ID: 1117156829

View in Genome Browser
Species Human (GRCh38)
Location 14:52950653-52950675
Sequence ACCACCTCCCAGCCCGTGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 243}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117156829_1117156835 -10 Left 1117156829 14:52950653-52950675 CCGGCCACGGGCTGGGAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 243
Right 1117156835 14:52950666-52950688 GGGAGGTGGTGGAGGACCCGGGG 0: 1
1: 0
2: 3
3: 51
4: 559
1117156829_1117156836 -3 Left 1117156829 14:52950653-52950675 CCGGCCACGGGCTGGGAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 243
Right 1117156836 14:52950673-52950695 GGTGGAGGACCCGGGGCTTTCGG 0: 1
1: 0
2: 2
3: 24
4: 263
1117156829_1117156847 27 Left 1117156829 14:52950653-52950675 CCGGCCACGGGCTGGGAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 243
Right 1117156847 14:52950703-52950725 TCGGGAGGGCGGCGGCGGCCGGG 0: 1
1: 0
2: 6
3: 52
4: 511
1117156829_1117156842 13 Left 1117156829 14:52950653-52950675 CCGGCCACGGGCTGGGAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 243
Right 1117156842 14:52950689-52950711 CTTTCGGCAGAAACTCGGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 57
1117156829_1117156839 8 Left 1117156829 14:52950653-52950675 CCGGCCACGGGCTGGGAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 243
Right 1117156839 14:52950684-52950706 CGGGGCTTTCGGCAGAAACTCGG 0: 1
1: 0
2: 0
3: 5
4: 51
1117156829_1117156845 22 Left 1117156829 14:52950653-52950675 CCGGCCACGGGCTGGGAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 243
Right 1117156845 14:52950698-52950720 GAAACTCGGGAGGGCGGCGGCGG 0: 1
1: 0
2: 0
3: 12
4: 246
1117156829_1117156841 12 Left 1117156829 14:52950653-52950675 CCGGCCACGGGCTGGGAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 243
Right 1117156841 14:52950688-52950710 GCTTTCGGCAGAAACTCGGGAGG 0: 1
1: 0
2: 0
3: 0
4: 46
1117156829_1117156846 26 Left 1117156829 14:52950653-52950675 CCGGCCACGGGCTGGGAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 243
Right 1117156846 14:52950702-52950724 CTCGGGAGGGCGGCGGCGGCCGG 0: 1
1: 1
2: 6
3: 90
4: 594
1117156829_1117156844 19 Left 1117156829 14:52950653-52950675 CCGGCCACGGGCTGGGAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 243
Right 1117156844 14:52950695-52950717 GCAGAAACTCGGGAGGGCGGCGG 0: 1
1: 0
2: 2
3: 20
4: 275
1117156829_1117156840 9 Left 1117156829 14:52950653-52950675 CCGGCCACGGGCTGGGAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 243
Right 1117156840 14:52950685-52950707 GGGGCTTTCGGCAGAAACTCGGG 0: 1
1: 0
2: 0
3: 6
4: 126
1117156829_1117156843 16 Left 1117156829 14:52950653-52950675 CCGGCCACGGGCTGGGAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 243
Right 1117156843 14:52950692-52950714 TCGGCAGAAACTCGGGAGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 92
1117156829_1117156848 28 Left 1117156829 14:52950653-52950675 CCGGCCACGGGCTGGGAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 243
Right 1117156848 14:52950704-52950726 CGGGAGGGCGGCGGCGGCCGGGG 0: 1
1: 0
2: 31
3: 300
4: 1811

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117156829 Original CRISPR ACCACCTCCCAGCCCGTGGC CGG (reversed) Intronic
900149187 1:1170865-1170887 GCCACCTCCCTTCCAGTGGCAGG + Intergenic
900957995 1:5899541-5899563 ACCACCTCCCAGCCCGGAAGGGG - Intronic
901051965 1:6429801-6429823 ACCCCCTCCCAGGCCATGCCAGG + Intronic
902482271 1:16718213-16718235 ACCCCCTCCCAGGCCATGCCAGG - Intergenic
902981233 1:20124860-20124882 ACATCCTCTCAGCCCATGGCAGG + Intergenic
903365354 1:22802464-22802486 ACCACCAGCCACCCCTTGGCAGG + Intronic
903679700 1:25088706-25088728 ACCACCCCCCAGCCCAGGGAAGG - Intergenic
904042089 1:27591016-27591038 CCCACCTCCCAGCCCCAGCCTGG + Intronic
904466860 1:30713482-30713504 ACCCCCTCCCACCCCCGGGCTGG + Exonic
912818727 1:112850183-112850205 AACACATCCCAGCCCATGCCCGG - Intergenic
912831415 1:112956712-112956734 AACACATCCCAGCCCATGCCCGG - Intronic
917648646 1:177053801-177053823 ACCACCTCACAGCTGGTGGTGGG - Intronic
918040976 1:180913396-180913418 TCCAGCTCCGAGCCCGTGGGAGG - Intronic
920091308 1:203455159-203455181 ACCACTTCCCCGCCCTTGGTGGG - Intergenic
920677780 1:208050213-208050235 ATAACCTGCCAGCCCGTGGCTGG - Intronic
921606681 1:217164506-217164528 AGCTTCTCCCAGCCCATGGCTGG + Intergenic
922572510 1:226642454-226642476 ACCACCACCCAGCCTGGGGTTGG + Intronic
922785057 1:228278536-228278558 ACCACCTGCTGGCCCCTGGCGGG + Intronic
923414207 1:233739018-233739040 CCATCCTCCCAGCCCGTGGGTGG - Intergenic
1063669761 10:8090639-8090661 ATCAAATCCCAGCCCTTGGCGGG - Intergenic
1065899094 10:30188810-30188832 AGCACATCCCAGCAGGTGGCAGG + Intergenic
1066433053 10:35371177-35371199 ACCACCGCCCAGCCCAGTGCTGG + Intronic
1068777023 10:60878799-60878821 TCCACCTCCCAGGCAGTGCCTGG - Intronic
1069628199 10:69881043-69881065 AGCACCCTCCACCCCGTGGCTGG + Intronic
1069901991 10:71711546-71711568 ACCACCTCCCAGCCCTGGGAGGG + Intronic
1069942450 10:71964720-71964742 ACCGCCGCCCAGCCCGGGGGAGG + Intronic
1070289672 10:75105913-75105935 TCCCCATCCCAGCCCGTGGGTGG - Intronic
1070895952 10:79983066-79983088 ACCTCCTCCCGCCCCCTGGCAGG + Intergenic
1071069050 10:81670152-81670174 TCGACTGCCCAGCCCGTGGCTGG - Intergenic
1072549229 10:96464546-96464568 AGCACGTGCCAGCCCGGGGCAGG + Intronic
1074430468 10:113390009-113390031 ACCACCTACAAGCCACTGGCTGG + Intergenic
1074732472 10:116393517-116393539 AGCCCCTCACTGCCCGTGGCGGG - Intergenic
1074870976 10:117575863-117575885 ACCACCTCCCAGGGTGGGGCAGG - Intergenic
1075517060 10:123117854-123117876 TCCACCTCCCAGCCAGGTGCTGG - Intergenic
1075539346 10:123299388-123299410 CCCACCACCCACCCCGGGGCTGG - Intergenic
1075721943 10:124592599-124592621 ACCACCACCATGCCCATGGCTGG + Intronic
1076114310 10:127884825-127884847 ACACCCTGTCAGCCCGTGGCTGG - Intronic
1076357395 10:129863489-129863511 AGCCCCTCCCAGCCTCTGGCGGG + Intronic
1076374270 10:129972955-129972977 CCCACCTCCCGGCCCGCAGCCGG - Intergenic
1076546256 10:131247399-131247421 ATCACCTACCAGCCCCAGGCTGG + Intronic
1076608127 10:131702583-131702605 ACCACCTCCCAGCCAAGGGCAGG + Intergenic
1077844838 11:6013225-6013247 ATCCCCTCACAGCCTGTGGCAGG + Intergenic
1078189031 11:9076208-9076230 GCCTCCTCCCTGCCCCTGGCAGG - Intronic
1078570431 11:12453101-12453123 GCCACCTCCCAGCTCGTCTCTGG + Intronic
1078761833 11:14257917-14257939 AACTCCTGCCAGCCCCTGGCTGG - Intronic
1079732081 11:23946023-23946045 AGCATCTCCCAGCCCTTTGCAGG + Intergenic
1080457263 11:32428687-32428709 ACACCCCCCCCGCCCGTGGCTGG - Intronic
1081713718 11:45234075-45234097 ACCAGCTCCTAGCCCGGGCCGGG + Intronic
1082848423 11:57744459-57744481 ACCAGCTCCCAGCCACTGGATGG - Exonic
1083319992 11:61839767-61839789 CCCACCTCTCAGCCCCTGGCAGG + Intronic
1083726855 11:64633021-64633043 CCCACCTCCCACCTCATGGCTGG + Intronic
1083767793 11:64850184-64850206 ACCACCTTGCTGGCCGTGGCCGG + Intergenic
1083851883 11:65372836-65372858 ACCACTGGGCAGCCCGTGGCTGG - Intergenic
1083878056 11:65535093-65535115 GCCACCTCCCAGCCTGGGCCTGG - Intronic
1085711311 11:78831344-78831366 CCCAGCTCCCAGCTCCTGGCCGG + Intronic
1086945979 11:92844429-92844451 ATCAGCATCCAGCCCGTGGCAGG + Exonic
1088786433 11:113186370-113186392 ACCACCTCCCAACCCTCTGCCGG + Intronic
1090508042 11:127340602-127340624 ATCACCTCCTAGCCTCTGGCAGG - Intergenic
1091667587 12:2430553-2430575 ACCACCTCCCAGACTGAGTCAGG - Intronic
1096523046 12:52194794-52194816 CCCACCTCCCAACCCCTGCCAGG - Intergenic
1102480820 12:113221860-113221882 ACGTGCTCCCAGCCCCTGGCTGG - Intronic
1104661680 12:130615947-130615969 ACCACGTCCCCGCCCGGAGCAGG - Intronic
1108941764 13:55964068-55964090 ACCACCTGACTGCCAGTGGCAGG - Intergenic
1112410639 13:99160525-99160547 CCCTCGTCCCAGCCCATGGCTGG - Intergenic
1113635152 13:111914414-111914436 ACCACCTCCCACCCTTTGTCAGG - Intergenic
1114056109 14:18968011-18968033 ACCTCCTCCCAGCCCAGGCCTGG - Intronic
1114106442 14:19433742-19433764 ACCTCCTCCCAGCCCAGGCCTGG + Intronic
1117156829 14:52950653-52950675 ACCACCTCCCAGCCCGTGGCCGG - Intronic
1118607281 14:67513815-67513837 ACCAGCTCCTATCCTGTGGCAGG - Intronic
1121696563 14:95917970-95917992 CCCTCCACCCAGCCCCTGGCAGG + Intergenic
1122931101 14:104933427-104933449 TCCACCTCCCACCCCGCGCCGGG + Exonic
1122962817 14:105105429-105105451 CCCTCCTCCCAGCTCCTGGCAGG - Intergenic
1124404292 15:29380050-29380072 ACCTCCCCCCAGCCCCTTGCTGG - Intronic
1128557632 15:68642431-68642453 ACCCCAGCACAGCCCGTGGCTGG - Intronic
1128866857 15:71120688-71120710 ACGAGCTCCCAGCCCATGGCTGG - Intronic
1132098867 15:99008485-99008507 AGCCCCTCACTGCCCGTGGCCGG + Intergenic
1132321270 15:100927251-100927273 CCCACCTCCAAGCTCGTGGCAGG + Intronic
1132853688 16:2035609-2035631 ACCACCTCCCAGCCAGGGGGTGG - Intronic
1133994868 16:10740578-10740600 ACCCCCTCCCCGCACGTGGGAGG + Intergenic
1135250991 16:20900825-20900847 GCCTCCTCCCAGCCCGCCGCGGG + Intronic
1136498964 16:30660118-30660140 ACCTCCTCCCACCCCAGGGCGGG - Intronic
1138552966 16:57757334-57757356 ACCCCCTCCAAGCCCGGGGGTGG + Intergenic
1139649740 16:68356313-68356335 AGCACCTCCCAACTCGGGGCAGG + Intronic
1140415256 16:74769884-74769906 ACCATGTCCAAGGCCGTGGCAGG + Intronic
1140756875 16:78075662-78075684 ACGAGCTCCCAGCGTGTGGCAGG + Intergenic
1141169387 16:81681457-81681479 GCCACCTCCCAGCCTGGGACCGG - Intronic
1142029068 16:87829487-87829509 TCCACCTCCCAGCACGGGGTGGG - Intergenic
1142155319 16:88530280-88530302 ACCACCTCCCAGTCCCTGAGGGG + Intronic
1142211539 16:88810948-88810970 ACCTCCTGCCAGGCCGGGGCAGG - Intronic
1142226103 16:88878347-88878369 ATCTCCTCCCACCCCGGGGCTGG + Intronic
1142230767 16:88899268-88899290 ACCACCCACCAGCCAGGGGCAGG + Intronic
1142500718 17:331483-331505 ACCCCCACCCTGGCCGTGGCTGG + Intronic
1142817482 17:2438061-2438083 ACCACCTGCCAGCACATGGTGGG - Intronic
1144999293 17:19292251-19292273 ACCACCTCTCAGCCCCGGGCGGG - Intronic
1145005583 17:19335983-19336005 ACCACCTGCCAGCCCCTCTCTGG + Exonic
1146950062 17:36899707-36899729 TCCACCTCCCAGTCTGTGGGGGG + Intergenic
1147171273 17:38620548-38620570 TCCAACTTCCAGGCCGTGGCTGG + Intergenic
1147678146 17:42221261-42221283 ACCACCACCCTCCCTGTGGCTGG - Intronic
1147687803 17:42297677-42297699 ACCACCACCCTCCCTGTGGCTGG + Intronic
1147915491 17:43882983-43883005 ACCACCCCCCAGCCCTGGCCTGG - Exonic
1147992553 17:44343993-44344015 ACCACAGCCCAGCCCGTGCCAGG + Intergenic
1148732433 17:49845653-49845675 CCCAGCTCCCAGCTCCTGGCAGG - Intronic
1150281852 17:63933529-63933551 ACCACCTCCCATGCCATGGTTGG + Intergenic
1150315101 17:64162677-64162699 TCCACCTCCCAGCTCCTGGCAGG - Intronic
1151435024 17:74089856-74089878 ACAGCCTCCCAGCCAGTCGCAGG - Intergenic
1152065909 17:78112441-78112463 ACCACCCCCCAGCCAGCTGCTGG + Exonic
1152517529 17:80834546-80834568 CCCGCCTCCCACCCCGGGGCTGG + Intronic
1152774981 17:82195418-82195440 CCCACCTCCCAGGACGTGGGTGG - Intronic
1152782255 17:82231571-82231593 ACCACCTCCCGGCCCCAGGGCGG + Intronic
1153204476 18:2682354-2682376 CCCACCTCTCAGCCCCAGGCTGG + Intronic
1153958044 18:10114993-10115015 CCCATCTTCCAGCCCCTGGCTGG - Intergenic
1155024790 18:21931229-21931251 ACCAGCTCCAAGCCCCAGGCAGG - Intergenic
1157276472 18:46314283-46314305 ACCACCTCCCCGCCCGTCATTGG - Intergenic
1157515911 18:48311218-48311240 ACCCCCTGCCTGCCCGTGGTGGG + Intronic
1159452618 18:68621577-68621599 TCCTCCTCCCAGCCCCTGACAGG - Intergenic
1159918174 18:74204133-74204155 CCCACCTCCCAGCCCATAGCTGG - Intergenic
1159952590 18:74496232-74496254 ACCACCCCTCTGCCTGTGGCTGG + Exonic
1160146599 18:76370696-76370718 ACCAGCGCCTAGCCTGTGGCTGG + Intronic
1160535363 18:79588765-79588787 ACCCCCTCCCAGCCCCTGCACGG + Intergenic
1160793495 19:933511-933533 GCCACCTCCTCGCCCGGGGCTGG + Intronic
1160854767 19:1211770-1211792 CCCACCTCCCACCTCCTGGCTGG - Intronic
1162038007 19:7952946-7952968 CCCAACCCACAGCCCGTGGCCGG - Intergenic
1162044142 19:7987608-7987630 ACCAGTGCCCAGCCCATGGCTGG + Intronic
1162396403 19:10420335-10420357 GCCCCCTCCCAGCCCGGAGCGGG + Intronic
1164536230 19:29088158-29088180 TCTACCTGCCACCCCGTGGCTGG - Intergenic
1165832007 19:38735070-38735092 ACCACCCCCCTGCCCCAGGCCGG - Intronic
1165861667 19:38912258-38912280 GCCCCCTCCCCGCCCGCGGCGGG + Intergenic
1166105154 19:40594543-40594565 ACCACCTCCTACCCTGTGGCTGG - Intronic
1166354065 19:42216964-42216986 TCCTCCTCCCAGCACGGGGCCGG + Exonic
1167903244 19:52637840-52637862 CCCACCTCCCTCCTCGTGGCGGG - Intronic
925592022 2:5519388-5519410 ACCACCTCCCTGCTCCTGGCAGG - Intergenic
926767120 2:16331155-16331177 ACCACCTGCCAGGGCTTGGCAGG + Intergenic
927226048 2:20767162-20767184 ACCCCCTCACAGCCTGGGGCAGG - Intronic
928125675 2:28614144-28614166 ACCACACCCGAGCCCCTGGCAGG - Intronic
929588623 2:43131331-43131353 TCCACCTCTGAGCCCGGGGCTGG + Intergenic
930102305 2:47612943-47612965 CACACCTCCCAGCCCTTGCCAGG + Intergenic
931219861 2:60279240-60279262 ACCAGCTCTCAACCCATGGCTGG + Intergenic
931649208 2:64453900-64453922 ACCAGCGCCCAGGACGTGGCAGG + Intergenic
931763574 2:65436100-65436122 ACCCCCTCCCCGCCCCTGGGAGG - Intergenic
935090764 2:99892887-99892909 ATTACCTCCCAGCTCGTGGTGGG + Intronic
937112514 2:119377479-119377501 ACCACTTCCCAGCCCAAGCCTGG - Intergenic
937146020 2:119645337-119645359 ACCTCCCTCCAGCCCCTGGCAGG + Intronic
937258891 2:120572999-120573021 ACCCACCCCCAGCCCCTGGCAGG + Intergenic
937671400 2:124541317-124541339 ACCACCTCCCATCCCTTCCCTGG + Intronic
938286206 2:130119968-130119990 ACCTCCTCCCAGCCCAGGCCTGG + Intronic
938336848 2:130508688-130508710 ACCTCCTCCCAGCCCAGGCCTGG + Intronic
938352975 2:130611947-130611969 ACCTCCTCCCAGCCCAGGCCTGG - Intronic
938429403 2:131218928-131218950 ACCTCCTCCCAGCCCAGGCCTGG - Intronic
938474229 2:131592109-131592131 ACCTCCTCCCAGCCCAGGCCTGG - Intergenic
941951547 2:171161024-171161046 CCCACCCCCCAGCCCCTGGCAGG - Intronic
946494645 2:220183632-220183654 ACCACCTCCAACCCCTAGGCTGG - Intergenic
947658859 2:231851625-231851647 ACCACCTCCCACCCCGTCTGTGG - Intergenic
948088156 2:235267686-235267708 ACCTCCTCCCAGCCCAGGCCAGG + Intergenic
948695013 2:239728938-239728960 TCAACCTCCTGGCCCGTGGCTGG - Intergenic
1168813133 20:719387-719409 TCCAACTCCCAGGCCCTGGCAGG - Intergenic
1168851210 20:978297-978319 ACCACCTCCCAGGCAGTTGTGGG + Intronic
1169251552 20:4064776-4064798 AGCTCCTCCCAGGCCCTGGCTGG - Intergenic
1172488644 20:35316272-35316294 TCTACCTCCCAGCCCATGACAGG - Intronic
1172649522 20:36492995-36493017 ACCACTCCCCAGCCACTGGCAGG - Intronic
1174075435 20:47932204-47932226 CCCACCTCCCAGCCTCTGCCAGG - Intergenic
1175249161 20:57598357-57598379 GTCACCTCCCAGCCCCTGGCTGG - Intergenic
1175961871 20:62641507-62641529 ACCACCTCACGGCCCCAGGCTGG - Exonic
1176178971 20:63740840-63740862 GCCACCTCCCAACCCCTGCCAGG + Intronic
1176303833 21:5113360-5113382 ACCACCTCAGAGCCCGGGCCTGG + Intergenic
1179635612 21:42706785-42706807 TTCACCCCCCAGCCCCTGGCAGG + Intronic
1179810544 21:43866371-43866393 CCCACCTCCCAGCCCCCAGCAGG - Intronic
1179853197 21:44148590-44148612 ACCACCTCAGAGCCCGGGCCTGG - Intergenic
1180003241 21:45004576-45004598 CCCTCCTCCCAGCCCCGGGCAGG + Intergenic
1180163112 21:46006814-46006836 GCCTCCTCCCAGCCCCTGCCAGG - Intergenic
1180474601 22:15690714-15690736 ACCTCCTCCCAGCCCAGGCCTGG - Intronic
1180936604 22:19629622-19629644 AGCGCCTCACAGCCCTTGGCTGG + Intergenic
1181937392 22:26448645-26448667 AACACCTCCCAGCTCTTGACAGG + Intronic
1183298546 22:37046543-37046565 ACCATATCCCTGCCCGTGCCTGG - Intergenic
1183546565 22:38457226-38457248 ACCACATACCAGCCCCTGGGCGG + Intergenic
1183605837 22:38866381-38866403 GCCTCCTCCGAGCCCGAGGCTGG - Exonic
1183876765 22:40789330-40789352 GCCCCTTCCCACCCCGTGGCTGG - Intronic
1184657023 22:45947019-45947041 CCCAGCTCCCAGCCCATGCCAGG + Intronic
1184677900 22:46053644-46053666 CCCAGCCCCCAGCCCCTGGCCGG - Intronic
1185397987 22:50602132-50602154 AGCACCTCCCTGCCCCGGGCTGG - Intronic
949483018 3:4511774-4511796 AGCACCTCTCAGCCCATGGCAGG - Intronic
952857505 3:37784342-37784364 ATCACCCCCCAGCCAGAGGCAGG - Intronic
955349124 3:58180943-58180965 CCCAGCTCCCAGCCTGGGGCTGG + Intergenic
961447578 3:126988074-126988096 ACCAGCTCCCTGCCTGAGGCTGG - Intergenic
961455050 3:127019862-127019884 ACCACCTCACAGCGGGTGGAAGG + Intronic
961829804 3:129617680-129617702 CCCAGCTCACAGCCCCTGGCGGG + Intergenic
963235674 3:142953440-142953462 ACCACAGCCCAGCCCCTAGCTGG - Intronic
964600250 3:158492540-158492562 TCCACCTCCCAGCCCATTTCTGG - Intronic
968474364 4:795979-796001 CCCACCTCCCAGACCTTTGCTGG + Intronic
968514203 4:1009630-1009652 GCCACGTCCCAGCCCGCGGCCGG - Intergenic
969275705 4:6134519-6134541 ACCACTTCCCACCCCTAGGCTGG + Intronic
969303164 4:6309274-6309296 AGCCCCTCACCGCCCGTGGCGGG + Intergenic
969961779 4:10952014-10952036 CCCACCTCCCAGGCCATGGCAGG + Intergenic
973764473 4:54150585-54150607 ACCTTTTCCCAGCCCCTGGCAGG - Intronic
973827864 4:54727109-54727131 CCCAACTCACAGCCCATGGCAGG - Intronic
974753545 4:66172827-66172849 TCCCACTCCCAGCCCCTGGCAGG + Intergenic
975784976 4:77877891-77877913 CCCACCCCCCAGCCAGTTGCAGG - Intronic
976730244 4:88254168-88254190 CTCAGCTCCCAGCCCCTGGCTGG - Intergenic
982069071 4:151679426-151679448 ACCGCCTCCCAGCCAGTCCCAGG - Intronic
984502171 4:180570478-180570500 ACCACCGCCCAGCCCCTGGCAGG - Intergenic
985627524 5:997366-997388 CACACCTCCCAGCCTGTGGATGG + Intergenic
986440806 5:7779981-7780003 ACTTCCTCCTGGCCCGTGGCTGG - Intronic
986721207 5:10563074-10563096 ACCAGCTGCCAGCCGGTGGGAGG - Intergenic
987071114 5:14337862-14337884 GCCAGCTGCCAGCCCGGGGCAGG - Intronic
989279314 5:39622444-39622466 ACCTCCTCACAGCCTGGGGCAGG + Intergenic
990418960 5:55613463-55613485 AACCCCTCCCTGCCCGGGGCCGG - Intergenic
997581582 5:135020449-135020471 ACCACCTGCCAGGCTGTGGCGGG - Intergenic
997801423 5:136866356-136866378 ACCACCTCCCACCTTGTGACTGG + Intergenic
1000035854 5:157447387-157447409 ACCTCCGCCCAGCCAGTGCCAGG - Intronic
1001550528 5:172599050-172599072 CAGACCTCCTAGCCCGTGGCTGG - Intergenic
1001801448 5:174547794-174547816 ACCACCTCCTAGTCAGTGGCAGG + Intergenic
1005989124 6:30892368-30892390 TCCCCCTCCCAGGCCATGGCAGG - Exonic
1007074279 6:39056904-39056926 AGCACCTCCCAGCCTGTGCATGG + Intronic
1007225209 6:40308837-40308859 ACCAACGCCCAGCCCCTGGACGG + Intergenic
1010755112 6:79658009-79658031 ACTACCGCCCTGCCCGTGGCTGG - Intronic
1013575691 6:111482517-111482539 GCCACCTCCCTGCCCGGGGGTGG + Intronic
1015496128 6:133885312-133885334 ACCATCTCCCAGCTGGTGCCAGG + Intergenic
1017089500 6:150746061-150746083 GTCAACTCCCAGCCCGTGGCAGG - Intronic
1018070718 6:160161947-160161969 ACCTCTTCCCAGCAGGTGGCAGG + Intergenic
1018501229 6:164412965-164412987 ACCACCTCCCTTCCCAAGGCAGG - Intergenic
1018915592 6:168130638-168130660 CCCACCTCACAGGCCTTGGCAGG - Intergenic
1019455369 7:1123986-1124008 ACCAACTCCACGCCAGTGGCCGG + Intronic
1019477780 7:1252281-1252303 ACCGCCTCCCAGCCTGAGCCAGG - Intergenic
1020029238 7:4921155-4921177 ACCACATCCCAGCCCCTCTCTGG + Intronic
1021106797 7:16646556-16646578 GCCACTTCCCACCGCGTGGCTGG - Intronic
1022386623 7:29905546-29905568 TCCACCCCCCACCCCATGGCAGG + Intronic
1026454306 7:70557366-70557388 CCCAGCTCCCAGCCCTTGGCTGG + Intronic
1031029261 7:116716823-116716845 ACCAGTGCTCAGCCCGTGGCTGG + Intronic
1031629842 7:124032996-124033018 ACAGCCTCCGAGCCCATGGCGGG - Exonic
1035240890 7:157528450-157528472 ACCACCTGCCACCCAGTAGCTGG + Intergenic
1036307196 8:7611156-7611178 ACCACCTCCCCGCCCCAGCCAGG - Intergenic
1036358038 8:8059143-8059165 ACCACCTCCCCGCCCCAGCCAGG - Intergenic
1036417328 8:8562949-8562971 AGCCCCTCCCAACCCCTGGCAGG - Intergenic
1036628078 8:10488635-10488657 ACTACCTCCCAACCACTGGCTGG + Intergenic
1036892909 8:12607803-12607825 ACCACCTCCCCGCCCCAGCCAGG + Intergenic
1037613130 8:20493341-20493363 ACCACAACCCAGCCTGTGACAGG - Intergenic
1037737633 8:21580142-21580164 ACAACCTCCCTGCCCTTGGAAGG - Intergenic
1038168811 8:25110184-25110206 CCCTGCTCCCAGCCCCTGGCTGG - Intergenic
1038420564 8:27431498-27431520 ACGACCTCCCCGCCTGGGGCTGG - Intronic
1038445557 8:27601450-27601472 CCCACCTGCCCGCCCATGGCTGG + Intronic
1039721327 8:40167826-40167848 ACTACCTCCCAGGCCGAGGTAGG + Intergenic
1049235951 8:141512423-141512445 ACCACATCCCAGCCCGGGAGGGG - Intergenic
1049236235 8:141513783-141513805 ATCACATCCCAGTCTGTGGCTGG + Intergenic
1049319042 8:141986197-141986219 AGCACCGCCCAGCCCCTGGGAGG - Intergenic
1049374041 8:142280720-142280742 AGCACATCCCAGCCCGCGACAGG + Intronic
1049396824 8:142404808-142404830 CCCACCTCCCCTTCCGTGGCTGG + Intergenic
1049454181 8:142678640-142678662 ACCACCACCCAGCCACTGGCAGG + Intronic
1049782286 8:144434536-144434558 AGCAGCTCCCAGCCCATGCCAGG + Intronic
1055708758 9:79036454-79036476 ACCACCTGCCAGACAGTGGATGG - Intergenic
1058853968 9:109041583-109041605 ACCATCTCTCAGCCCCTGGGAGG - Intronic
1060201817 9:121655786-121655808 GCCACCTGCCAGGCCCTGGCTGG + Intronic
1060526622 9:124324622-124324644 GCCACCTCCAGGCCTGTGGCGGG - Intronic
1060982802 9:127803279-127803301 CCCACTTCCCAACCCGGGGCGGG - Intronic
1061000508 9:127899647-127899669 CCCACCTCCCAGGCCTGGGCCGG - Intronic
1061608556 9:131730391-131730413 GCCACCTCCCAGCCTAAGGCTGG - Intronic
1061630990 9:131872106-131872128 ACCGCCTTCCAGCTCCTGGCTGG + Intronic
1061774418 9:132951324-132951346 AGCCACTCCCAGCCCGTGACTGG + Intronic
1061800744 9:133112345-133112367 ATCACGTCCCAGGTCGTGGCTGG - Intronic
1062137577 9:134937940-134937962 ACCTTCTCCCTGCCCCTGGCTGG + Intergenic
1062405229 9:136393056-136393078 CCCAGCTCCCAGCCTGTGCCTGG + Intronic
1185647229 X:1624412-1624434 ACCACCTCCCAGCATCTGCCTGG - Intronic
1185647249 X:1624474-1624496 ACCACCTCCCAGCATCTGCCTGG - Intronic
1185647291 X:1624598-1624620 ACCACCTCCCAGCATCTGCCTGG - Intronic
1185647311 X:1624660-1624682 ACCACCTCCCAGCATCTGCCTGG - Intronic
1185647329 X:1624722-1624744 ACCACCTCCCAGCATCTGCCTGG - Intronic
1187873400 X:23783108-23783130 CCCACCTCACGGCCCGAGGCGGG + Intergenic
1189251287 X:39602250-39602272 CCCTCCTCCCCGCCAGTGGCAGG - Intergenic
1192503048 X:71665701-71665723 GCCACCTCCCAGCCATTGCCTGG - Intergenic
1199976911 X:152899514-152899536 AGCAATTCCCAGCCCCTGGCTGG + Intergenic
1200042693 X:153381247-153381269 TCCACCTCCCAGACAATGGCAGG - Intergenic