ID: 1117156829

View in Genome Browser
Species Human (GRCh38)
Location 14:52950653-52950675
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 243}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117156829_1117156845 22 Left 1117156829 14:52950653-52950675 CCGGCCACGGGCTGGGAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 243
Right 1117156845 14:52950698-52950720 GAAACTCGGGAGGGCGGCGGCGG 0: 1
1: 0
2: 0
3: 12
4: 246
1117156829_1117156842 13 Left 1117156829 14:52950653-52950675 CCGGCCACGGGCTGGGAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 243
Right 1117156842 14:52950689-52950711 CTTTCGGCAGAAACTCGGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 57
1117156829_1117156844 19 Left 1117156829 14:52950653-52950675 CCGGCCACGGGCTGGGAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 243
Right 1117156844 14:52950695-52950717 GCAGAAACTCGGGAGGGCGGCGG 0: 1
1: 0
2: 2
3: 20
4: 275
1117156829_1117156840 9 Left 1117156829 14:52950653-52950675 CCGGCCACGGGCTGGGAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 243
Right 1117156840 14:52950685-52950707 GGGGCTTTCGGCAGAAACTCGGG 0: 1
1: 0
2: 0
3: 6
4: 126
1117156829_1117156846 26 Left 1117156829 14:52950653-52950675 CCGGCCACGGGCTGGGAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 243
Right 1117156846 14:52950702-52950724 CTCGGGAGGGCGGCGGCGGCCGG 0: 1
1: 1
2: 6
3: 90
4: 594
1117156829_1117156843 16 Left 1117156829 14:52950653-52950675 CCGGCCACGGGCTGGGAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 243
Right 1117156843 14:52950692-52950714 TCGGCAGAAACTCGGGAGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 92
1117156829_1117156839 8 Left 1117156829 14:52950653-52950675 CCGGCCACGGGCTGGGAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 243
Right 1117156839 14:52950684-52950706 CGGGGCTTTCGGCAGAAACTCGG 0: 1
1: 0
2: 0
3: 5
4: 51
1117156829_1117156841 12 Left 1117156829 14:52950653-52950675 CCGGCCACGGGCTGGGAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 243
Right 1117156841 14:52950688-52950710 GCTTTCGGCAGAAACTCGGGAGG 0: 1
1: 0
2: 0
3: 0
4: 46
1117156829_1117156835 -10 Left 1117156829 14:52950653-52950675 CCGGCCACGGGCTGGGAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 243
Right 1117156835 14:52950666-52950688 GGGAGGTGGTGGAGGACCCGGGG 0: 1
1: 0
2: 3
3: 51
4: 559
1117156829_1117156836 -3 Left 1117156829 14:52950653-52950675 CCGGCCACGGGCTGGGAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 243
Right 1117156836 14:52950673-52950695 GGTGGAGGACCCGGGGCTTTCGG 0: 1
1: 0
2: 2
3: 24
4: 263
1117156829_1117156848 28 Left 1117156829 14:52950653-52950675 CCGGCCACGGGCTGGGAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 243
Right 1117156848 14:52950704-52950726 CGGGAGGGCGGCGGCGGCCGGGG 0: 1
1: 0
2: 31
3: 300
4: 1811
1117156829_1117156847 27 Left 1117156829 14:52950653-52950675 CCGGCCACGGGCTGGGAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 243
Right 1117156847 14:52950703-52950725 TCGGGAGGGCGGCGGCGGCCGGG 0: 1
1: 0
2: 6
3: 52
4: 511

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117156829 Original CRISPR ACCACCTCCCAGCCCGTGGC CGG (reversed) Intronic