11:46120006-46120028 AGGGCCGGCCCCGGGGTGAGGGG + Intronic
1083680256 11:64348418-64348440 AGGGCAGGGCAGGGGCTGGGCGG + Intronic
1084419951 11:69055390-69055412 AGCAGCGGCCAGGCGCTGGGAGG - Intronic
1084433933 11:69127136-69127158 AGCGCCGGGATCCGGCTGGGCGG - Intergenic
1086161895 11:83731289-83731311 AGGGCCAGTCAGGGGCTGGGGGG - Intronic
1087422629 11:97949563-97949585 AGCGCCTGTCAGGGGGTGGGGGG - Intergenic
1087789349 11:102390947-102390969 AGTGCCAGCTACTGGCTGGGAGG - Intergenic
1202813264 11_KI270721v1_random:36376-36398 AGTGAAGGCCACGGGTTGGGGGG - Intergenic
1091546205 12:1502990-1503012 TGCTCTGGCCACGGGGTGGGTGG - Intergenic
1091617065 12:2057652-2057674 AGAGCCTGCGACGGACTGGGTGG - Intronic
1092038950 12:5366558-5366580 AGGGCCTGTCAGGGGCTGGGGGG + Intergenic
1094767460 12:33613278-33613300 AGGGCCTGCCAGGGGGTGGGTGG + Intergenic
1095672425 12:44876405-44876427 AGCGCCGGCCTCGCCCTCGGCGG - Intronic
1095753079 12:45730823-45730845 AGCGACGTCCGCGGGTTGGGGGG - Intronic
1096083910 12:48852279-48852301 AGCGCCGGCCCCAGGCTGCGGGG + Intronic
1097543666 12:60972219-60972241 AGGGCCTGTCATGGGCTGGGGGG - Intergenic
1100797668 12:98199314-98199336 AGGGCCTGCCAGGGGCTGGGGGG - Intergenic
1101605958 12:106247867-106247889 GGCTCGGGCCGCGGGCTGGGAGG + Exonic
1103527780 12:121579287-121579309 GGCTCCGGACACGGGCTGGCGGG + Intronic
1103810738 12:123611447-123611469 AGCCCCAGCCCCGGGCTGGTGGG - Intronic
1104926384 12:132316133-132316155 GGAGCTGGCCGCGGGCTGGGAGG + Intronic
1104988531 12:132611210-132611232 AGCGCCGGGCACGGGGAGGAGGG + Intergenic
1105522105 13:21140492-21140514 ATAGTCGGCCAGGGGCTGGGCGG - Exonic
1106037401 13:26056533-26056555 AGAGCCTGTCAGGGGCTGGGAGG + Intergenic
1106473449 13:30077839-30077861 AGCCCTGGCCAGGGGCTGGAGGG - Intergenic
1108164945 13:47683105-47683127 AGGGCCTGTCACGGGGTGGGGGG - Intergenic
1113749647 13:112768316-112768338 GGCGTCGGCCACTGGCTGTGGGG + Intronic
1114212307 14:20625826-20625848 AGTGCCGGCCGCGGGCTGATGGG - Intergenic
1115421360 14:33198989-33199011 ACCGCCGGCCACGGACAGTGTGG - Intronic
1115664887 14:35534993-35535015 AGCGCCGTCCCGGGGCTTGGGGG + Exonic
1117156827 14:52950649-52950671 AGCGCCGGCCACGGGCTGGGAGG + Intronic
1121112946 14:91324731-91324753 AGCGGCGGCCACGGCCAGGCTGG + Intronic
1123007670 14:105332262-105332284 AGCGCCAGTGAGGGGCTGGGAGG - Intronic
1124061599 15:26298316-26298338 ACCGCCGGCCCCGGGCAGTGAGG - Intergenic
1124239631 15:28018878-28018900 AGCGCAGGAAACGGGCCGGGAGG - Intronic
1124473213 15:30007360-30007382 AGCTCAGGCCTGGGGCTGGGGGG + Intergenic
1126194692 15:45918938-45918960 AGCCCTGGCCTCTGGCTGGGTGG - Intergenic
1129035616 15:72646908-72646930 ATGGATGGCCACGGGCTGGGTGG - Intergenic
1129214268 15:74090308-74090330 ATGGATGGCCACGGGCTGGGTGG + Intergenic
1129391149 15:75221629-75221651 ATGGATGGCCACGGGCTGGGTGG - Intergenic
1129399741 15:75275061-75275083 ATGGATGGCCACGGGCTGGGTGG - Intronic
1129473162 15:75766250-75766272 ATGGATGGCCACGGGCTGGGTGG + Intergenic
1129731407 15:77934656-77934678 ATGGATGGCCACGGGCTGGGTGG + Intergenic
1132098871 15:99008489-99008511 CCCGCCGGCCACGGGCAGTGAGG - Intergenic
1132419307 15:101652088-101652110 AGGGGCGGCCTCGGGCCGGGCGG + Intronic
1132499815 16:280358-280380 AGAGCCGGGCACGGGCCGGGCGG + Intronic
1132625196 16:888223-888245 AGCCCCTGCCAGGGCCTGGGCGG - Intronic
1132764312 16:1526590-1526612 GGCGCCCGCCATGGGGTGGGTGG - Intronic
1133010171 16:2906040-2906062 ACCAATGGCCACGGGCTGGGCGG + Intergenic
1133628456 16:7594127-7594149 AGGGCCTGTCACGGGGTGGGGGG - Intronic
1136458485 16:30395584-30395606 AGCGGCGGCTGCGCGCTGGGAGG + Intronic
1136567784 16:31080376-31080398 ATCGGCGGCGACGGGCTGGACGG + Exonic
1139946039 16:70642896-70642918 AGTGGCTGCCAGGGGCTGGGAGG + Intronic
1140455568 16:75103490-75103512 AGTGGTGGCCAGGGGCTGGGCGG + Intronic
1141423887 16:83933387-83933409 TGCGCAGGGCAGGGGCTGGGGGG - Intronic
1141471632 16:84242636-84242658 AGTGCCATCCACTGGCTGGGAGG - Intergenic
1141697982 16:85629272-85629294 AGCCACAGGCACGGGCTGGGTGG - Intronic
1141839246 16:86564069-86564091 TGCAGCGGCCACGGGCCGGGAGG + Intergenic
1142009297 16:87705774-87705796 AGAGCCGGGCAGGGCCTGGGCGG + Intronic
1142378992 16:89721351-89721373 AGCGCTGGCCTGGGGCGGGGCGG - Intronic
1142389845 16:89792138-89792160 TGCGGTGGCCACCGGCTGGGAGG - Intronic
1142671276 17:1488381-1488403 AGCGCGAGCCCCGGGCGGGGAGG + Intronic
1143308608 17:5969753-5969775 AGGGCCTGCCAGGGGGTGGGGGG + Intronic
1143575884 17:7792811-7792833 AGCACCGACCACTGGCTGGAGGG - Exonic
1145260587 17:21352280-21352302 AGTGCCGGGCAGCGGCTGGGTGG - Intergenic
1146058123 17:29591134-29591156 AGCGCCTGGCACGGGCTGCCTGG - Intronic
1146339555 17:32007516-32007538 AGCGCCGGGGCCGGGTTGGGAGG - Intergenic
1146917401 17:36687008-36687030 AGCCCTGCCCAGGGGCTGGGTGG - Intergenic
1150249969 17:63699866-63699888 AGGGCCGGCCCCCGGCTGGGCGG - Intronic
1152017060 17:77757681-77757703 AGCTCCTGCTACAGGCTGGGCGG - Intergenic
1152036983 17:77879665-77879687 GGCACAGGCCAGGGGCTGGGTGG + Intergenic
1152362379 17:79838821-79838843 GGCGCCGGGCTCGGGCTCGGCGG + Intronic
1152749143 17:82054561-82054583 AGCCCTGGACACGGCCTGGGTGG + Exonic
1153605827 18:6830472-6830494 AGGGCCTGTCAGGGGCTGGGGGG - Intronic
1153815382 18:8786047-8786069 ACCGGGAGCCACGGGCTGGGAGG + Exonic
1154331814 18:13436081-13436103 AGTGCCTGTCACAGGCTGGGCGG + Intronic
1155075217 18:22348635-22348657 AGCGCCCGGCTCCGGCTGGGCGG + Intergenic
1156255579 18:35392761-35392783 AGCGGTGGTCAAGGGCTGGGAGG - Intergenic
1157547121 18:48554431-48554453 AGTGCCTGCCTCGGCCTGGGAGG - Intronic
1158403150 18:57139340-57139362 AGGGCTGGCCAAGGGCTGAGAGG - Intergenic
1160279159 18:77471099-77471121 ATAGCCGGCCACAGGCTGGTTGG - Intergenic
1160661803 19:304653-304675 AGGGCCGGCCCCCAGCTGGGAGG - Intergenic
1161051171 19:2164596-2164618 AGCGCCGGGAACGAGCGGGGCGG - Intronic
1161266357 19:3366518-3366540 CGCGCCGGCCGCGGGGCGGGGGG + Intronic
1161273639 19:3404011-3404033 GGGGCAGGCCAGGGGCTGGGGGG - Intronic
1161707531 19:5829169-5829191 GGCGCCGGCTTCGGGCTGGATGG - Intergenic
1162054021 19:8052265-8052287 AGCGGTGGCCACAGGATGGGGGG - Intronic
1162421545 19:10568613-10568635 CGCGCCGGCGACCGGCTGAGTGG - Exonic
1162421559 19:10568681-10568703 AGCGCCGGGCTGGGGCGGGGCGG - Exonic
1162744553 19:12791301-12791323 AACAGCGGCCACGGGCCGGGTGG - Intronic
1162914907 19:13869444-13869466 CCCACCGCCCACGGGCTGGGTGG + Intronic
1163262528 19:16199735-16199757 AGAGCACGCCAGGGGCTGGGTGG + Intronic
1163516443 19:17766823-17766845 GGCGCCGCCCAGCGGCTGGGTGG + Intronic
1163829978 19:19542976-19542998 AGCGCCCGCCCCGGGCTCAGGGG + Intronic
1165319331 19:35075900-35075922 AGCCCCCACCACGGCCTGGGGGG + Intergenic
1167258391 19:48443971-48443993 AGCGCAGGCCACGGCCCGAGGGG + Exonic
1167707951 19:51092958-51092980 AGCCCCTGCCACGTGCCGGGTGG - Intergenic
1168180464 19:54659240-54659262 GGCACCTGTCACGGGCTGGGGGG + Intronic
1168405467 19:56108214-56108236 AGCACTGGGCAGGGGCTGGGTGG - Intronic
1168405502 19:56108310-56108332 AGCTCTGGGCAGGGGCTGGGTGG - Intronic
925172610 2:1759550-1759572 ACCGCCGGCCCCGGGCAGTGAGG - Intergenic
925327511 2:3035117-3035139 AGCGCAGGGCAGGGGTTGGGAGG - Intergenic
926464337 2:13168923-13168945 GACGCCGGTCACGGACTGGGAGG - Intergenic
927125500 2:20009468-20009490 AGCGCCTGTCAGGGGGTGGGGGG + Intronic
931412134 2:62042652-62042674 AGCCCCGGCGACGGGCTGAAGGG + Intronic
931762876 2:65432354-65432376 AGCGCCGGCCGCGGGTGGGGGGG + Intronic
931802202 2:65769516-65769538 AGGGCCTGTCAGGGGCTGGGGGG - Intergenic
934872365 2:97878686-97878708 AGGGCCTGTCAGGGGCTGGGGGG + Intronic
935746481 2:106194012-106194034 AGCGCCGGCCCCGCCCGGGGCGG + Intronic
937638048 2:124179083-124179105 AGCCAGGGTCACGGGCTGGGTGG - Intronic
939998885 2:148947646-148947668 AGCCCCAGCCAGGGCCTGGGAGG - Intronic
941021027 2:160407909-160407931 CGCGCCGGCCGGGGGCGGGGAGG + Intronic
943033749 2:182716014-182716036 GGCGCCTGCCGCGGGCGGGGAGG - Intergenic
946085732 2:217169320-217169342 AGGGCCTGTCAGGGGCTGGGGGG - Intergenic
946401542 2:219471154-219471176 AGAGCGGGCCAGGGGCAGGGGGG + Intronic
946688059 2:222291257-222291279 AGCGCGGGCCAGGGGCTAGGGGG + Intronic
946727094 2:222671670-222671692 CGCGCTGGGCACTGGCTGGGCGG - Intergenic
948205200 2:236159777-236159799 AGGGCCGGGCCCGGGGTGGGGGG - Intergenic
948207070 2:236168063-236168085 AGCGCCGGGCAGGGGCCGAGCGG + Exonic
1169234672 20:3921202-3921224 AGGGCCTGCCATGGGGTGGGGGG - Intronic
1171140827 20:22740612-22740634 AGGGCCTGCCATGGGGTGGGGGG + Intergenic
1172488643 20:35316268-35316290 AGCACCTGTCATGGGCTGGGAGG + Intronic
1172834690 20:37865513-37865535 AGTGGCTGCCAGGGGCTGGGGGG - Intronic
1172970090 20:38866931-38866953 AGCGGCTGCCAGGGGCTAGGGGG - Intronic
1173654085 20:44687207-44687229 AGTGGCTGCCAGGGGCTGGGAGG - Intergenic
1174353489 20:49983736-49983758 ACCGCTGGCCAGGGGCTGGGTGG - Intronic
1174467981 20:50731854-50731876 TGCGCGGGGCCCGGGCTGGGCGG + Intronic
1175873718 20:62220009-62220031 GGCGCCGGCCGAGAGCTGGGCGG + Exonic
1176202094 20:63865706-63865728 AGAGCAGGGCACGGGGTGGGCGG - Intronic
1176431634 21:6579704-6579726 AGCGGTGGCCAGGGGATGGGCGG - Intergenic
1177082726 21:16661284-16661306 AGGGCCTGTCAGGGGCTGGGGGG - Intergenic
1179012091 21:37563957-37563979 AGCGCCAGCCCCGGGCTTCGGGG + Intergenic
1179635613 21:42706789-42706811 AGGGCCTGCCAGGGGCTGGGGGG - Intronic
1179707028 21:43187166-43187188 AGCGGTGGCCAGGGGATGGGCGG - Intergenic
1179783858 21:43719023-43719045 GGCCCCGCCCCCGGGCTGGGAGG - Intergenic
1180071579 21:45439379-45439401 CCCGCCGGTCACGGGCTGGTGGG + Intronic
1181007517 22:20021048-20021070 CGCGCCGGCTTCGGGCTGGGCGG + Exonic
1181085120 22:20436382-20436404 AGCGGCGGCGGCGGGCGGGGCGG - Intronic
1181779243 22:25180963-25180985 GGAGCCGGCCAGGGGCTGGATGG + Intronic
1182355458 22:29720591-29720613 AGCGCGGGCCAGGGGCGCGGGGG + Intronic
1184222671 22:43110838-43110860 ACCGCCGGGCTCGAGCTGGGCGG - Intronic
1184314539 22:43674507-43674529 AGCACAGGCCAAGGCCTGGGAGG + Intronic
1184408557 22:44313677-44313699 GGAGACGGCCATGGGCTGGGGGG - Intergenic
1184664173 22:45978671-45978693 CGCGCCCGCCACTGGCTGCGAGG - Intergenic
1184986904 22:48141894-48141916 TGCGCAGGACACGGGGTGGGGGG + Intergenic
950425031 3:12920589-12920611 AGCGCTGGCTGCGGGCCGGGAGG + Exonic
951881388 3:27484133-27484155 AGCGGCCGTCACGGGCTGGCCGG - Intronic
953391509 3:42536375-42536397 AGCCCCGGCCCTGGGCTCGGAGG + Exonic
953931921 3:47009832-47009854 AGCGACGGCCACGCGGAGGGGGG - Intergenic
954300692 3:49699378-49699400 AGCCCAGGCCCCGGGGTGGGGGG + Intronic
956414519 3:69013095-69013117 AGTCCCGGCCAAGGGCTGAGGGG + Intronic
961353209 3:126316815-126316837 AGTGCCAGCCACGGGCTCTGAGG - Intergenic
961403400 3:126662895-126662917 AGCCTCGGCCAGTGGCTGGGAGG + Intergenic
961446270 3:126983163-126983185 GGCGGCGGCCTCGGCCTGGGCGG + Intergenic
965590373 3:170356839-170356861 AGCGCCGGCAGCTGGCTGGGCGG + Intergenic
965648284 3:170908155-170908177 GGCGGCGGCCGAGGGCTGGGCGG - Intronic
971195625 4:24470486-24470508 GGCGCCGGCCACGGGCAGCCGGG + Intergenic
973279326 4:48342139-48342161 GGCGCCGGGCAGGAGCTGGGCGG + Intronic
973919157 4:55667141-55667163 AGCGATTGCCAGGGGCTGGGGGG - Intergenic
978730926 4:112025538-112025560 AGGGCCTGTCAGGGGCTGGGGGG + Intergenic
979012835 4:115393150-115393172 AGGGCCTGTCAGGGGCTGGGGGG + Intergenic
980664729 4:135916531-135916553 AGGGCCTGTCAGGGGCTGGGGGG + Intergenic
980855652 4:138436110-138436132 AGGGCCTGTCAGGGGCTGGGGGG + Intergenic
984734852 4:183099371-183099393 GGCGCCGGCGAGGGGCTGAGGGG - Exonic
985129082 4:186723826-186723848 GGCGCCGGCGCCGAGCTGGGCGG - Exonic
985559214 5:574030-574052 AGAGCCGGCCAGCGGCTGGGGGG + Intergenic
985563202 5:602306-602328 TGCGGCGGCCACAGACTGGGGGG - Intergenic
985791769 5:1931833-1931855 AGCACAGGCCACAGGCCGGGGGG - Intergenic
985842466 5:2318786-2318808 AGGGCCAGCCAGGGGTTGGGGGG - Intergenic
986198228 5:5557631-5557653 AGCGCTTGCCAGGGACTGGGTGG - Intergenic
986462019 5:7982376-7982398 AGGGGTGGCCATGGGCTGGGTGG + Intergenic
992098268 5:73381918-73381940 AGTGCCTGCCTCGGGCTCGGAGG - Intergenic
992228319 5:74640344-74640366 AGCGACGGTCACGGGCAAGGAGG + Exonic
992866441 5:80960979-80961001 AGGGCCGGCGCCGGGCAGGGAGG + Exonic
995108583 5:108402636-108402658 AGGGCCTGTCAGGGGCTGGGGGG - Intergenic
998387600 5:141766785-141766807 AGCCCCGGCAAAGGCCTGGGTGG - Intergenic
1000301620 5:159961814-159961836 AATGCCAGCCATGGGCTGGGTGG - Intronic
1000467470 5:161597527-161597549 AGGGCCTGTCACGGGATGGGGGG + Intronic
1001231313 5:169991084-169991106 AGCTGCGGCCGTGGGCTGGGTGG - Intronic
1001617833 5:173056826-173056848 AGCAGCGGCCCCGGGCTCGGAGG - Intronic
1003097997 6:3157309-3157331 CGCGGCGGCCCCGGGCTGGCCGG - Intronic
1006150424 6:31984031-31984053 AGGGTGGGCCAAGGGCTGGGGGG - Intronic
1006156725 6:32016769-32016791 AGGGTGGGCCAAGGGCTGGGGGG - Intronic
1006239523 6:32665174-32665196 AGCGCCAGGCACGGGCGGGCGGG - Intronic
1006797066 6:36738615-36738637 AGGGCCAGCCACAGCCTGGGGGG + Intergenic
1007759720 6:44127076-44127098 AGCGCCGGCCACGGACTTGGGGG + Intronic
1007783207 6:44265639-44265661 AGCGCCCGCCGGGGGCGGGGAGG - Exonic
1008545129 6:52577133-52577155 AGTGCGGGCCGCGGGCTGGGCGG - Intergenic
1010254470 6:73742186-73742208 AGTGGCTGCCAGGGGCTGGGGGG - Intronic
1011063738 6:83301035-83301057 AGGGCCTGCCATGGGATGGGGGG + Intronic
1014237043 6:118969799-118969821 AGGGCCTGTCACGGGGTGGGGGG - Intronic
1014802260 6:125790659-125790681 AGCGCGCGCCACTGGCCGGGAGG + Intronic
1016985501 6:149891880-149891902 AGGGCCTGTCACGGGGTGGGGGG - Intronic
1017671983 6:156777762-156777784 GGCGCCGGCCGCGGCCCGGGGGG - Intergenic
1020106244 7:5423530-5423552 AGCGGCGGCCGCGGGATGGCGGG - Exonic
1022689048 7:32628022-32628044 AGCGGCTGCCACGGGTTAGGGGG + Intergenic
1023955624 7:44884855-44884877 GGCGCGGGCCCCGGGCCGGGCGG - Exonic
1026911100 7:74092528-74092550 AGGGCCTGCAAGGGGCTGGGAGG - Intronic
1030403919 7:109086634-109086656 GGGGCCTGTCACGGGCTGGGGGG + Intergenic
1030921967 7:115401881-115401903 AGGGCCTGTCAGGGGCTGGGGGG + Intergenic
1031422699 7:121568929-121568951 AGTGCTGGTCACGGACTGGGAGG - Intergenic
1033888518 7:145978467-145978489 AGTGCCTGCCAGGGGGTGGGTGG + Intergenic
1034262441 7:149765284-149765306 CGCGCTGGCCAGGGGCTTGGCGG + Exonic
1034499407 7:151440174-151440196 AGGGGCAGCCGCGGGCTGGGCGG - Intronic
1034550052 7:151814735-151814757 AGCGCAGGCAACGGTCTTGGTGG + Intronic
1035045291 7:155961754-155961776 AGAGCCAGCCCAGGGCTGGGAGG + Intergenic
1035236023 7:157498157-157498179 CTTGCTGGCCACGGGCTGGGAGG + Intergenic
1036168491 8:6459969-6459991 AGCCACGGCCACGGGCTCTGGGG + Intronic
1036476929 8:9102054-9102076 AGTGCCGGCCAAGGGTTGAGTGG + Intronic
1039020332 8:33197771-33197793 AGGGGCGGCCAAGGGGTGGGGGG + Intergenic
1040559860 8:48514614-48514636 AGCTCTGGCCAGCGGCTGGGCGG + Intergenic
1043238029 8:77893678-77893700 AGGGCCTGCCAGGGGGTGGGGGG + Intergenic
1043352017 8:79372968-79372990 AGGGCCTGTCACGGGGTGGGGGG + Intergenic
1044862160 8:96534062-96534084 ACCGCCGGCCCCGGGCAGTGAGG - Intronic
1045510803 8:102810726-102810748 CGCGCCGACCCCGCGCTGGGTGG + Intergenic
1049019086 8:139941500-139941522 AGGGCAGGCCAGGGGCTGGCAGG + Intronic
1049351207 8:142165744-142165766 AGGGCCAGCCTGGGGCTGGGCGG - Intergenic
1049396826 8:142404812-142404834 AGCGCCAGCCACGGAAGGGGAGG - Intergenic
1049405250 8:142449498-142449520 AGCGCCGGCAGCCGGGTGGGGGG + Exonic
1049532187 8:143160165-143160187 AGCGCGGGCCTCGGGGTCGGGGG + Intronic
1049761521 8:144333951-144333973 AGCTCCGGGCGCGGGGTGGGCGG + Exonic
1052068316 9:24050601-24050623 AGGGCCGGTCATGGGATGGGGGG - Intergenic
1052494927 9:29213463-29213485 AGCGCCGGTGCGGGGCTGGGCGG + Intergenic
1053262362 9:36679423-36679445 AGTGGTGGCCAGGGGCTGGGGGG - Intergenic
1054890539 9:70246305-70246327 AGGGCCTGCCAGGGGGTGGGGGG + Intergenic
1056969580 9:91191183-91191205 AGAGCTGCCCAGGGGCTGGGAGG - Intergenic
1057139683 9:92718901-92718923 AGCGCCGGCCACGCGCCTCGGGG + Exonic
1057279910 9:93701928-93701950 AGAGGCGGCCTGGGGCTGGGCGG - Intergenic
1058687238 9:107489622-107489644 GGCGCGGGCCACGGGCGGGTGGG + Exonic
1059196962 9:112379745-112379767 AGCGCCGGCTCCGAGCTGGGAGG - Intergenic
1059659059 9:116383219-116383241 AGCCCCAGCCAAGGGTTGGGAGG + Intronic
1060825113 9:126683304-126683326 TGCGGCGGCCGCGGGCCGGGCGG - Intronic
1061060945 9:128250387-128250409 CCCGCGGGCCCCGGGCTGGGGGG - Intronic
1062044700 9:134419611-134419633 AGCGCGGGGCAGGGCCTGGGCGG + Intronic
1062230723 9:135480092-135480114 CGCGCCGGCCCCGGCCTGGCTGG - Intronic
1062231584 9:135484950-135484972 CCCGCCGGCCCCGGGCTGTGCGG - Exonic
1062322508 9:135997307-135997329 GGCCCGGGCCTCGGGCTGGGAGG - Intergenic
1062382966 9:136296440-136296462 AGCACCGGCCTTGGGCTGGACGG + Intronic
1062525840 9:136977807-136977829 AGTGCCGGCCAGGGACTGAGCGG + Intronic
1062607300 9:137353958-137353980 TGCGCTGGCACCGGGCTGGGGGG + Intronic
1186378433 X:9033238-9033260 AGCCCCGGGGACGGGCTGGACGG - Intronic
1186496566 X:10015951-10015973 GGCGGCGGCCCCGCGCTGGGCGG - Intronic
1186888204 X:13936014-13936036 AGTGCTTGCCAGGGGCTGGGGGG + Intronic
1187244006 X:17537971-17537993 AGAGCCAGCCACGGGCAGGAGGG + Intronic
1187326542 X:18295472-18295494 AGTGCCTGCAACAGGCTGGGTGG - Intronic
1188005954 X:25015903-25015925 AGCTCGGGCCGCGGGCAGGGCGG - Exonic
1193222075 X:78937463-78937485 AGGGCCTGTCACGGGGTGGGGGG - Intergenic
1194953134 X:100150732-100150754 AGGGCCTGTCACGGGATGGGGGG - Intergenic
1196459523 X:115915972-115915994 AGGGCCTGTCACGGGGTGGGGGG + Intergenic
1197142673 X:123133538-123133560 AGGGCCTGTCACGGGGTGGGGGG + Intergenic
1199798666 X:151227901-151227923 AGCGGCGGGCCCGAGCTGGGAGG - Intergenic
1199969740 X:152850937-152850959 AGTGGCGGCCAGGGGCTGGGAGG - Intronic
1200224865 X:154411819-154411841 AGCGCCGGCCGCGGGCCGGGTGG + Exonic
1201763343 Y:17560559-17560581 AGCCCCTGCGGCGGGCTGGGGGG + Intergenic
1201838210 Y:18345431-18345453 AGCCCCTGCGGCGGGCTGGGGGG - Intergenic