ID: 1117156828

View in Genome Browser
Species Human (GRCh38)
Location 14:52950652-52950674
Sequence GCCGGCCACGGGCTGGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 648
Summary {0: 1, 1: 1, 2: 2, 3: 53, 4: 591}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117156821_1117156828 -7 Left 1117156821 14:52950636-52950658 CCACCGAATTCGCAGCGCCGGCC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1117156828 14:52950652-52950674 GCCGGCCACGGGCTGGGAGGTGG 0: 1
1: 1
2: 2
3: 53
4: 591
1117156818_1117156828 10 Left 1117156818 14:52950619-52950641 CCAAAGAAAGGCGAATCCCACCG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1117156828 14:52950652-52950674 GCCGGCCACGGGCTGGGAGGTGG 0: 1
1: 1
2: 2
3: 53
4: 591
1117156817_1117156828 11 Left 1117156817 14:52950618-52950640 CCCAAAGAAAGGCGAATCCCACC 0: 1
1: 0
2: 1
3: 5
4: 74
Right 1117156828 14:52950652-52950674 GCCGGCCACGGGCTGGGAGGTGG 0: 1
1: 1
2: 2
3: 53
4: 591
1117156816_1117156828 12 Left 1117156816 14:52950617-52950639 CCCCAAAGAAAGGCGAATCCCAC 0: 1
1: 0
2: 1
3: 8
4: 79
Right 1117156828 14:52950652-52950674 GCCGGCCACGGGCTGGGAGGTGG 0: 1
1: 1
2: 2
3: 53
4: 591
1117156822_1117156828 -10 Left 1117156822 14:52950639-52950661 CCGAATTCGCAGCGCCGGCCACG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1117156828 14:52950652-52950674 GCCGGCCACGGGCTGGGAGGTGG 0: 1
1: 1
2: 2
3: 53
4: 591
1117156820_1117156828 -6 Left 1117156820 14:52950635-52950657 CCCACCGAATTCGCAGCGCCGGC 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1117156828 14:52950652-52950674 GCCGGCCACGGGCTGGGAGGTGG 0: 1
1: 1
2: 2
3: 53
4: 591
1117156815_1117156828 13 Left 1117156815 14:52950616-52950638 CCCCCAAAGAAAGGCGAATCCCA 0: 1
1: 0
2: 2
3: 7
4: 221
Right 1117156828 14:52950652-52950674 GCCGGCCACGGGCTGGGAGGTGG 0: 1
1: 1
2: 2
3: 53
4: 591

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117156828 Original CRISPR GCCGGCCACGGGCTGGGAGG TGG Intronic
900393461 1:2443689-2443711 GCCCGCCCCGCGCCGGGAGGGGG - Intronic
900420265 1:2553185-2553207 GACGGCCAGGGGAGGGGAGGAGG + Intergenic
900424164 1:2568473-2568495 GACGGCCAGGGGAGGGGAGGAGG - Intergenic
900502077 1:3011296-3011318 GCTGGCCACAAGCGGGGAGGAGG - Intergenic
900533151 1:3164657-3164679 GCAGGCGAGGGGCTAGGAGGCGG + Intronic
901805516 1:11736235-11736257 GGTGGCGACGGGCTGGGGGGAGG + Exonic
901851741 1:12020062-12020084 GGGGGGCAAGGGCTGGGAGGAGG + Intronic
902049906 1:13554999-13555021 GCCGGGCACGGGGCGGGAGGCGG - Intergenic
902410772 1:16210291-16210313 GCAGGCAGCGGGCTGGGCGGGGG + Intronic
902465264 1:16613530-16613552 GCAGGCGAGGGGCTGGGTGGCGG - Intronic
902609372 1:17588231-17588253 GTGGGCCACGGGGTGGGTGGGGG + Intronic
902771386 1:18647186-18647208 GCCGGCCAGCGGAGGGGAGGGGG + Intronic
902856505 1:19210155-19210177 CACGACCCCGGGCTGGGAGGTGG - Exonic
902930157 1:19725574-19725596 GCGTGCCAAGGGCAGGGAGGTGG - Intronic
903011776 1:20336375-20336397 GACGGACCCGGGCTGGAAGGTGG + Exonic
903034181 1:20484249-20484271 GTCGGCCAGCGGCTGGGAGAGGG - Intronic
903164036 1:21508853-21508875 GCAGCCCACGGGCAGGGAAGCGG + Intergenic
903613455 1:24633914-24633936 TTCGGCCAGGGGTTGGGAGGGGG + Intronic
904116805 1:28168587-28168609 GGTTGCCAGGGGCTGGGAGGAGG + Intronic
904466861 1:30713483-30713505 GCCAGCCCGGGGGTGGGAGGGGG - Exonic
904783016 1:32964670-32964692 GCCGGCCATGGGCTCCGAGAAGG - Exonic
905074587 1:35258726-35258748 GATGGCCAGGGGCTGGGGGGAGG + Intergenic
906355987 1:45106302-45106324 GCCGCCCATCGTCTGGGAGGTGG + Intronic
907254753 1:53170448-53170470 GGTTGCCAGGGGCTGGGAGGAGG - Intergenic
907333432 1:53685906-53685928 GCTGGCCACAGGCTGGCTGGAGG - Intronic
908258087 1:62318884-62318906 GCAGACCCCAGGCTGGGAGGCGG + Intronic
908389279 1:63670336-63670358 GTCGGAAACAGGCTGGGAGGGGG + Intergenic
909288152 1:73847458-73847480 GGTTGCCAGGGGCTGGGAGGAGG - Intergenic
909571937 1:77123615-77123637 GGCTGCCAGGAGCTGGGAGGAGG + Intronic
911042084 1:93599075-93599097 GCTGGCCACGGTCAGGAAGGTGG - Intronic
912073472 1:105842631-105842653 GCCTGTCAGGGGGTGGGAGGAGG - Intergenic
913671290 1:121098653-121098675 GCCGACAGCTGGCTGGGAGGGGG + Intergenic
914086860 1:144461602-144461624 GCAGGCTATGGGCTGGGCGGCGG - Intronic
914192761 1:145425545-145425567 GCAGGCTATGGGCTGGGCGGCGG - Intergenic
914311749 1:146472611-146472633 GCAGGCTATGGGCTGGGCGGCGG + Intergenic
914590665 1:149103493-149103515 GCAGGCTATGGGCTGGGCGGCGG - Exonic
914921968 1:151853349-151853371 CCTGGCCATGGGCTGGGAAGAGG + Intronic
915033886 1:152906523-152906545 GACTGTCACGGGCTGGGAAGAGG + Intergenic
915463140 1:156081561-156081583 CTCGGCCACGTGCTCGGAGGTGG + Exonic
916115522 1:161482029-161482051 GCATGCCACATGCTGGGAGGTGG - Intergenic
917904622 1:179576136-179576158 GCCGGCCCCGGGCAGGGTGCGGG + Intergenic
918040975 1:180913395-180913417 GCCTCCCACGGGCTCGGAGCTGG + Intronic
919793196 1:201305621-201305643 GAGGGCCAAAGGCTGGGAGGTGG - Intronic
919846902 1:201648267-201648289 GCAGGCCGCGGGCTGGGATCCGG + Exonic
920111335 1:203589398-203589420 GCCGAGCAGGGGCTGGGATGTGG - Intergenic
920872124 1:209803612-209803634 GCAGGGCATGGGCTTGGAGGAGG - Intronic
921743340 1:218710722-218710744 GCCTGCTTCCGGCTGGGAGGCGG - Intergenic
921956180 1:220985281-220985303 GGTTGCCAAGGGCTGGGAGGAGG - Intergenic
923007956 1:230067206-230067228 GCCGGCCGCGGGCGCGGTGGGGG - Exonic
923870543 1:237988778-237988800 GCCTGTCATGGGGTGGGAGGAGG + Intergenic
924514061 1:244751667-244751689 GCCAGCCACGCCCTGGGATGAGG + Intergenic
1062814340 10:488680-488702 GCAGGGCAGGGGCTGGGAGAGGG - Intronic
1062866993 10:864126-864148 GCGGGCCACGGTCTGCGTGGTGG + Exonic
1064384546 10:14878813-14878835 GCCGGCCAGGGGCGGGGCGTCGG + Intronic
1065099524 10:22320614-22320636 GCCGCCCGCGGGCGGGGAAGAGG + Intronic
1066180758 10:32958429-32958451 CCCGGCCCGGGGCTAGGAGGAGG + Intronic
1066685360 10:37976463-37976485 GGCGGGCAGGGCCTGGGAGGCGG - Intronic
1066749223 10:38635713-38635735 GCCTGCAGCGGGCTGGGACGAGG - Intergenic
1066967435 10:42282079-42282101 GCCTGCAGCGGGCTGGGACGAGG + Intergenic
1067100407 10:43330044-43330066 GCCGCCCATCGTCTGGGAGGTGG + Intergenic
1067723637 10:48749860-48749882 GCCTGGCAGGGGCTGGGAGAAGG - Intronic
1068777022 10:60878798-60878820 GCCAGGCACTGCCTGGGAGGTGG + Intronic
1069042964 10:63713590-63713612 GCCTGCCACAGCCTGGGAGAGGG + Intergenic
1069650887 10:70047419-70047441 GCCTGTCATGGGGTGGGAGGAGG + Intergenic
1069942451 10:71964721-71964743 GCCTCCCCCGGGCTGGGCGGCGG - Intronic
1070289671 10:75105912-75105934 CCCACCCACGGGCTGGGATGGGG + Intronic
1070561960 10:77574998-77575020 GCCTCCCAAGGGCTAGGAGGAGG - Intronic
1070604214 10:77887258-77887280 ACAGGCAAAGGGCTGGGAGGTGG - Intronic
1070800664 10:79242976-79242998 GCGGGCGGCGGGCTGGGGGGCGG + Intronic
1073097182 10:100987058-100987080 GCCGGGCTCGGGCTGGAGGGCGG - Intronic
1074504863 10:114060582-114060604 GGTTGCCAGGGGCTGGGAGGAGG + Intergenic
1075256061 10:120926758-120926780 GCCGGCCAGAGGCTGGCAGCAGG + Intergenic
1075971423 10:126657319-126657341 GGCCCCCAGGGGCTGGGAGGAGG - Intronic
1075994793 10:126868572-126868594 GGCTGCCAGGGGCTGGGGGGAGG + Intergenic
1076006835 10:126954595-126954617 GGCTGCCAGGGGCTGGGAGGAGG - Intronic
1076160964 10:128243954-128243976 GCCTGTCGCGGGGTGGGAGGAGG + Intergenic
1076372398 10:129963954-129963976 GACGGCCAGGGGCGCGGAGGCGG + Intergenic
1076372599 10:129964815-129964837 GCGGGCAACGGACTGGGAGGAGG + Intergenic
1076374269 10:129972954-129972976 GCCGGCTGCGGGCCGGGAGGTGG + Intergenic
1076815709 10:132913830-132913852 GCCGGCGGGGGGCTGGGTGGAGG - Intronic
1076851740 10:133096625-133096647 GCAGGCCACGGGAAGAGAGGAGG + Intronic
1076891821 10:133288448-133288470 GCCCGCCACGGCCAGGGAGCAGG + Intronic
1077081366 11:726034-726056 CCCGGGCAGGTGCTGGGAGGCGG + Intronic
1077103034 11:830535-830557 GAGGGCCAGGGGCTGGGAGTGGG - Intronic
1077348235 11:2074499-2074521 GGTGGCCAAGGGCTGGGTGGGGG - Intergenic
1077360401 11:2138127-2138149 GCAGGCCCCGGGCCGGGAGCGGG + Intronic
1078189030 11:9076207-9076229 CCCTGCCAGGGGCAGGGAGGAGG + Intronic
1078245802 11:9573046-9573068 GCTGGACACTGGCTGGGAGGAGG - Intergenic
1078339271 11:10487404-10487426 GCATCCCATGGGCTGGGAGGGGG - Intronic
1078594662 11:12675238-12675260 GCCGGCTCCGGGCTCCGAGGCGG - Intronic
1078599288 11:12716136-12716158 TCCGGCCGAGGGATGGGAGGGGG + Intronic
1078930726 11:15910532-15910554 GCTGGCCAGGAGCAGGGAGGAGG - Intergenic
1079064439 11:17276960-17276982 GCGGGGCACCGGCGGGGAGGGGG + Intronic
1079232862 11:18664748-18664770 GCCTGTCATGGGGTGGGAGGAGG + Intergenic
1079296903 11:19241947-19241969 GCCGGCCTGGGGCTGGGCAGGGG - Intergenic
1080551453 11:33376541-33376563 GCCGGCCACGGCCCGGGCGCCGG - Intergenic
1080628665 11:34052750-34052772 GTGGGCCAGGGGGTGGGAGGAGG - Intronic
1080668584 11:34356997-34357019 GCCGGCGACGGGCTGCGCCGGGG - Exonic
1081621229 11:44620159-44620181 GCTGGCCAGGGGCGGGGAGGAGG + Exonic
1081693557 11:45094420-45094442 GTGGGGCATGGGCTGGGAGGGGG + Intergenic
1081773758 11:45664708-45664730 GCCGGGCCAGGGCTGGGAGCAGG + Intronic
1082828491 11:57598175-57598197 GCGGGCCCCGGGCGGGGTGGGGG + Intronic
1082955224 11:58863579-58863601 GCTGGCCTAGGGCTGGGATGGGG + Intronic
1083253404 11:61482444-61482466 GCAGGGCAGGGGCTGGGAAGGGG - Intronic
1083319993 11:61839768-61839790 GCCTGCCAGGGGCTGAGAGGTGG - Intronic
1083726856 11:64633022-64633044 GCCAGCCATGAGGTGGGAGGTGG - Intronic
1083878055 11:65535092-65535114 GCCAGGCCCAGGCTGGGAGGTGG + Intronic
1084030001 11:66475780-66475802 TGCGGCCACGGGCTGGGCTGGGG - Exonic
1085640243 11:78188789-78188811 GCCGGACACCGGCGGGGACGAGG - Exonic
1085711312 11:78831345-78831367 CCCGGCCAGGAGCTGGGAGCTGG - Intronic
1086401574 11:86465289-86465311 GCAGGCCTGGGGGTGGGAGGTGG + Intronic
1087019684 11:93589641-93589663 GCAGGCCAGGGAGTGGGAGGTGG + Intergenic
1088480639 11:110293690-110293712 GCAGACCACGAGCTGGCAGGTGG - Intronic
1088504300 11:110513673-110513695 GACAGCCAGAGGCTGGGAGGAGG + Intergenic
1088791999 11:113234454-113234476 GGTTGCCAGGGGCTGGGAGGAGG - Intronic
1089832606 11:121341775-121341797 GGTTGCCAGGGGCTGGGAGGAGG + Intergenic
1089853114 11:121517240-121517262 GGCTGCCAGGGGCTGGGAGAAGG - Intronic
1090391390 11:126390850-126390872 GGCTGCCAAGGGCTGGGGGGAGG - Intronic
1090891622 11:130928730-130928752 GCAAGCCACAGGCTGGGAGAAGG - Intergenic
1091759984 12:3080778-3080800 GGCTGCCAGAGGCTGGGAGGAGG - Intronic
1091782122 12:3220557-3220579 CCGGGCCATTGGCTGGGAGGTGG + Intronic
1092715477 12:11384988-11385010 GCCTGCCATGGGTTGGGGGGAGG + Intronic
1094254496 12:28407084-28407106 GCAAGACACGGGGTGGGAGGTGG - Intronic
1096029181 12:48396637-48396659 GCCTGCCGTGGGGTGGGAGGAGG + Intergenic
1096054908 12:48642470-48642492 GCCGCCCATTGTCTGGGAGGTGG + Intergenic
1096054921 12:48642509-48642531 GCCGCCCATCGTCTGGGAGGTGG + Intergenic
1096469930 12:51869453-51869475 GCCGGGAACCGGCGGGGAGGGGG + Intergenic
1096523045 12:52194793-52194815 GCCTGGCAGGGGTTGGGAGGTGG + Intergenic
1099215007 12:79842959-79842981 GGCTGCCAGGGGCTGGAAGGAGG - Intronic
1103712888 12:122926065-122926087 GGCGGCCAGGGGCTGTGTGGAGG + Intronic
1103738363 12:123075314-123075336 GCTAGGCACGGGCTGGGCGGGGG + Intronic
1103915116 12:124372188-124372210 GCCGGCCAAGGGCAAGGACGCGG - Exonic
1104435310 12:128751423-128751445 GCTTGCCAGGGGCTGGGAGAGGG + Intergenic
1104594912 12:130114364-130114386 GCGTGCCACGGGCTGGGTGAGGG + Intergenic
1105405322 13:20128183-20128205 GCCGGCCAGGGCCCGGGCGGAGG + Intergenic
1106308400 13:28532840-28532862 GCCGGCGGAGGGCGGGGAGGTGG - Intergenic
1106776775 13:33016655-33016677 GCCGCCCTCGGTCTGGTAGGCGG - Exonic
1107604003 13:42040735-42040757 GCTGGCCCCGGGCGGGGAGCCGG + Intronic
1107696013 13:43001001-43001023 GCAGGCCAGGGGCTAGGATGAGG + Intergenic
1108382384 13:49866949-49866971 GGTTGCCAGGGGCTGGGAGGAGG - Intergenic
1109219328 13:59625528-59625550 GCTGGACATGGGCTGGGAGCTGG - Intergenic
1111672588 13:91348436-91348458 GCAGGCCGCGGGCCGGGAGGGGG + Intergenic
1112018265 13:95349430-95349452 GGATGCCACGGGGTGGGAGGAGG - Intergenic
1112410638 13:99160524-99160546 TCCAGCCATGGGCTGGGACGAGG + Intergenic
1112651981 13:101409457-101409479 GGTGGCCAGGGGCTGGGAGGAGG - Intronic
1113492829 13:110705943-110705965 GCAGCCCACGGGCCGGGAGACGG - Exonic
1113747792 13:112756891-112756913 GCAGGCCCCGCGCTGGGAGCAGG - Intronic
1114368187 14:22053455-22053477 GGCTGCCAGAGGCTGGGAGGAGG - Intergenic
1116945440 14:50831160-50831182 GCCGGGCCCGCGCGGGGAGGAGG + Intergenic
1117156828 14:52950652-52950674 GCCGGCCACGGGCTGGGAGGTGG + Intronic
1118984537 14:70742321-70742343 GCCGGGGACTGGCTGGGAAGTGG - Intronic
1119622090 14:76138881-76138903 GCCGGCCCGGGGCGCGGAGGAGG - Intergenic
1121252935 14:92513419-92513441 GCCGACCGCGGGCCGGCAGGTGG - Intergenic
1121696564 14:95917971-95917993 TCCTGCCAGGGGCTGGGTGGAGG - Intergenic
1122162265 14:99793233-99793255 GCGGGGCCCGGGCCGGGAGGGGG - Intronic
1122166601 14:99829635-99829657 GGTTACCACGGGCTGGGAGGCGG - Intronic
1122694726 14:103547071-103547093 GCAGGCCAGGGGCTGTGTGGAGG + Intergenic
1122717724 14:103705621-103705643 GCGGGCCAGGGGAAGGGAGGGGG - Intronic
1122875785 14:104664257-104664279 GCCAGCCTGGGGCTTGGAGGAGG + Intergenic
1122929331 14:104926198-104926220 GCTGGCCCCTGGCTGGGATGGGG - Intronic
1122931102 14:104933428-104933450 GCCCGGCGCGGGGTGGGAGGTGG - Exonic
1122962816 14:105105428-105105450 GCCTGCCAGGAGCTGGGAGGAGG + Intergenic
1124117838 15:26864306-26864328 GGTTGCCACGGGCTGGGAGAAGG - Intronic
1124249346 15:28096939-28096961 CCTGGCCCCGGGCTGGGAGCGGG - Intronic
1124378491 15:29144034-29144056 GCTGGCCATGGTGTGGGAGGAGG + Intronic
1124853119 15:33360280-33360302 GACGGCCTGGGGCTGGGAGTGGG - Intronic
1126688360 15:51267531-51267553 GCCGGCCACGGACGTGGGGGCGG - Intronic
1126868928 15:52966811-52966833 GATTGCCAGGGGCTGGGAGGGGG + Intergenic
1128119197 15:65133432-65133454 GGCGGCCCCGGGCCGGGAGGCGG + Exonic
1128737688 15:70062532-70062554 GCCCGCCTCTGGCTGGCAGGCGG + Intronic
1129082313 15:73052182-73052204 GCCCGCCACGGCCCGAGAGGCGG + Intronic
1129424571 15:75454514-75454536 GGCGGCCGCGGGCGGGTAGGCGG - Intronic
1129528392 15:76239545-76239567 GGCTTCCAGGGGCTGGGAGGTGG - Intronic
1129759145 15:78118839-78118861 GGTTGCCAGGGGCTGGGAGGAGG - Intronic
1130908425 15:88255608-88255630 GCCAGCAACTGGTTGGGAGGCGG + Intronic
1131153711 15:90062367-90062389 GGCGACCACTGGCTGGGATGTGG - Intronic
1131259230 15:90879991-90880013 GCTGGACCCAGGCTGGGAGGGGG + Intronic
1132321271 15:100927252-100927274 TCCTGCCACGAGCTTGGAGGTGG - Intronic
1132656632 16:1044294-1044316 GCCGGCCAGGGGCGTGGGGGCGG - Intergenic
1132663773 16:1072738-1072760 CCCGGGCGCCGGCTGGGAGGGGG - Intergenic
1132816021 16:1826961-1826983 GACTGCCACGGGCCGGGAGACGG + Exonic
1132989449 16:2785436-2785458 GCCGGGCACGGGCAGGCAGACGG + Exonic
1133010173 16:2906043-2906065 AATGGCCACGGGCTGGGCGGTGG + Intergenic
1133113187 16:3561823-3561845 CCCGCCCACGGGCAGGGTGGGGG + Intronic
1133802454 16:9094525-9094547 GACTGCCAGGGACTGGGAGGTGG - Intronic
1134044958 16:11094170-11094192 GACAGCCACAGGCTGGGAAGGGG - Intronic
1135250992 16:20900826-20900848 GCCCGCGGCGGGCTGGGAGGAGG - Intronic
1135757006 16:25106909-25106931 GCTGGCCTCGGGCTGGGCTGTGG + Intergenic
1136251749 16:29009741-29009763 GCTGGCAAGGGGCTGAGAGGAGG + Intergenic
1136455595 16:30378222-30378244 GCAGGCCCCGGGCCGGGAAGTGG + Exonic
1136478596 16:30527458-30527480 GCCGTCCGCGGGGTTGGAGGAGG - Intronic
1136779002 16:32885606-32885628 GCCGGCCGGGGGCCGGGGGGCGG + Intergenic
1136891616 16:33975912-33975934 GCCGGCCGGGGGCCGGGGGGCGG - Intergenic
1137617462 16:49856155-49856177 GCCGGCGGGGGGTTGGGAGGAGG - Intronic
1139349241 16:66325020-66325042 GCCAGCCACAGCCAGGGAGGAGG + Intergenic
1139446134 16:66999935-66999957 GAGGCCCACGGGCTTGGAGGTGG + Intronic
1139490653 16:67284307-67284329 GCCGCTGACTGGCTGGGAGGCGG + Exonic
1139839661 16:69868197-69868219 GCTGGCCACGGGCAGGGAGGTGG + Intronic
1139952768 16:70680106-70680128 CCCGGCCTCGGGCCAGGAGGGGG + Intronic
1140455571 16:75103493-75103515 GGTGGCCAGGGGCTGGGCGGGGG + Intronic
1140478724 16:75251425-75251447 GCCGCGTACGGGCTTGGAGGCGG - Intronic
1141169386 16:81681456-81681478 TCCGGTCCCAGGCTGGGAGGTGG + Intronic
1141536075 16:84680802-84680824 GGCTGCCAGGGGCTGGGAGATGG + Intergenic
1141628379 16:85273632-85273654 TGCTGCCAGGGGCTGGGAGGAGG + Intergenic
1141831134 16:86510504-86510526 GCCGCGGACGGGCCGGGAGGAGG - Intergenic
1141998297 16:87648652-87648674 CCCGGCCCTGGGCTGGGAGAGGG + Intronic
1142009300 16:87705777-87705799 GCCGGGCAGGGCCTGGGCGGGGG + Intronic
1142177198 16:88650772-88650794 TCAGGCCGCGGGCTGGAAGGAGG - Intronic
1142349777 16:89574815-89574837 GGCAGCCTCGGCCTGGGAGGAGG - Intergenic
1142414746 16:89935264-89935286 GGCTGCCCCGGGCTGTGAGGGGG - Exonic
1203081413 16_KI270728v1_random:1147695-1147717 GCCGGCCGGGGGCCGGGGGGCGG + Intergenic
1142500719 17:331484-331506 GCCAGCCACGGCCAGGGTGGGGG - Intronic
1142607850 17:1091800-1091822 GGTGAGCACGGGCTGGGAGGTGG + Exonic
1143470731 17:7173780-7173802 TACGGCCACGGGCTCGGAGGAGG - Exonic
1143966331 17:10759062-10759084 GGCGGGTAGGGGCTGGGAGGCGG - Intergenic
1143966339 17:10759080-10759102 GGCGGGTAGGGGCTGGGAGGCGG - Intergenic
1143966347 17:10759098-10759120 GGCGGGTAGGGGCTGGGAGGCGG - Intergenic
1143966361 17:10759134-10759156 GGCGGGTAGGGGCTGGGAGGCGG - Intergenic
1143966369 17:10759152-10759174 GGCGGGTAGGGGCTGGGAGGCGG - Intergenic
1143966384 17:10759188-10759210 GGCGGGTAGGGGCTGGGAGGCGG - Intergenic
1143966406 17:10759242-10759264 GGCGGGTAGGGGCTGGGAGGCGG - Intergenic
1143966420 17:10759278-10759300 GGCGGGTAGGGGCTGGGAGGCGG - Intergenic
1143966428 17:10759296-10759318 GGCGGGTAGGGGCTGGGAGGCGG - Intergenic
1143966436 17:10759314-10759336 GGCGGGTAGGGGCTGGGAGGCGG - Intergenic
1143966456 17:10759368-10759390 GGCGGGTAGGGGCTGGGAGGCGG - Intergenic
1143966470 17:10759404-10759426 GGCGGGTAGGGGCTGGGAGGCGG - Intergenic
1143966478 17:10759422-10759444 GGCGGGTAGGGGCTGGGAGGCGG - Intergenic
1143966486 17:10759440-10759462 GGCGGGTAGGGGCTGGGAGGCGG - Intergenic
1143966500 17:10759476-10759498 GGCGGGTAGGGGCTGGGAGGCGG - Intergenic
1143966508 17:10759494-10759516 GGCGGGTAGGGGCTGGGAGGCGG - Intergenic
1143966516 17:10759512-10759534 GGCGGGTAGGGGCTGGGAGGCGG - Intergenic
1144002590 17:11069657-11069679 GGTTGCCAGGGGCTGGGAGGAGG - Intergenic
1144767776 17:17742104-17742126 GCCGGCTCTGGGGTGGGAGGTGG + Intronic
1144999292 17:19292250-19292272 GCCCGCCCGGGGCTGAGAGGTGG + Intronic
1146022627 17:29292873-29292895 GCCGGCGACGGGGGGGGGGGCGG + Intronic
1146201326 17:30861200-30861222 GGAGGCCAAGGGCGGGGAGGGGG - Intronic
1146393571 17:32444365-32444387 GCCGGGCGCGGGCTGAGGGGTGG - Exonic
1146645111 17:34572005-34572027 GCTGGCCACGGGGTGGGGGATGG + Intergenic
1147758356 17:42782431-42782453 GCCGGCCATGGGGCGGGAGGGGG - Intronic
1147992554 17:44343994-44344016 GCCTGGCACGGGCTGGGCTGTGG - Intergenic
1148090909 17:45022056-45022078 GCCGCCCGCGGCCTGGGAGGAGG + Intergenic
1148732432 17:49845652-49845674 GCCTGCCAGGAGCTGGGAGCTGG + Intronic
1148779446 17:50113174-50113196 GCAGGTCACGGTGTGGGAGGCGG - Intronic
1149314070 17:55422107-55422129 GCCGGGCTCGGGCAGCGAGGCGG + Intergenic
1149428783 17:56580016-56580038 GGTTGCCAAGGGCTGGGAGGAGG - Intergenic
1149925102 17:60694900-60694922 GGTTGCCAGGGGCTGGGAGGAGG - Intronic
1150315100 17:64162676-64162698 CCCTGCCAGGAGCTGGGAGGTGG + Intronic
1150317570 17:64182302-64182324 GGTTGCCAGGGGCTGGGAGGAGG + Intronic
1150641478 17:66952785-66952807 GCCGGGCAGGGCCTGGGATGGGG - Intergenic
1151428461 17:74046790-74046812 GGTGGCCAGGGGCTGGGAGTGGG - Intergenic
1151971274 17:77458697-77458719 GGCAGCCACGGGCTGAGTGGCGG + Intronic
1152343710 17:79739025-79739047 GACGGCCACAGGCAGGGACGAGG + Intronic
1152458230 17:80428079-80428101 GTGGGCCACAGGCTGGGATGGGG - Intronic
1152517530 17:80834547-80834569 TCCAGCCCCGGGGTGGGAGGCGG - Intronic
1152597257 17:81243838-81243860 CGGGGCCAGGGGCTGGGAGGGGG - Intergenic
1152747594 17:82048554-82048576 GCCCACCAGGGGCTGGGAGAGGG + Exonic
1152783736 17:82237604-82237626 GCCGGCCGCGGGCTTCGTGGCGG + Exonic
1152786126 17:82248986-82249008 GCCGGAGACGGGCCGGGGGGAGG + Exonic
1153094545 18:1385364-1385386 GCCTGTCATGGGGTGGGAGGAGG + Intergenic
1153174382 18:2354479-2354501 GGTGGCCAGGGGCTTGGAGGAGG - Intergenic
1153810205 18:8745898-8745920 GGTTGCCAGGGGCTGGGAGGAGG - Intronic
1153958043 18:10114992-10115014 GCCAGCCAGGGGCTGGAAGATGG + Intergenic
1154943559 18:21138017-21138039 GCCGCCCAACGTCTGGGAGGTGG - Intergenic
1155478413 18:26259432-26259454 GCCTGTCGCGGGGTGGGAGGAGG - Intronic
1156255578 18:35392758-35392780 GGTGGTCAAGGGCTGGGAGGTGG - Intergenic
1157473746 18:48008478-48008500 GCCGGCCAGGTGCGGGGAGGAGG - Intergenic
1157720495 18:49920139-49920161 GCTTGCCAGGGGCTGGGAGTGGG + Intronic
1157849009 18:51030365-51030387 GCCGCCCAGGGGGTGGGAGCGGG + Exonic
1158170242 18:54590173-54590195 GGTTGCCAGGGGCTGGGAGGAGG - Intronic
1159452617 18:68621576-68621598 GCCTGTCAGGGGCTGGGAGGAGG + Intergenic
1159918173 18:74204132-74204154 GCCAGCTATGGGCTGGGAGGTGG + Intergenic
1160535364 18:79588766-79588788 TCCGTGCAGGGGCTGGGAGGGGG - Intergenic
1160703307 19:518234-518256 GCTGGGTAGGGGCTGGGAGGAGG + Intronic
1160703333 19:518298-518320 GCTGGGTAGGGGCTGGGAGGAGG + Intronic
1160703375 19:518399-518421 GCTGGGTAGGGGCTGGGAGGAGG + Intronic
1160877188 19:1302195-1302217 GCCCACCTAGGGCTGGGAGGGGG + Intergenic
1160909704 19:1468943-1468965 TCTGGGCAGGGGCTGGGAGGCGG - Exonic
1160965852 19:1746594-1746616 GCAGGCCTGGAGCTGGGAGGTGG + Intergenic
1161025440 19:2034706-2034728 CCCGACCACGGCCGGGGAGGGGG - Intronic
1161153529 19:2721278-2721300 GGCGGCCCGGGGCGGGGAGGGGG - Intronic
1161155816 19:2731521-2731543 GCAGGGCACGGGATGGGAGAAGG + Intronic
1161266360 19:3366521-3366543 GCCGGCCGCGGGGCGGGGGGGGG + Intronic
1161895174 19:7074746-7074768 GCAGGGCACGGGCTGGAGGGGGG + Intronic
1161955360 19:7491193-7491215 GGTTGCCAGGGGCTGGGAGGAGG - Intronic
1162038006 19:7952945-7952967 GCCGGCCACGGGCTGTGGGTTGG + Intergenic
1162127213 19:8506111-8506133 GCGGGCCAGGAGCGGGGAGGTGG - Intergenic
1162181849 19:8874929-8874951 GGTTGCCAGGGGCTGGGAGGAGG + Intronic
1162396404 19:10420336-10420358 CCCCGCTCCGGGCTGGGAGGGGG - Intronic
1162414523 19:10527081-10527103 GCTTGCCATGGGTTGGGAGGCGG - Intergenic
1162421624 19:10568851-10568873 GACGGCGAGGGGCTGGGAGCCGG + Exonic
1162504429 19:11074730-11074752 GTGTGCCACGGGCTGGGAGGGGG + Intergenic
1162805049 19:13133435-13133457 GGTTGCCAGGGGCTGGGAGGCGG - Intronic
1162934198 19:13973001-13973023 GCTGGCCACCGCCTGGGAGGTGG + Exonic
1163026904 19:14517961-14517983 GGCGGCCGCGCGGTGGGAGGAGG - Intronic
1163610940 19:18301254-18301276 GCCAGGCCCAGGCTGGGAGGCGG + Intergenic
1163634157 19:18430750-18430772 GCCGGCCACCTGCAGAGAGGGGG + Intronic
1163803989 19:19385380-19385402 GCCGGCAACTGGCTGGGCAGGGG - Intergenic
1164942013 19:32257921-32257943 GATGGGCATGGGCTGGGAGGTGG - Intergenic
1165511862 19:36270753-36270775 GCCGGCGGCGGGCTGGGGGTGGG + Intergenic
1165512141 19:36271935-36271957 GCCGCCCACGGGCACGCAGGCGG - Intergenic
1165512414 19:36273254-36273276 GCCGGCGGCGGGCTGGGGGTGGG + Intergenic
1165512961 19:36275795-36275817 GCCGGCGGCGGGCTGGGGGTGGG + Intergenic
1165513517 19:36278350-36278372 GCCGGCGGCGGGCTGGGGGTGGG + Intergenic
1165514067 19:36280884-36280906 GCCGGCGGCGGGCTGGGGGTGGG + Intergenic
1165514619 19:36283421-36283443 GCCGGCGGCGGGCTGGGGGTGGG + Intergenic
1165515171 19:36285954-36285976 GCCGGCGGCGGGCTGGGGGTGGG + Intergenic
1165515721 19:36288490-36288512 GCCGGCGGCGGGCTGGGGGTGGG + Intergenic
1165516272 19:36291027-36291049 GCCGGCGGCGGGCTGGGGGTGGG + Intergenic
1165516824 19:36293553-36293575 GCCGGCGGCGGGCTGGGGGTGGG + Intergenic
1165517377 19:36296076-36296098 GCCGGCGGCGGGCTGGGGGTGGG + Intergenic
1165517929 19:36298611-36298633 GCCGGCGGCGGGCTGGGGGTGGG + Intergenic
1165518480 19:36301146-36301168 GCCGGCGGCGGGCTGGGGGTGGG + Intergenic
1165519029 19:36303678-36303700 GCCGGCGGCGGGCTGGGGGTGGG + Intergenic
1165519579 19:36306193-36306215 GCCGGCGGCGGGCTGGGGGTGGG + Intergenic
1165520129 19:36308721-36308743 GCCGGCGGCGGGCTGGGGGTGGG + Intergenic
1165623939 19:37269860-37269882 GCCGGCGGCGGGCTGGGGGTGGG - Intergenic
1165624485 19:37272401-37272423 GCCGGCGGCGGGCTGGGGGTGGG - Intergenic
1165625028 19:37274928-37274950 GCCGGCGGCGGGCTGGGGGTGGG - Intergenic
1165626102 19:37279991-37280013 GCCGGCGGCGGGCTGGGGGTGGG - Intergenic
1165626643 19:37282518-37282540 GCCGGCGGCGGGCTGGGGGTGGG - Intergenic
1165627183 19:37285039-37285061 GCCGGCGGCGGGCTGGGGGTGGG - Intergenic
1165628262 19:37290091-37290113 GCCGGCGGCGGGCTGGGGGTGGG - Intergenic
1165628802 19:37292616-37292638 GCCGGCGGCGGGCTGGGGGTGGG - Intergenic
1165629344 19:37295142-37295164 GCCGGCGGCGGGCTGGGGGTGGG - Intergenic
1165629885 19:37297667-37297689 GCCGGCGGCGGGCTGGGGGTGGG - Intergenic
1165630428 19:37300195-37300217 GCCGGCGGCGGGCTGGGGGTGGG - Intergenic
1165630965 19:37302733-37302755 GCCGGCGGCGGGCTGGGGGTGGG - Intergenic
1165812249 19:38618617-38618639 GCCGGGCAGGGGCTGGGGTGAGG - Intronic
1165861668 19:38912259-38912281 CCCCGCCGCGGGCGGGGAGGGGG - Intergenic
1166043123 19:40215016-40215038 GCCGGCGGCGGGCTGGGAACAGG - Exonic
1166354066 19:42216965-42216987 CCCGGCCCCGTGCTGGGAGGAGG - Exonic
1166628215 19:44380503-44380525 GGCTGCCAGTGGCTGGGAGGAGG + Intronic
1166930409 19:46298366-46298388 GCCGGCCTTGGGTGGGGAGGGGG - Intronic
1166996779 19:46723196-46723218 GGAGGCCAGGCGCTGGGAGGTGG + Exonic
1167074771 19:47241304-47241326 CCCGGGGAAGGGCTGGGAGGGGG + Intergenic
1167303836 19:48695870-48695892 GCCGGCAATGGGGAGGGAGGAGG + Intergenic
1167556020 19:50196195-50196217 GCAGGGCATGGGATGGGAGGAGG + Intronic
1167618424 19:50548656-50548678 GCAGGCCACGGGGCAGGAGGTGG + Exonic
1167903243 19:52637839-52637861 GCCCGCCACGAGGAGGGAGGTGG + Intronic
1168401682 19:56088984-56089006 GGCGGCCGCGGCCGGGGAGGCGG + Exonic
925313794 2:2906764-2906786 GGCGGCTGCGGGCTGGGAAGAGG - Intergenic
925592021 2:5519387-5519409 GCCTGCCAGGAGCAGGGAGGTGG + Intergenic
925991282 2:9256926-9256948 TGCAGCCAAGGGCTGGGAGGGGG + Intronic
926738286 2:16090803-16090825 GCTGTCCACGGGCTCAGAGGAGG + Intergenic
926889515 2:17627128-17627150 GGCAGCCACGGGCTGTGATGTGG - Intronic
927125943 2:20012533-20012555 GCGGGCCACGGGGTCGGGGGCGG + Exonic
927236608 2:20880610-20880632 GCTGGCCACAGCCAGGGAGGTGG - Intergenic
927714084 2:25341531-25341553 GCCGGGCGGGGGCGGGGAGGGGG + Intronic
927851694 2:26503695-26503717 GCCGGGCAGGGGCTGGAAAGCGG + Intronic
927941249 2:27104246-27104268 CAGGGCCAAGGGCTGGGAGGAGG - Intronic
928493482 2:31807490-31807512 GCCTGCCAGGGGGTGGGTGGAGG + Intergenic
929488221 2:42373757-42373779 GGTTGCCAGGGGCTGGGAGGAGG - Intronic
929588624 2:43131332-43131354 GCCAGCCCCGGGCTCAGAGGTGG - Intergenic
931442031 2:62296783-62296805 GCCAGCCACGCCCAGGGAGGGGG + Intergenic
931665633 2:64608213-64608235 GCAGGCCAGGGGCTGCGAGGTGG - Intergenic
931668235 2:64625289-64625311 GGCGTCCACTGCCTGGGAGGAGG - Intergenic
934312218 2:91877849-91877871 GCCCGCAGCGGGCTGGGACGAGG - Intergenic
934341352 2:92271218-92271240 GGTTGCCAGGGGCTGGGAGGAGG + Intergenic
934778034 2:96951243-96951265 GCTGGGCTCAGGCTGGGAGGAGG - Intronic
934994501 2:98944915-98944937 GCAGGCCACAGACTGGGAGAAGG - Intergenic
936224614 2:110636639-110636661 GCCTGCCGTGGGGTGGGAGGAGG + Intergenic
937825243 2:126361819-126361841 GGTTGCCAGGGGCTGGGAGGAGG + Intergenic
940620510 2:156107056-156107078 GCCTGTCATGGGGTGGGAGGAGG + Intergenic
940852385 2:158700960-158700982 GCCAGACATGGGGTGGGAGGAGG + Intergenic
941021028 2:160407912-160407934 GCCGGCCGGGGGCGGGGAGGCGG + Intronic
941384942 2:164841389-164841411 GGCGCCCGCGGGCTGGGAGCCGG - Exonic
941842601 2:170103036-170103058 GCCTGTCAGGGGCTGGGGGGAGG - Intergenic
941951546 2:171161023-171161045 ACCTGCCAGGGGCTGGGGGGTGG + Intronic
942046120 2:172100448-172100470 GGCGGCAGCGGGCCGGGAGGAGG + Exonic
942629780 2:177942878-177942900 GGTTGCCAGGGGCTGGGAGGAGG - Intronic
943609982 2:190020756-190020778 GGCTGCCAGGGGCTGGAAGGAGG - Intronic
944170748 2:196773938-196773960 GCAGGCCACGGGCTGGTACCGGG + Intronic
944743751 2:202635691-202635713 GCCGGACGCGGGCTGGGGGTGGG - Exonic
946315595 2:218909318-218909340 GCCGGCCACGCGCCGTGAGCCGG + Intergenic
946335176 2:219031148-219031170 GCAGGCCACGTGCTGGTACGGGG - Exonic
946402381 2:219475411-219475433 GTCCCCCATGGGCTGGGAGGTGG - Intronic
947537265 2:230948095-230948117 GGCGGCCAGGGGGTGGGCGGCGG - Intronic
947670742 2:231933983-231934005 GCAGGCAGTGGGCTGGGAGGTGG - Intergenic
947802828 2:232942165-232942187 GCCAGCCACTGGATGGGATGGGG - Intronic
948424441 2:237878286-237878308 GAGGGCCAGGGGCAGGGAGGAGG + Intronic
948935071 2:241158638-241158660 GCCGCCCACAGGCTGGGACAAGG - Intronic
1169234671 20:3921199-3921221 GCCTGCCATGGGGTGGGGGGAGG - Intronic
1169940607 20:10933302-10933324 GCCTGCCAGGGGCGGGGTGGGGG + Intergenic
1170574798 20:17654154-17654176 GCCGGCCCTGGGATGTGAGGAGG - Intronic
1171136874 20:22702592-22702614 GCAGGTCACGGACTGGGAGCTGG - Intergenic
1171140828 20:22740615-22740637 GCCTGCCATGGGGTGGGGGGAGG + Intergenic
1171295962 20:24017434-24017456 GGCTGCCAGGGGCTGGGAGGGGG - Intergenic
1171406001 20:24912921-24912943 GCTGGCCACAGGAGGGGAGGTGG - Intergenic
1171469480 20:25358645-25358667 GCAGGCCTCAGGCTAGGAGGTGG + Intronic
1172015223 20:31869430-31869452 AGCGGCCCCAGGCTGGGAGGGGG - Intronic
1172379292 20:34475041-34475063 GCCGCCCATGGTCTGGGATGTGG - Intronic
1172834689 20:37865510-37865532 GGCTGCCAGGGGCTGGGGGGAGG - Intronic
1172841098 20:37903186-37903208 GCCGGGCGAGGGCTGGGAGCTGG + Exonic
1173430342 20:42982243-42982265 GCCGGCACGGGGCTGGGTGGTGG + Intronic
1173530562 20:43766455-43766477 GCTGGAGTCGGGCTGGGAGGAGG - Intergenic
1174075434 20:47932203-47932225 GCCTGGCAGAGGCTGGGAGGTGG + Intergenic
1174088144 20:48025030-48025052 GCTGGCCCCTGGCTGGGAGATGG + Intergenic
1175504821 20:59474312-59474334 ACCGTCCATGGGCAGGGAGGGGG - Intergenic
1175825185 20:61933144-61933166 GCCGGCCTCGCGTGGGGAGGCGG - Intronic
1175873839 20:62220361-62220383 GCCGGCGCCGGGCGGGGCGGGGG - Intergenic
1175964535 20:62653882-62653904 GCCTGCCATGGGGTGGGGGGAGG + Intronic
1175970589 20:62684844-62684866 CACGGCCATGGGGTGGGAGGTGG - Intronic
1176164932 20:63667907-63667929 GCCGGGCACGCGCTGGGAAGAGG - Intronic
1176164941 20:63667942-63667964 GCCGGGCACATGCTGGGAGGGGG - Intronic
1176165006 20:63668152-63668174 GCCGGGCACACACTGGGAGGAGG - Intronic
1176178972 20:63740841-63740863 GCCTGGCAGGGGTTGGGAGGTGG - Intronic
1176305341 21:5120307-5120329 GCCAGCCAGGGGCTGTTAGGCGG - Intronic
1176371416 21:6064127-6064149 GGCTGCCAGGGGTTGGGAGGAGG - Intergenic
1177157349 21:17512983-17513005 GCCGAGCGGGGGCTGGGAGGAGG + Exonic
1178457770 21:32771542-32771564 GCCGGGCACGGGCGAAGAGGCGG - Exonic
1178610219 21:34073446-34073468 GCCGCCCGCGGGCGGAGAGGGGG + Intronic
1178992379 21:37366692-37366714 GCCGGCTCGGGGCTGGGGGGCGG + Intronic
1179209530 21:39313493-39313515 GCCGGGCGCGGGGCGGGAGGCGG + Exonic
1179547213 21:42120844-42120866 TCTGGCCCAGGGCTGGGAGGGGG - Intronic
1179752103 21:43474412-43474434 GGCTGCCAGGGGTTGGGAGGAGG + Intergenic
1179810543 21:43866370-43866392 GCCTGCTGGGGGCTGGGAGGTGG + Intronic
1179851714 21:44141724-44141746 GCCAGCCAGGGGCTGTTAGGCGG + Intronic
1179999519 21:44989059-44989081 GCAGGGCAGGGGCAGGGAGGTGG - Intergenic
1180003242 21:45004577-45004599 GCCTGCCCGGGGCTGGGAGGAGG - Intergenic
1180163111 21:46006813-46006835 GCCTGGCAGGGGCTGGGAGGAGG + Intergenic
1180178061 21:46099652-46099674 GCGGGGCACTGGCTGGGACGGGG + Intronic
1180188943 21:46153683-46153705 GCTGGCCAGGGGCTGGGCTGTGG - Intronic
1180538975 22:16423665-16423687 GCCCGCAGCGGGCTGGGATGAGG - Intergenic
1180720945 22:17907977-17907999 GCTGGACAGAGGCTGGGAGGTGG + Intronic
1181522612 22:23458313-23458335 GCCAGCCCTGGGTTGGGAGGAGG + Intergenic
1181583074 22:23838528-23838550 TGCGGACACGGGCTGGGTGGAGG - Intronic
1182338855 22:29603532-29603554 GCAGGCCCCGGGCTGTGGGGAGG + Intergenic
1182394635 22:30026462-30026484 GCAGGCGAGGGGCTGGGAGTGGG + Exonic
1182896001 22:33859946-33859968 GCTTGCCAGGGGCTGGGAGGAGG + Intronic
1183284560 22:36953768-36953790 GCTGGCCATGGGCTGGGGTGGGG + Intergenic
1183591446 22:38781433-38781455 GCCCTCCAGGAGCTGGGAGGAGG - Intronic
1183605836 22:38866380-38866402 CCCAGCCTCGGGCTCGGAGGAGG + Exonic
1183876764 22:40789329-40789351 ACCAGCCACGGGGTGGGAAGGGG + Intronic
1183991705 22:41601256-41601278 GCTGCCCACGGGTAGGGAGGAGG + Intronic
1184247703 22:43244156-43244178 GCGGGGCATGGGCTGGGAGGTGG - Intronic
1184389846 22:44197016-44197038 GCAGGCCCCGGGCTGGCAGCCGG - Intronic
1184677899 22:46053643-46053665 GCCGGCCAGGGGCTGGGGGCTGG + Intronic
1184766952 22:46577132-46577154 CCCGGCCACGAGCGCGGAGGCGG - Intronic
1184986905 22:48141897-48141919 GCAGGACACGGGGTGGGGGGCGG + Intergenic
950138661 3:10600664-10600686 CCGGGCCAGGGGCAGGGAGGGGG - Intronic
950437241 3:12987260-12987282 GCAGGCTGTGGGCTGGGAGGTGG - Intronic
950521773 3:13501774-13501796 GCTGGCGAGGGGCGGGGAGGGGG - Intronic
950729780 3:14947596-14947618 GCCGCCCGCGCGCTGGTAGGAGG - Intronic
952241320 3:31533328-31533350 GCGGGCCACGGGCGGGGGAGGGG - Intronic
952874118 3:37927851-37927873 GGCTGCCAAGGGCTGGGAGGAGG - Intronic
954412781 3:50378243-50378265 GGAAGCCAGGGGCTGGGAGGAGG + Intronic
955341818 3:58130797-58130819 GCCGGCCCCGGGCTGGGCTCAGG + Exonic
955368784 3:58333124-58333146 GGCGGCCCCGGGCCGCGAGGGGG + Intronic
957074082 3:75587908-75587930 GCCGGCCCCGGGCAGTGAGGGGG + Intergenic
958183312 3:90086525-90086547 GGCGGGCAGGGGCGGGGAGGGGG - Intergenic
959624608 3:108435472-108435494 GGTTGCCAAGGGCTGGGAGGAGG - Intronic
960612014 3:119563328-119563350 GCCTGTCATGGGCTGGGGGGAGG - Intergenic
960659902 3:120046058-120046080 GGTGGCCAGGGGATGGGAGGAGG + Intronic
961197855 3:125018349-125018371 GATTGCCAGGGGCTGGGAGGAGG + Intronic
961372780 3:126441454-126441476 GGGGGCCTCGGGCAGGGAGGCGG + Intronic
961469775 3:127104304-127104326 GGGTGCCAGGGGCTGGGAGGAGG - Intergenic
961634831 3:128326630-128326652 GCCAGCCCTGGGCTGAGAGGAGG - Intronic
961829805 3:129617681-129617703 GCCCGCCAGGGGCTGTGAGCTGG - Intergenic
965648283 3:170908152-170908174 GGCGGCCGAGGGCTGGGCGGCGG - Intronic
966862802 3:184239843-184239865 GCAGCCCATGTGCTGGGAGGTGG + Exonic
968213338 3:196867793-196867815 GGCGGCCCCGGGTCGGGAGGCGG + Intergenic
968258147 3:197297888-197297910 GCGGGCCCCGGGCGGGGCGGGGG - Intronic
968514202 4:1009629-1009651 GCCGGCCGCGGGCTGGGACGTGG + Intergenic
968737454 4:2304711-2304733 CTCGGCCACGGGCTCCGAGGCGG + Exonic
968756337 4:2418176-2418198 GCCGGCCACGGACAGGGAAAGGG + Intronic
969568769 4:7995839-7995861 GCCGAGGAGGGGCTGGGAGGGGG - Intronic
969690699 4:8702539-8702561 GGTGGCCAGGGACTGGGAGGAGG + Intergenic
969705395 4:8788847-8788869 GAGGACCACAGGCTGGGAGGAGG + Intergenic
969961780 4:10952015-10952037 CCCTGCCATGGCCTGGGAGGTGG - Intergenic
970030087 4:11664356-11664378 GCCTGTCGGGGGCTGGGAGGAGG + Intergenic
971250750 4:24971334-24971356 GACGCCCTCGGCCTGGGAGGTGG + Intronic
974753546 4:66172828-66172850 GCCTGCCAGGGGCTGGGAGTGGG - Intergenic
974877764 4:67718302-67718324 CCTGGCCAGGGGCTGGGAGCAGG + Intergenic
975650283 4:76586172-76586194 GCCGGCGATTGGCCGGGAGGAGG + Intronic
975784975 4:77877890-77877912 GCCTGCAACTGGCTGGGGGGTGG + Intronic
976435496 4:85013165-85013187 GCCTGTCATGGGGTGGGAGGAGG - Intergenic
976805752 4:89044901-89044923 GGCTACCAGGGGCTGGGAGGTGG + Intronic
977941967 4:102868969-102868991 GGCGGCCTCGGCCTGGGCGGCGG - Exonic
978130336 4:105188346-105188368 GATTGCCAGGGGCTGGGAGGAGG + Intronic
978254893 4:106681705-106681727 GCCGGCCCCGGGCAGTGAGGAGG - Intergenic
979205550 4:118033572-118033594 GCGGGCCGGGAGCTGGGAGGCGG + Intergenic
979317514 4:119281978-119282000 GATTGCCAAGGGCTGGGAGGAGG - Intronic
982770198 4:159390265-159390287 GGTGGCCACGGGGTGGGGGGTGG - Intergenic
983631876 4:169857416-169857438 GGTTGCCAGGGGCTGGGAGGAGG + Intergenic
984308354 4:178023855-178023877 GCCTGTCACGGGGTGGGGGGAGG + Intergenic
984502170 4:180570477-180570499 CCCTGCCAGGGGCTGGGCGGTGG + Intergenic
984734902 4:183099524-183099546 GCTGCCCCGGGGCTGGGAGGAGG + Exonic
985059621 4:186064054-186064076 GGCTGTCAGGGGCTGGGAGGAGG + Intergenic
985784024 5:1884978-1885000 CCGGGCCAAGGGCTGGGATGGGG + Intronic
986164494 5:5261932-5261954 GCTGGCCAGGGTCTTGGAGGAGG - Intronic
986721256 5:10563298-10563320 GCCGGGGATGGGCGGGGAGGAGG - Intergenic
986739142 5:10690482-10690504 GATGGCCAGGGGCTGGGAGGAGG - Intronic
986743754 5:10726563-10726585 GCCGGCCCCGGCCCAGGAGGCGG + Intronic
986912800 5:12577299-12577321 GCCTGTCATGGGGTGGGAGGAGG + Intergenic
989217120 5:38917019-38917041 GCAGGCAAGGTGCTGGGAGGAGG + Intronic
989379362 5:40798229-40798251 GCCGGGGGCGGGCGGGGAGGGGG + Exonic
991594483 5:68288620-68288642 GCCGGGAACAGGCTGGGGGGAGG + Intronic
991904142 5:71491673-71491695 GATTGCCAAGGGCTGGGAGGCGG - Intronic
992563156 5:77972591-77972613 GCCGGGCCAGGGGTGGGAGGCGG + Intergenic
993900207 5:93579758-93579780 GCCGGCTGGGGGCGGGGAGGGGG - Intergenic
994097248 5:95858287-95858309 GCTGGCCCTGGGCTTGGAGGAGG - Intronic
995224985 5:109690880-109690902 GCGGGCCCCGGGCTGGCGGGGGG - Intronic
995552522 5:113294972-113294994 GCTGGCCACGGGGTGCGCGGAGG + Intronic
998321543 5:141236584-141236606 GTCGGCCTGGGCCTGGGAGGGGG - Intergenic
998339926 5:141408322-141408344 GCTGGCCAAGGGCTCGGTGGTGG + Exonic
998341009 5:141417979-141418001 GCTGGCCAAGGGCTCGGTGGTGG + Exonic
998406681 5:141878271-141878293 GCCGGCCCCGGCCTGGGCTGCGG + Exonic
999155283 5:149453454-149453476 GCCGGCCAGTGGCTGAGAGGAGG - Intergenic
1000035853 5:157447386-157447408 GCCTGGCACTGGCTGGGCGGAGG + Intronic
1000467471 5:161597530-161597552 GCCTGTCACGGGATGGGGGGAGG + Intronic
1001070249 5:168579408-168579430 GCCGGCCTAGGGCGGGGCGGCGG + Exonic
1002172988 5:177385783-177385805 GCCCCCCACGGACTGGGAGTGGG - Exonic
1002606055 5:180383397-180383419 GCAGGCCACAGGCAGGGAGGTGG + Intergenic
1004396119 6:15248117-15248139 GCCAGCCACGGGCTTGCAGCCGG - Intronic
1004690349 6:17987698-17987720 GGCGGCGGCGGGCGGGGAGGAGG + Intergenic
1004777023 6:18859014-18859036 GATTGCCAGGGGCTGGGAGGTGG - Intergenic
1005048527 6:21664482-21664504 GCCGGCCACGCGCAGGGCCGCGG - Intergenic
1005385247 6:25279304-25279326 GCCGGGCTCCGGCTGGGCGGGGG - Intronic
1005989123 6:30892367-30892389 CCCTGCCATGGCCTGGGAGGGGG + Exonic
1006119514 6:31795577-31795599 GCCGGCGCCTGGCTGTGAGGTGG - Exonic
1006399255 6:33806925-33806947 GCCAGGCTTGGGCTGGGAGGAGG + Intergenic
1006446488 6:34082606-34082628 GCGGGCCCTGGGCTGGGAGGCGG - Intronic
1006783537 6:36649249-36649271 GGTTGCCAGGGGCTGGGAGGAGG + Intergenic
1007110350 6:39310066-39310088 GCTGGCCAGGAACTGGGAGGCGG + Intronic
1007264817 6:40588064-40588086 GCCGGCCCTAGGCTGGGAGTGGG + Intergenic
1007399462 6:41595441-41595463 GAGGGCCAGGGGCTGGCAGGAGG + Intronic
1007409172 6:41651855-41651877 GCTGGGCACCAGCTGGGAGGTGG - Intronic
1007631718 6:43276518-43276540 GCCGCGCACGGGCGGGGAGGGGG + Intronic
1007721163 6:43886240-43886262 GCCGCCCAGGGGGTGGGATGGGG - Intergenic
1007783204 6:44265636-44265658 GCCCGCCGGGGGCGGGGAGGGGG - Exonic
1008545126 6:52577130-52577152 GCGGGCCGCGGGCTGGGCGGGGG - Intergenic
1010254469 6:73742183-73742205 GGCTGCCAGGGGCTGGGGGGTGG - Intronic
1010806097 6:80238749-80238771 GCCTGTCATGGGATGGGAGGAGG - Intronic
1014137655 6:117907611-117907633 GGCGGCCGCGGCCCGGGAGGCGG - Exonic
1014720594 6:124913048-124913070 GGCTGTCAGGGGCTGGGAGGAGG - Intergenic
1015848104 6:137542924-137542946 GACTGTCACAGGCTGGGAGGAGG + Intergenic
1016340870 6:143060677-143060699 GCCGGCCGCGGCCTGGCAGGCGG - Intronic
1016827839 6:148404740-148404762 GTGGGGCACGGGCTGGGAGAGGG - Intronic
1017717153 6:157221063-157221085 GCCGGCCAGGGGCGGGAAGGGGG - Intergenic
1017914321 6:158819479-158819501 CCGGGCCTCGGGCTGGGTGGGGG + Intergenic
1018952566 6:168388804-168388826 GCCGGGGATGGGCAGGGAGGAGG - Intergenic
1018977425 6:168575945-168575967 GTCGGCCACATGCTGGCAGGAGG + Intronic
1019056470 6:169227180-169227202 GCTGGCGCCGGGCTGGGAAGAGG + Intronic
1019477779 7:1252280-1252302 GCCTGGCTCAGGCTGGGAGGCGG + Intergenic
1019588715 7:1818231-1818253 GCCAGCCCTGGGTTGGGAGGAGG - Intronic
1019937572 7:4266518-4266540 GCTGGCCTCGGACTGGGAGAGGG - Exonic
1020204769 7:6105509-6105531 GCCGGCCCGGGGCTCTGAGGGGG - Intronic
1021106796 7:16646555-16646577 GCCAGCCACGCGGTGGGAAGTGG + Intronic
1022386624 7:29905547-29905569 GCCTGCCATGGGGTGGGGGGTGG - Intronic
1023919911 7:44620653-44620675 GTGGCCCACGGGCTGGGAGTTGG - Intronic
1024621209 7:51159070-51159092 GCTGGCCAGGAGCTTGGAGGAGG + Intronic
1026009964 7:66628949-66628971 GCCGGCTGCGGGCTGGCCGGAGG - Exonic
1026454307 7:70557367-70557389 GCCAGCCAAGGGCTGGGAGCTGG - Intronic
1026554823 7:71398664-71398686 GACAGCCAGGGGCTGGGTGGAGG + Intronic
1026916174 7:74121432-74121454 GCGGTCCACGGGGTGGGAGAAGG - Exonic
1026979547 7:74518335-74518357 GCCGGCCCGGGGCTGGGCTGGGG + Intronic
1027035906 7:74925129-74925151 GGTTGCCAGGGGCTGGGAGGAGG - Intergenic
1029188364 7:98755238-98755260 GCACGCCAGGGGCTGGGGGGCGG - Intergenic
1032097562 7:128947146-128947168 GGTGGCCCAGGGCTGGGAGGAGG + Intronic
1032525653 7:132576976-132576998 GCCGGCCGCGGGCTGCCGGGGGG - Exonic
1034083308 7:148300846-148300868 GACTGCCAGGGGCTGGGAGGAGG + Intronic
1034262442 7:149765287-149765309 GCTGGCCAGGGGCTTGGCGGCGG + Exonic
1034273844 7:149815608-149815630 GAAGGCCATGGGGTGGGAGGAGG + Intergenic
1034400081 7:150856473-150856495 GCCGGCCCTGGGCTGGGCCGTGG + Exonic
1035224652 7:157426628-157426650 GCTCGCCACCAGCTGGGAGGGGG - Intergenic
1035236026 7:157498160-157498182 GCTGGCCACGGGCTGGGAGGGGG + Intergenic
1036482661 8:9151748-9151770 GCGGGCCAGGGTCTGGGAAGGGG + Exonic
1036781721 8:11652351-11652373 GACTGCCAGGGGCTGGGGGGAGG - Intergenic
1037127082 8:15364863-15364885 GGCTGCCAGGGGCTGGGAGTAGG + Intergenic
1037805857 8:22057607-22057629 GCCAGCCACTGGCTGGGGGCAGG - Intronic
1037994649 8:23343432-23343454 GCGGGCCAGGGACTGGGAGGTGG + Intronic
1038168810 8:25110183-25110205 ACCAGCCAGGGGCTGGGAGCAGG + Intergenic
1038730287 8:30120981-30121003 GGCTGCCAGGGGCTGGGAGCAGG - Intronic
1039608403 8:38901142-38901164 GGGCGCCGCGGGCTGGGAGGGGG - Intergenic
1039775468 8:40732044-40732066 GATTGCCAGGGGCTGGGAGGAGG + Intronic
1040081855 8:43292788-43292810 CCGGGCCTGGGGCTGGGAGGAGG + Intergenic
1042938661 8:74086045-74086067 GGTTGCCAGGGGCTGGGAGGGGG - Intergenic
1043183019 8:77108693-77108715 GCCTGCCAGGGGATGGGGGGAGG + Intergenic
1043527476 8:81112158-81112180 GCGGGCCGCGGGGCGGGAGGGGG + Intergenic
1043563633 8:81523639-81523661 GGGGGCCAGGGGCTGGGAGAAGG - Intergenic
1043699805 8:83271216-83271238 GCCTGTCATGGGGTGGGAGGGGG + Intergenic
1043881673 8:85550349-85550371 AGTGGCCAGGGGCTGGGAGGAGG + Intergenic
1044142475 8:88672551-88672573 GGAGGCCACGGGCGGGGAGGGGG + Intergenic
1045649619 8:104329740-104329762 GCGGGTCAGGGGCTGGGTGGGGG + Intergenic
1046252833 8:111655161-111655183 GCCTGTCACGGGGTGGGGGGAGG + Intergenic
1047556173 8:125933047-125933069 GGCTTCCAGGGGCTGGGAGGAGG + Intergenic
1048330645 8:133468447-133468469 GGCTGTCAGGGGCTGGGAGGAGG + Intronic
1049019087 8:139941503-139941525 GCAGGCCAGGGGCTGGCAGGAGG + Intronic
1049105098 8:140607762-140607784 GGCTGCCAGGGGGTGGGAGGGGG + Intronic
1049212164 8:141391882-141391904 GCCGCCCCTGGGCTGGGAGGAGG - Intergenic
1049396825 8:142404809-142404831 GCCAGCCACGGAAGGGGAGGTGG - Intergenic
1049605813 8:143528755-143528777 GCAGGCCATGGGCGGGAAGGTGG - Intronic
1049803044 8:144527015-144527037 GCAGTCGCCGGGCTGGGAGGGGG + Exonic
1050173779 9:2849508-2849530 GCCTGTCATGGGCTGGGGGGAGG + Intergenic
1050472599 9:6008160-6008182 GCCAGCGGGGGGCTGGGAGGGGG + Intergenic
1052056182 9:23910372-23910394 GCCTGTCATGGGGTGGGAGGAGG + Intergenic
1052068315 9:24050598-24050620 GCCGGTCATGGGATGGGGGGAGG - Intergenic
1052256327 9:26461100-26461122 GCTGGCCAAGGGCCAGGAGGAGG - Intergenic
1053262361 9:36679420-36679442 GGTGGCCAGGGGCTGGGGGGTGG - Intergenic
1053878079 9:42563532-42563554 GGTTGCCAGGGGCTGGGAGGAGG - Intergenic
1053894581 9:42730835-42730857 GGTTGCCAGGGGCTGGGAGGAGG + Intergenic
1054233615 9:62538162-62538184 GGTTGCCAGGGGCTGGGAGGAGG + Intergenic
1055931544 9:81564570-81564592 GCAGGCAACGGGGTGGGATGGGG + Intergenic
1056517820 9:87371780-87371802 GCTGGCAAAGAGCTGGGAGGTGG + Intergenic
1056787650 9:89604380-89604402 CTCGGCCAAGGGCGGGGAGGTGG + Intergenic
1057854846 9:98594279-98594301 CTCAGCCACGGGGTGGGAGGCGG - Intronic
1058687239 9:107489625-107489647 GCGGGCCACGGGCGGGTGGGAGG + Exonic
1059394738 9:114027397-114027419 GGTGGCCACGTGCTGGGAGCAGG - Intronic
1060526621 9:124324621-124324643 GCCCGCCACAGGCCTGGAGGTGG + Intronic
1060621626 9:125072697-125072719 GGCTGCCAGGGGCTAGGAGGAGG - Intronic
1060974298 9:127755334-127755356 GCCGGCCAGGGGAGGGGAGGGGG + Intronic
1061000507 9:127899646-127899668 CCCGGCCCAGGCCTGGGAGGTGG + Exonic
1061181947 9:129029534-129029556 GGCGGTCACGGGAAGGGAGGGGG + Intergenic
1061327211 9:129871183-129871205 GGTTGCCAGGGGCTGGGAGGTGG - Intronic
1061402781 9:130377638-130377660 GGGGGTCACGGGCTGTGAGGAGG - Intronic
1061607665 9:131723436-131723458 GGCTGCCAGGGGCTGGAAGGAGG - Intronic
1061780144 9:132991058-132991080 GCTGGCCAGGAGCTGGGAGCCGG - Exonic
1062107918 9:134765787-134765809 AGCGTCCACCGGCTGGGAGGCGG - Intronic
1062137578 9:134937941-134937963 GCCAGCCAGGGGCAGGGAGAAGG - Intergenic
1062275539 9:135728644-135728666 CGCAGCCACGGGCTGGGAAGGGG + Intronic
1062405230 9:136393057-136393079 GCCAGGCACAGGCTGGGAGCTGG - Intronic
1062522418 9:136963829-136963851 GCCGGCTGGGGGCAGGGAGGAGG + Intergenic
1186450014 X:9664359-9664381 GCAGGCCTAGGGCTGGGTGGGGG + Intronic
1186496518 X:10015760-10015782 GCTGCCCGCCGGCTGGGAGGAGG + Exonic
1187473181 X:19587317-19587339 GGCTGCCAGGGGCTGGGAGAGGG + Intronic
1189251286 X:39602249-39602271 CCCTGCCACTGGCGGGGAGGAGG + Intergenic
1190056891 X:47186318-47186340 GCAGGCCATGGGCTGGAAAGAGG + Exonic
1190220420 X:48509134-48509156 GCCGGCCCAGGGATGGGAGCTGG - Intronic
1192238815 X:69313871-69313893 GCAGGACGGGGGCTGGGAGGAGG - Intergenic
1193296757 X:79842505-79842527 GCCTGTCATGGGGTGGGAGGAGG + Intergenic
1193302743 X:79910797-79910819 GCTTGCCAGGGGCTGGGAGGGGG + Intergenic
1195572586 X:106412998-106413020 GCCTGTCATGGGGTGGGAGGCGG + Intergenic
1195584385 X:106548175-106548197 GGTGGCCAGGGGCTGGGATGTGG - Intergenic
1196912733 X:120500342-120500364 GCCGGGCATGGGCCGGGCGGTGG + Intergenic
1197476269 X:126929414-126929436 GTCGGCCTCCTGCTGGGAGGTGG + Intergenic
1197575417 X:128204912-128204934 GCCTGTCACGGGGTGGGGGGAGG + Intergenic
1198235795 X:134734865-134734887 GCAGTCCAGGGGGTGGGAGGTGG - Intronic
1198750190 X:139931730-139931752 GCCGCCTTCGGGCTGGGTGGTGG - Intronic
1199695339 X:150339843-150339865 GCAGGCCAGGGGCAGGGAGGAGG + Intergenic
1200000938 X:153059428-153059450 GCCAGCCATGGCCTGGGTGGAGG + Intronic
1200100803 X:153688448-153688470 GCCGGCCGGGGGCCGGGGGGCGG - Exonic
1200137144 X:153880662-153880684 GCCAGCCACGGCCTGGGGAGCGG - Intronic
1200275963 X:154732824-154732846 GCTGGCCGGGGGCTCGGAGGTGG - Intronic
1200806882 Y:7442710-7442732 GTCTTCCAGGGGCTGGGAGGGGG + Intergenic
1200986503 Y:9306866-9306888 GCCTCCCACGAGCTTGGAGGCGG - Intergenic
1201180186 Y:11335322-11335344 GCCCGCAGCGGGCTGGGACGAGG - Intergenic
1202124075 Y:21554036-21554058 GCCTCCCACGAGCTTGGAGGCGG + Intergenic
1202154933 Y:21875344-21875366 GCCTCCCACGAGCTTGGAGGCGG - Intergenic