ID: 1117156830

View in Genome Browser
Species Human (GRCh38)
Location 14:52950655-52950677
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2309
Summary {0: 1, 1: 0, 2: 13, 3: 135, 4: 2160}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117156818_1117156830 13 Left 1117156818 14:52950619-52950641 CCAAAGAAAGGCGAATCCCACCG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1117156830 14:52950655-52950677 GGCCACGGGCTGGGAGGTGGTGG 0: 1
1: 0
2: 13
3: 135
4: 2160
1117156815_1117156830 16 Left 1117156815 14:52950616-52950638 CCCCCAAAGAAAGGCGAATCCCA 0: 1
1: 0
2: 2
3: 7
4: 221
Right 1117156830 14:52950655-52950677 GGCCACGGGCTGGGAGGTGGTGG 0: 1
1: 0
2: 13
3: 135
4: 2160
1117156821_1117156830 -4 Left 1117156821 14:52950636-52950658 CCACCGAATTCGCAGCGCCGGCC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1117156830 14:52950655-52950677 GGCCACGGGCTGGGAGGTGGTGG 0: 1
1: 0
2: 13
3: 135
4: 2160
1117156822_1117156830 -7 Left 1117156822 14:52950639-52950661 CCGAATTCGCAGCGCCGGCCACG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1117156830 14:52950655-52950677 GGCCACGGGCTGGGAGGTGGTGG 0: 1
1: 0
2: 13
3: 135
4: 2160
1117156817_1117156830 14 Left 1117156817 14:52950618-52950640 CCCAAAGAAAGGCGAATCCCACC 0: 1
1: 0
2: 1
3: 5
4: 74
Right 1117156830 14:52950655-52950677 GGCCACGGGCTGGGAGGTGGTGG 0: 1
1: 0
2: 13
3: 135
4: 2160
1117156820_1117156830 -3 Left 1117156820 14:52950635-52950657 CCCACCGAATTCGCAGCGCCGGC 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1117156830 14:52950655-52950677 GGCCACGGGCTGGGAGGTGGTGG 0: 1
1: 0
2: 13
3: 135
4: 2160
1117156816_1117156830 15 Left 1117156816 14:52950617-52950639 CCCCAAAGAAAGGCGAATCCCAC 0: 1
1: 0
2: 1
3: 8
4: 79
Right 1117156830 14:52950655-52950677 GGCCACGGGCTGGGAGGTGGTGG 0: 1
1: 0
2: 13
3: 135
4: 2160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type