ID: 1117156831

View in Genome Browser
Species Human (GRCh38)
Location 14:52950657-52950679
Sequence CTCCACCACCTCCCAGCCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 633
Summary {0: 1, 1: 0, 2: 8, 3: 72, 4: 552}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117156831_1117156841 8 Left 1117156831 14:52950657-52950679 CCACGGGCTGGGAGGTGGTGGAG 0: 1
1: 0
2: 8
3: 72
4: 552
Right 1117156841 14:52950688-52950710 GCTTTCGGCAGAAACTCGGGAGG 0: 1
1: 0
2: 0
3: 0
4: 46
1117156831_1117156846 22 Left 1117156831 14:52950657-52950679 CCACGGGCTGGGAGGTGGTGGAG 0: 1
1: 0
2: 8
3: 72
4: 552
Right 1117156846 14:52950702-52950724 CTCGGGAGGGCGGCGGCGGCCGG 0: 1
1: 1
2: 6
3: 90
4: 594
1117156831_1117156847 23 Left 1117156831 14:52950657-52950679 CCACGGGCTGGGAGGTGGTGGAG 0: 1
1: 0
2: 8
3: 72
4: 552
Right 1117156847 14:52950703-52950725 TCGGGAGGGCGGCGGCGGCCGGG 0: 1
1: 0
2: 6
3: 52
4: 511
1117156831_1117156844 15 Left 1117156831 14:52950657-52950679 CCACGGGCTGGGAGGTGGTGGAG 0: 1
1: 0
2: 8
3: 72
4: 552
Right 1117156844 14:52950695-52950717 GCAGAAACTCGGGAGGGCGGCGG 0: 1
1: 0
2: 2
3: 20
4: 275
1117156831_1117156836 -7 Left 1117156831 14:52950657-52950679 CCACGGGCTGGGAGGTGGTGGAG 0: 1
1: 0
2: 8
3: 72
4: 552
Right 1117156836 14:52950673-52950695 GGTGGAGGACCCGGGGCTTTCGG 0: 1
1: 0
2: 2
3: 24
4: 263
1117156831_1117156849 30 Left 1117156831 14:52950657-52950679 CCACGGGCTGGGAGGTGGTGGAG 0: 1
1: 0
2: 8
3: 72
4: 552
Right 1117156849 14:52950710-52950732 GGCGGCGGCGGCCGGGGCTGCGG 0: 1
1: 11
2: 144
3: 1816
4: 4157
1117156831_1117156843 12 Left 1117156831 14:52950657-52950679 CCACGGGCTGGGAGGTGGTGGAG 0: 1
1: 0
2: 8
3: 72
4: 552
Right 1117156843 14:52950692-52950714 TCGGCAGAAACTCGGGAGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 92
1117156831_1117156840 5 Left 1117156831 14:52950657-52950679 CCACGGGCTGGGAGGTGGTGGAG 0: 1
1: 0
2: 8
3: 72
4: 552
Right 1117156840 14:52950685-52950707 GGGGCTTTCGGCAGAAACTCGGG 0: 1
1: 0
2: 0
3: 6
4: 126
1117156831_1117156839 4 Left 1117156831 14:52950657-52950679 CCACGGGCTGGGAGGTGGTGGAG 0: 1
1: 0
2: 8
3: 72
4: 552
Right 1117156839 14:52950684-52950706 CGGGGCTTTCGGCAGAAACTCGG 0: 1
1: 0
2: 0
3: 5
4: 51
1117156831_1117156845 18 Left 1117156831 14:52950657-52950679 CCACGGGCTGGGAGGTGGTGGAG 0: 1
1: 0
2: 8
3: 72
4: 552
Right 1117156845 14:52950698-52950720 GAAACTCGGGAGGGCGGCGGCGG 0: 1
1: 0
2: 0
3: 12
4: 246
1117156831_1117156842 9 Left 1117156831 14:52950657-52950679 CCACGGGCTGGGAGGTGGTGGAG 0: 1
1: 0
2: 8
3: 72
4: 552
Right 1117156842 14:52950689-52950711 CTTTCGGCAGAAACTCGGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 57
1117156831_1117156848 24 Left 1117156831 14:52950657-52950679 CCACGGGCTGGGAGGTGGTGGAG 0: 1
1: 0
2: 8
3: 72
4: 552
Right 1117156848 14:52950704-52950726 CGGGAGGGCGGCGGCGGCCGGGG 0: 1
1: 0
2: 31
3: 300
4: 1811

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117156831 Original CRISPR CTCCACCACCTCCCAGCCCG TGG (reversed) Intronic