ID: 1117156831

View in Genome Browser
Species Human (GRCh38)
Location 14:52950657-52950679
Sequence CTCCACCACCTCCCAGCCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 633
Summary {0: 1, 1: 0, 2: 8, 3: 72, 4: 552}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117156831_1117156845 18 Left 1117156831 14:52950657-52950679 CCACGGGCTGGGAGGTGGTGGAG 0: 1
1: 0
2: 8
3: 72
4: 552
Right 1117156845 14:52950698-52950720 GAAACTCGGGAGGGCGGCGGCGG 0: 1
1: 0
2: 0
3: 12
4: 246
1117156831_1117156844 15 Left 1117156831 14:52950657-52950679 CCACGGGCTGGGAGGTGGTGGAG 0: 1
1: 0
2: 8
3: 72
4: 552
Right 1117156844 14:52950695-52950717 GCAGAAACTCGGGAGGGCGGCGG 0: 1
1: 0
2: 2
3: 20
4: 275
1117156831_1117156846 22 Left 1117156831 14:52950657-52950679 CCACGGGCTGGGAGGTGGTGGAG 0: 1
1: 0
2: 8
3: 72
4: 552
Right 1117156846 14:52950702-52950724 CTCGGGAGGGCGGCGGCGGCCGG 0: 1
1: 1
2: 6
3: 90
4: 594
1117156831_1117156849 30 Left 1117156831 14:52950657-52950679 CCACGGGCTGGGAGGTGGTGGAG 0: 1
1: 0
2: 8
3: 72
4: 552
Right 1117156849 14:52950710-52950732 GGCGGCGGCGGCCGGGGCTGCGG 0: 1
1: 11
2: 144
3: 1816
4: 4157
1117156831_1117156843 12 Left 1117156831 14:52950657-52950679 CCACGGGCTGGGAGGTGGTGGAG 0: 1
1: 0
2: 8
3: 72
4: 552
Right 1117156843 14:52950692-52950714 TCGGCAGAAACTCGGGAGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 92
1117156831_1117156848 24 Left 1117156831 14:52950657-52950679 CCACGGGCTGGGAGGTGGTGGAG 0: 1
1: 0
2: 8
3: 72
4: 552
Right 1117156848 14:52950704-52950726 CGGGAGGGCGGCGGCGGCCGGGG 0: 1
1: 0
2: 31
3: 300
4: 1811
1117156831_1117156840 5 Left 1117156831 14:52950657-52950679 CCACGGGCTGGGAGGTGGTGGAG 0: 1
1: 0
2: 8
3: 72
4: 552
Right 1117156840 14:52950685-52950707 GGGGCTTTCGGCAGAAACTCGGG 0: 1
1: 0
2: 0
3: 6
4: 126
1117156831_1117156841 8 Left 1117156831 14:52950657-52950679 CCACGGGCTGGGAGGTGGTGGAG 0: 1
1: 0
2: 8
3: 72
4: 552
Right 1117156841 14:52950688-52950710 GCTTTCGGCAGAAACTCGGGAGG 0: 1
1: 0
2: 0
3: 0
4: 46
1117156831_1117156847 23 Left 1117156831 14:52950657-52950679 CCACGGGCTGGGAGGTGGTGGAG 0: 1
1: 0
2: 8
3: 72
4: 552
Right 1117156847 14:52950703-52950725 TCGGGAGGGCGGCGGCGGCCGGG 0: 1
1: 0
2: 6
3: 52
4: 511
1117156831_1117156842 9 Left 1117156831 14:52950657-52950679 CCACGGGCTGGGAGGTGGTGGAG 0: 1
1: 0
2: 8
3: 72
4: 552
Right 1117156842 14:52950689-52950711 CTTTCGGCAGAAACTCGGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 57
1117156831_1117156836 -7 Left 1117156831 14:52950657-52950679 CCACGGGCTGGGAGGTGGTGGAG 0: 1
1: 0
2: 8
3: 72
4: 552
Right 1117156836 14:52950673-52950695 GGTGGAGGACCCGGGGCTTTCGG 0: 1
1: 0
2: 2
3: 24
4: 263
1117156831_1117156839 4 Left 1117156831 14:52950657-52950679 CCACGGGCTGGGAGGTGGTGGAG 0: 1
1: 0
2: 8
3: 72
4: 552
Right 1117156839 14:52950684-52950706 CGGGGCTTTCGGCAGAAACTCGG 0: 1
1: 0
2: 0
3: 5
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117156831 Original CRISPR CTCCACCACCTCCCAGCCCG TGG (reversed) Intronic
900129186 1:1080420-1080442 CTCCTCCTCCTCCCACCCAGTGG - Intergenic
900143149 1:1146898-1146920 ATCCTCCACATCCCAGCCCTCGG - Intergenic
900158430 1:1212602-1212624 CCCCAGCCCCTCCCAGCCCCTGG + Intronic
900186954 1:1337146-1337168 CTTCAGCCCCGCCCAGCCCGCGG - Intronic
900303044 1:1987366-1987388 CTCCAGCTCCTCCCCTCCCGTGG - Intronic
900512447 1:3067077-3067099 CTCCAGCACCTCCCACCCACTGG + Intergenic
900566855 1:3337561-3337583 CTCCCCCAGCTCCCACCCCAAGG - Intronic
901229649 1:7634620-7634642 CTCCACCAGCGTCCAGCCTGGGG - Intronic
901447259 1:9316146-9316168 CCCCACCCCCTGCCAGCCCAGGG - Intronic
901672436 1:10863604-10863626 CAGCACCCCCTCCCACCCCGAGG - Intergenic
901799856 1:11701726-11701748 CTCCGCCTCCCCGCAGCCCGGGG - Intronic
902609374 1:17588236-17588258 CACCACCCCCACCCACCCCGTGG - Intronic
902856504 1:19210150-19210172 CACAGCCACCTCCCAGCCCGGGG + Exonic
904028746 1:27520922-27520944 CCACACCACCTCCCAGCCCTGGG - Intergenic
904608919 1:31714703-31714725 CCCCACCACCTCCCACCTCGGGG - Intergenic
904831568 1:33309356-33309378 CCCCCCCACCTCCCAGACGGGGG + Intronic
905007865 1:34725559-34725581 CTACACCACCACCCAGGCCTTGG + Intronic
905311411 1:37051659-37051681 CTCCACCACCTCCCCACCCGGGG + Intergenic
905942397 1:41874570-41874592 CACCACCACCTCCCTCACCGTGG + Intronic
906154444 1:43605833-43605855 CTCCACGACATCCCACCCCAGGG - Intronic
906206921 1:43991895-43991917 CTCCACCAGCTCCCACAGCGAGG - Exonic
906746703 1:48226786-48226808 CTCCACCCCAACCCAGCCCAGGG - Intronic
907410635 1:54281136-54281158 CCCCACCACCTCCCTGGCCAGGG + Intronic
907502278 1:54889890-54889912 CTCCCCTACCTCCTAGCCCCTGG + Intergenic
908252017 1:62273204-62273226 CTCCTCCTCCTCCCCGCCAGTGG - Exonic
908258091 1:62318889-62318911 CGCCCCCGCCTCCCAGCCTGGGG - Intronic
909532676 1:76699348-76699370 TTCCACCTCCTCTCAGCCCTTGG - Intergenic
909931468 1:81503748-81503770 CCCAGCCACCTCCCAGCTCGGGG + Intronic
910449184 1:87329265-87329287 CTCTCCCACCTCCCGGCCCGCGG - Intronic
911045470 1:93624117-93624139 ACCCAGCACCTCCCAGCCAGGGG + Intronic
911232030 1:95371752-95371774 CTCCACCACCTGCCAACCTGAGG - Intergenic
911486666 1:98512820-98512842 CCCCACCACCTCCCTCCCTGAGG + Intergenic
914490640 1:148148486-148148508 CACCACCAGCTCCCACCCAGGGG - Intronic
914509327 1:148317580-148317602 CTCCAGAATCTCCCAACCCGCGG - Intergenic
915238589 1:154502938-154502960 CTCCGCCCCCTCTGAGCCCGGGG - Intronic
915338985 1:155166174-155166196 CTCCCGCACCTCCCACCCCCAGG - Intergenic
915529235 1:156493892-156493914 CTCCCCCACCTGTCAGCCTGGGG - Intronic
915575534 1:156774082-156774104 CCCCACCTCCCCCCAGCCCCTGG - Intronic
915737681 1:158095054-158095076 CTCCTACACCTCCCAGCACTCGG + Exonic
915913926 1:159930240-159930262 GTCCAGCACCTCCCAGCCCTGGG + Exonic
916075971 1:161200161-161200183 CTCCACCCTCTCCCTGCCCCAGG - Intronic
917110971 1:171547683-171547705 CACCACCGCCTTCCAGCCTGGGG - Intronic
917494683 1:175529545-175529567 CTGCAACACCTCCCAGTCCTGGG - Intronic
918064488 1:181089896-181089918 CTCCACCTCCTCCCCGCAGGGGG - Exonic
918276812 1:182960317-182960339 CTCCACCAACTACCAGTCCCTGG - Intergenic
918296449 1:183161489-183161511 CTGCCCCACCTCCCACCCCATGG - Intergenic
918751224 1:188272259-188272281 AGCCCCTACCTCCCAGCCCGGGG + Intergenic
920418194 1:205812769-205812791 CACCACCCCCTCCCCGCCCCAGG + Intronic
920677781 1:208050217-208050239 CTTCATAACCTGCCAGCCCGTGG - Intronic
921956176 1:220985276-220985298 TTCCCCCTCCTCCCAGCCCTTGG + Intergenic
922572509 1:226642450-226642472 GTGCACCACCACCCAGCCTGGGG + Intronic
922781498 1:228256517-228256539 CACCACCACCTCCCAGCACAAGG - Intronic
922782288 1:228262866-228262888 CTACACCACCTCCTAGCACCAGG - Intronic
922782454 1:228263948-228263970 CCCCACCACCTCCCAGCACAAGG - Intronic
922863699 1:228840841-228840863 GGCCACCAACTCCCATCCCGAGG - Intergenic
923414212 1:233739022-233739044 CACCCCATCCTCCCAGCCCGTGG - Intergenic
1062768413 10:82171-82193 CTCCCCCTCCTCCCACCCAGGGG + Intergenic
1062817204 10:509418-509440 CTGCTCCCCCTCCCACCCCGAGG + Intronic
1063897662 10:10699364-10699386 CTCTACCACCTGCCAGACCCAGG - Intergenic
1064316928 10:14266155-14266177 CCCCACCCCCTCCCACCCCCAGG - Intronic
1064431916 10:15278736-15278758 TTCCCACACCTCCCAGCCCCTGG - Intronic
1064957987 10:20932412-20932434 CTCCCCCACCCCCCAGCCCCAGG - Intronic
1065239867 10:23694688-23694710 CCCCACCACCCCCCACCCCGCGG - Intergenic
1066180761 10:32958434-32958456 CTCCGCCTCCTCCTAGCCCCGGG - Intronic
1067064800 10:43097632-43097654 CAGCACCCCCTCCCACCCCGAGG + Intronic
1067472388 10:46546541-46546563 CTCCAACACCTCCCAGAGCAGGG + Intergenic
1067693288 10:48518192-48518214 CTCGACCACATCCCAGCATGTGG + Intronic
1067800362 10:49354162-49354184 CCCCACCAGCTCCCAGCTCTGGG - Intergenic
1068028928 10:51683761-51683783 CCCCACCACCCTCCAGCCTGTGG + Intronic
1068502653 10:57859725-57859747 CTTCACCACCTCCTTGCCCATGG - Intergenic
1068667720 10:59695139-59695161 CCCCAAAACCTCCCAGCCCTAGG - Intronic
1069719700 10:70541565-70541587 CTCCTCCTCCTCCCATCCCAAGG - Intronic
1069901989 10:71711542-71711564 CCTCACCACCTCCCAGCCCTGGG + Intronic
1070128998 10:73643776-73643798 CTCCATCCCCTCCCAACCCAAGG + Intergenic
1070358061 10:75659626-75659648 TTCCCCCACCTCCCAGTCCCTGG - Intronic
1070803392 10:79256367-79256389 CCCCACTATCTCCCAGCCCTCGG + Intronic
1074504867 10:114060587-114060609 CTCCCCCTCCTCCCAGCCCCTGG - Intergenic
1074980069 10:118612325-118612347 CTCCACCACTTCCCAGATGGTGG + Intergenic
1075011482 10:118874111-118874133 TTCCACTATCTCCCAGCCCTGGG - Intergenic
1075956586 10:126528621-126528643 CTCCACCACGGCCCAGCACTGGG + Intronic
1075971418 10:126657314-126657336 TTCCTCCTCCTCCCAGCCCCTGG + Intronic
1076096086 10:127736234-127736256 CTCCGCCACCCCACAGCGCGGGG + Intergenic
1076142815 10:128093156-128093178 CCCCACCGGCTCCCAGCCCCAGG - Intergenic
1076209927 10:128632335-128632357 CTCCCCCTCCTCCCAGCCCGGGG + Intergenic
1076218723 10:128716253-128716275 ATCCCCCAACTCCCAGCCCCAGG + Intergenic
1076588739 10:131569102-131569124 CTCCACCACCCCTCAGCATGGGG - Intergenic
1076608125 10:131702579-131702601 AACCACCACCTCCCAGCCAAGGG + Intergenic
1076647733 10:131964927-131964949 CTCCACCTCTTTCCACCCCGGGG + Intergenic
1077195259 11:1276699-1276721 CTCCACCACCTCCAACACCCTGG + Exonic
1077360403 11:2138132-2138154 CTCCGCCCGCTCCCGGCCCGGGG - Intronic
1077369716 11:2175806-2175828 CTCAACAGCCTCTCAGCCCGAGG + Intergenic
1077549239 11:3192704-3192726 CACCCCCACTTCCCACCCCGAGG - Intergenic
1078427458 11:11263508-11263530 ATCCCCCAGCTCCCAGCCCTGGG + Intergenic
1079090506 11:17476942-17476964 CTCCACCACCTGCGGGGCCGGGG + Intergenic
1080543715 11:33295292-33295314 CTCCACCCCATCCCCGCCCATGG + Intronic
1081604546 11:44519205-44519227 CTCTGCCACCTCCCAGCTTGGGG - Intergenic
1082023430 11:47553293-47553315 CTCCTCCACTTCCCAGCCCGAGG - Intronic
1082955227 11:58863584-58863606 CCCCACCCCATCCCAGCCCTAGG - Intronic
1083088376 11:60174406-60174428 CTCCGCCACCTCCCAGGCTCAGG + Intronic
1083319836 11:61838831-61838853 CTCCAGCACCTCCTGGCCTGCGG + Intronic
1083330297 11:61894865-61894887 TTCCACCTCCTCCCAGCCCCAGG - Intergenic
1083553878 11:63610515-63610537 CTCCAGCCCCTCTCAGCCCGTGG + Intronic
1083653799 11:64219543-64219565 CTCCCCCACCTCCCCGCTCTGGG - Exonic
1083662998 11:64260475-64260497 CTGCCCCACCTCCCTGCCCAGGG - Intronic
1083672339 11:64306237-64306259 CGCCTCCCCCTCCCCGCCCGCGG - Exonic
1083888922 11:65586084-65586106 CTCCAGGGCCTCCCAGCCCCAGG + Intronic
1083936440 11:65872355-65872377 GTCCACCATCTCGCAGCCCCAGG - Exonic
1083955627 11:65981466-65981488 CCCCAACCCCTCCCAGCCCTGGG - Intergenic
1083957482 11:65993148-65993170 CTCCACACCCTCCCACCCCCCGG + Intergenic
1084315722 11:68344097-68344119 CTCCACCCCTACCCAGCCTGCGG - Intronic
1084659884 11:70540463-70540485 TACCACCTCCTCCCTGCCCGCGG + Intronic
1085456015 11:76665817-76665839 CACCCCCACCTCCCTGCCCTAGG - Intronic
1088547771 11:110978243-110978265 CTCCACCACTCCCCAGCCTCTGG - Intergenic
1088791998 11:113234449-113234471 CACTACCTCCTCCCAGCCCCTGG + Intronic
1089474069 11:118744081-118744103 CTCCACCACCTCCCATGAGGAGG + Intergenic
1089504819 11:118956244-118956266 CTCCAGCCCCTCCCACCCCCAGG + Intronic
1089832608 11:121341780-121341802 TTCCTCCTCCTCCCAGCCCCTGG - Intergenic
1091360827 11:134977490-134977512 CACCTCCAGCTCCCAGCCTGGGG - Intergenic
1091449714 12:564974-564996 CTCCACCCTGTCCCAGACCGTGG + Intronic
1096001147 12:48131572-48131594 CTCCACCCTCTCCCTGCCCCAGG - Intronic
1096255453 12:50059343-50059365 CTCGACCCCCACCCAGCCTGAGG + Intronic
1096456923 12:51795215-51795237 CTCCACCACCTCCTAGCGAGTGG - Intronic
1096493007 12:52023293-52023315 CTCCACCCTCGCCCACCCCGGGG + Intronic
1096582104 12:52592316-52592338 CCACACCACCTTCCAGCCAGGGG + Intronic
1097196050 12:57243020-57243042 CCCCACCCCCTCCCAGGCCCAGG + Intergenic
1097959053 12:65514695-65514717 CTCCACCCCCACCCAGGCAGGGG + Intergenic
1098106008 12:67069418-67069440 CTGCACCAGCTCCCCGCCCCCGG - Intergenic
1098996369 12:77125420-77125442 CTCCAATCCCTCCCAGCCCCTGG - Intergenic
1099014119 12:77324927-77324949 CGCCGCCACCTAGCAGCCCGCGG - Intergenic
1099901623 12:88717727-88717749 CTCTCCCTCCTCCCAGCCCTAGG - Intergenic
1100404705 12:94263193-94263215 CCCCACCGCCTCCCCGCCCCCGG + Intronic
1100945182 12:99774982-99775004 CTCCTCCACTCCCCAGCCCCTGG - Intronic
1101339017 12:103824774-103824796 CTCCACCCCTGCCCAGCCCCAGG + Intronic
1101605959 12:106247875-106247897 CTCGCTCGCCTCCCAGCCCGCGG - Exonic
1102480822 12:113221864-113221886 CTCCACGTGCTCCCAGCCCCTGG - Intronic
1102539705 12:113609993-113610015 CTCGGCCTCCGCCCAGCCCGAGG - Intergenic
1103415025 12:120737862-120737884 GTCCACCACCGCCCGGGCCGAGG + Exonic
1103721458 12:122977775-122977797 ATCCCCCTCCTCCCAGCCTGGGG + Intronic
1103779539 12:123389499-123389521 CTCCACCATCTCCGGGCCCGGGG - Exonic
1103910584 12:124349943-124349965 CACCTCCACCTCCCAGGCCTGGG + Intronic
1103975899 12:124702394-124702416 CTCCCCACCCTCCCAGCCCATGG + Intergenic
1103988889 12:124785174-124785196 CTTCCACCCCTCCCAGCCCGGGG + Intronic
1105038910 12:132946681-132946703 CTCCCGCAACTCCCAGCCCTGGG - Intronic
1105209218 13:18247940-18247962 CTGCCCCAACACCCAGCCCGGGG - Intergenic
1105217522 13:18297753-18297775 CTCCACCATCTCCGGGCCCGGGG - Intergenic
1106614875 13:31317073-31317095 CTTCCCCACCTGCCAGCCAGGGG + Intronic
1107376125 13:39806633-39806655 TTCCACCTCCTCCCAGCCCAGGG - Intergenic
1109094173 13:58090014-58090036 CTTCCCCACCTCCCAGCCTCTGG - Intergenic
1111055739 13:82947612-82947634 TTCTACCATCTCCCAGCCCCTGG - Intergenic
1112126025 13:96469454-96469476 CTCCTCCACCTTTCAGCCTGAGG + Intronic
1112201350 13:97278900-97278922 CTCAACCACTTCCCAGCCTTGGG + Intronic
1113810278 13:113137340-113137362 CTCCCCCACCTGCCAACCCTTGG - Intronic
1113967860 13:114164685-114164707 CTCCTCCACCATTCAGCCCGAGG + Intergenic
1114617974 14:24078263-24078285 CTCCCTCACCTCCCAACCCCAGG + Intergenic
1115899806 14:38132756-38132778 TTTCACCACTTCCCAGCCCCTGG - Intergenic
1116791936 14:49348435-49348457 CTCCACTGCCCCCCAGCCTGGGG + Intergenic
1117156831 14:52950657-52950679 CTCCACCACCTCCCAGCCCGTGG - Intronic
1118690446 14:68333933-68333955 CTCCACCACACCCCAGCCTCTGG + Intronic
1119148006 14:72333784-72333806 CTCCATCCCCTCCCTGCCAGAGG + Intronic
1119259351 14:73228307-73228329 CCCCAGCCCCTCCCAGCCCGGGG - Intergenic
1119545617 14:75469476-75469498 CTCCACCTCCTCCCAGCCCATGG - Exonic
1119814693 14:77555393-77555415 CTCCACCACACCCCGGCCTGTGG + Exonic
1119874475 14:78045740-78045762 TTCCCCCACCTTCCAGCCCCTGG - Intergenic
1120813091 14:88824890-88824912 CTCCCCGGCCTCCCAACCCGGGG - Intronic
1120937956 14:89917249-89917271 CTTCCCCACTTCCCAGCCCCTGG + Intronic
1121224494 14:92311332-92311354 CACCCCCACCTCCCACCCCATGG + Intergenic
1121789876 14:96690985-96691007 CTCCAATACCTCCCAGTCCTAGG + Intergenic
1122166598 14:99829630-99829652 CCCTCCCGCCTCCCAGCCCGTGG + Intronic
1122413277 14:101536777-101536799 CTCCAGGAGCTCCCAGCCCATGG + Intergenic
1122802736 14:104239683-104239705 CCCCACCACCTCCAAGGCCTTGG - Intergenic
1122994693 14:105256732-105256754 CACCAGAACCTCCCAGCCCCAGG + Intronic
1124593574 15:31075645-31075667 CTCCACCAGCTCCCAGTCAGGGG - Intronic
1125645265 15:41267166-41267188 CACCACCATCCCCCAGCCCTGGG - Intronic
1126872152 15:53001482-53001504 CTCCATCTCCTCCCAGTCCAGGG - Intergenic
1127383039 15:58445693-58445715 CTCCATCACTTCCCAGCACGTGG + Intronic
1127389057 15:58490714-58490736 CTCCACCCACTCCCAGCCCCGGG - Intronic
1127687691 15:61364803-61364825 CTCCAATAACTCCCAGCCAGAGG - Intergenic
1127922470 15:63504420-63504442 GTCCGCCCCCGCCCAGCCCGCGG - Intergenic
1128119199 15:65133437-65133459 GGCCACCGCCTCCCGGCCCGGGG - Exonic
1128476757 15:68004122-68004144 CTTCACCACCTCCCACCCATAGG - Intergenic
1128742743 15:70095467-70095489 CCCCACCACCGCCCAGCCGCAGG - Intronic
1128982608 15:72198002-72198024 CTCCGGGACCTCCCAGTCCGGGG - Intergenic
1129528388 15:76239540-76239562 TTCCCCCACCTCCCAGCCCCTGG + Intronic
1129664742 15:77573289-77573311 CTCCACCCTCTCCCAGCACAAGG + Intergenic
1129759141 15:78118834-78118856 TTCCCCCTCCTCCCAGCCCCTGG + Intronic
1129832895 15:78682113-78682135 CTCCTCCACCTCCCTGCACAAGG - Intronic
1130678990 15:85980031-85980053 GTCCTCCACCTCTCAGCCCCTGG - Intergenic
1130937513 15:88482778-88482800 CACCCCCACCTCCCACCCAGTGG - Intergenic
1131108040 15:89747827-89747849 CTCCACTACCACCCGGCACGGGG + Intergenic
1131166446 15:90145397-90145419 CTCCACCAGCTGCCAGGCGGAGG + Intergenic
1131181284 15:90241647-90241669 CTCCAGGACCTCCCAGCTCCTGG + Exonic
1132200677 15:99952630-99952652 CTCCACCTGCCCCCAGCCCATGG - Intergenic
1132457284 16:31194-31216 CTCCCCCTCCTCCCACCCAGGGG + Intergenic
1132520072 16:382805-382827 GTCCCCCACCTCCCAGTCGGGGG - Intronic
1132672972 16:1109286-1109308 CTGCACCGCCCCCCAGCCCCCGG - Intergenic
1132747526 16:1443210-1443232 CGCCACCACCTCCCCGCCCTGGG + Intronic
1132892734 16:2212261-2212283 CTTCAGCACCTCCCAGGCCTGGG - Exonic
1133010175 16:2906048-2906070 CCCAGCCACCGCCCAGCCCGTGG - Intergenic
1133332940 16:4987716-4987738 CTCCTCCGCCCCCCAGCCCCAGG - Intronic
1133741099 16:8652084-8652106 CTCCCCCAACTGGCAGCCCGTGG - Intergenic
1133802450 16:9094520-9094542 CACCCCCACCTCCCAGTCCCTGG + Intronic
1134514145 16:14873345-14873367 CTCCACCACCTCCCACTCTCAGG - Intronic
1134701787 16:16271844-16271866 CTCCACCACCTCCCACTCTCAGG - Intronic
1134970043 16:18522806-18522828 CTCCACCACCTCCCACTCTCAGG + Intronic
1135133657 16:19872354-19872376 GCCCACCAGCTGCCAGCCCGCGG + Exonic
1135325600 16:21523575-21523597 GTCCTCCACCTGCCAGCCCTGGG - Intergenic
1135412807 16:22247931-22247953 CACCACCACCTCCCCTCCCTGGG + Intronic
1136288895 16:29259987-29260009 CCCCTCCACCTCCCAGCTCCTGG - Intergenic
1136498966 16:30660122-30660144 CTCTACCTCCTCCCACCCCAGGG - Intronic
1137605621 16:49784986-49785008 CTCCTACCCCTCCCAGCCCCAGG - Intronic
1138342514 16:56299491-56299513 CCCCAGCCCCACCCAGCCCGAGG + Intronic
1138380517 16:56598623-56598645 ATCCCCCACCGCCCAGCCCTGGG + Intergenic
1138552964 16:57757330-57757352 CCACACCCCCTCCAAGCCCGGGG + Intergenic
1138838465 16:60467847-60467869 CTCCCCCAACTCCCAGCCTCTGG - Intergenic
1140479891 16:75256833-75256855 CTGCCCCACCTGCCAGCCCCAGG - Intronic
1140843896 16:78868362-78868384 CTCCACTCACTCCCAGCCCCAGG - Intronic
1141531067 16:84647643-84647665 CTCCAGCAACTCCCCGCCCCTGG + Intergenic
1141786710 16:86205646-86205668 CCTCACCACCACCCTGCCCGTGG - Intergenic
1142029070 16:87829491-87829513 CTCATCCACCTCCCAGCACGGGG - Intergenic
1142094623 16:88232894-88232916 CCCCTCCACCTCCCAGCTCCTGG - Intergenic
1142226101 16:88878343-88878365 CTCCATCTCCTCCCACCCCGGGG + Intronic
1142256354 16:89015554-89015576 CTCCTCCAGCTCCCAGCCCAGGG - Intergenic
1142408857 16:89906097-89906119 CCCCACCCCCACCCAGCACGAGG - Intronic
1142638424 17:1271438-1271460 CGCCCCCACATCCCAGCCTGGGG + Exonic
1142716307 17:1748769-1748791 CTTCCCCACCTCCCAGCCTCAGG - Intronic
1142817484 17:2438065-2438087 CTTCACCACCTGCCAGCACATGG - Intronic
1143410666 17:6706576-6706598 CTCCACCCCCTTCCAGCCCTGGG + Intronic
1143576755 17:7798266-7798288 CTACACCACCTTCCAGATCGAGG + Exonic
1144548012 17:16215540-16215562 CTCTCCCTCCCCCCAGCCCGCGG + Exonic
1144681068 17:17195033-17195055 CTCCACCACCACCCACCCCCCGG + Intronic
1144689367 17:17250066-17250088 CTCCTTCTCCTCCCAGCCCCTGG + Intronic
1144739945 17:17576190-17576212 CTCCCACACCTCCCAGACTGTGG - Intronic
1144769344 17:17750886-17750908 CTCAACCACCTCCCCACCCTTGG - Intronic
1144836824 17:18160939-18160961 CTCCTGCTCCTCCCAGCCCTGGG + Intronic
1144889327 17:18484961-18484983 TTCCCCCACCTCCCAGCACCAGG + Intronic
1145065881 17:19761026-19761048 CTCCTCCACTCACCAGCCCGTGG + Intergenic
1145142882 17:20459335-20459357 TTCCCCCACCTCCCAGCACCAGG - Intronic
1145792996 17:27639351-27639373 CTCCCCCACCCCCCAGCACCAGG + Intronic
1145807851 17:27747168-27747190 CTCCCCTACCTCCCAGCACCAGG + Intergenic
1145871523 17:28277288-28277310 CTCCACCAACTACCAGTCCCTGG - Intergenic
1145901629 17:28493938-28493960 CTCCACCACCCTCCACCCTGTGG + Intronic
1146815732 17:35940671-35940693 ATCCCCCACCTCCCAACCCCTGG + Intronic
1146819523 17:35973704-35973726 CTCCAGGAGCTCCCAGCCTGGGG - Intergenic
1146832916 17:36085327-36085349 CACCCCGACCTCCCAGCCCCTGG - Intergenic
1146934939 17:36807636-36807658 CTCCACCACCTTTCAGCCTCAGG + Intergenic
1146938082 17:36824911-36824933 CCCCACCAACTCCCAGCTGGAGG - Intergenic
1147507320 17:41032328-41032350 CTCCACCACCACCCTACCCCCGG - Intergenic
1147597215 17:41724929-41724951 TTCCACCTCCTCCCAGCCCTCGG + Exonic
1148127004 17:45242171-45242193 CTCCATCTCCCCCCAGCCCCGGG - Intronic
1148352645 17:46951662-46951684 CTGCACAACCTCCCAGGCCAGGG + Intronic
1148799302 17:50213200-50213222 CTTTACCACTTCCCAGCCAGGGG - Intergenic
1149639252 17:58192560-58192582 CCCCACCTCCTACCAGCCTGGGG - Intergenic
1149925101 17:60694895-60694917 CTCTACCTCCTCCCAGCCCCTGG + Intronic
1150315103 17:64162681-64162703 TTCCTCCACCTCCCAGCTCCTGG - Intronic
1150317574 17:64182307-64182329 GTCCCCCTCCTCCCAGCCCCTGG - Intronic
1151269970 17:72986545-72986567 CTCCACCCCCAGCTAGCCCGAGG + Intronic
1151428459 17:74046785-74046807 CTCCTCCCACTCCCAGCCCCTGG + Intergenic
1151473718 17:74333257-74333279 CCCCAGCCCCTCCCAGCCCCAGG + Intronic
1151578151 17:74963137-74963159 CTCCACCACCCCCAAGCCCTGGG - Intronic
1151715217 17:75827712-75827734 CTCTACCACATCCCAGCACCAGG - Exonic
1151728917 17:75899600-75899622 CTCCCCCCCTTCCCTGCCCGAGG - Exonic
1152303452 17:79508393-79508415 CTCCTCCGCCTGCCTGCCCGAGG + Intronic
1152554944 17:81048494-81048516 CTCCACCTCCTCCCAACTTGGGG - Intronic
1152642297 17:81454318-81454340 CTGCCCCAGCTCCCAGCCTGGGG + Intronic
1152782251 17:82231567-82231589 CCCCACCACCTCCCGGCCCCAGG + Intronic
1152879857 17:82808601-82808623 CCCCAGCACCTGCCAGCCCTTGG - Intronic
1152961295 18:81996-82018 CTCCCCCTCCTCCCACCCAGGGG + Intergenic
1153929612 18:9866716-9866738 CTCCACCACCTCCTGGAACGGGG - Intergenic
1154170232 18:12046207-12046229 CTCCTCCCCTTCCCAGCCCCCGG + Intergenic
1154192369 18:12241417-12241439 CTCCCCCTCCTCCCAGACCCTGG + Intergenic
1154494477 18:14945467-14945489 CACCTCCAGCTCCCAGCCTGGGG + Intergenic
1155200689 18:23515086-23515108 CTCGGCCACCTCCCAGACCATGG - Intronic
1155298117 18:24403895-24403917 CTCCACCACCTCCTTCCCCCTGG - Intergenic
1157035599 18:43969416-43969438 CTCGACTACCTCCCAGGCCTAGG + Intergenic
1157201493 18:45663774-45663796 CCCCACCGCCTCCTAGCCAGGGG - Exonic
1157310855 18:46552037-46552059 TTCCACCTCCTCCCAGCCCCTGG - Intronic
1157480336 18:48049959-48049981 CTCCACCTCCTCCCATGCCCAGG + Intronic
1158090062 18:53700659-53700681 CTCCCCCACCTCCCAGCCCCTGG + Intergenic
1158170240 18:54590168-54590190 TTCCGCCTCCTCCCAGCCCCTGG + Intronic
1159889367 18:73939730-73939752 CTCCACCACCTCCCATCTCCCGG + Intergenic
1160196621 18:76760409-76760431 CTCCACCACAATCCAGCCTGGGG - Intergenic
1160251952 18:77210518-77210540 CACCCCCACCCCCCAGCCAGAGG - Intergenic
1160659635 19:291871-291893 CTTCTCCACGTCCCCGCCCGGGG - Intergenic
1160703250 19:518097-518119 TCCCAGCACCCCCCAGCCCGGGG - Intronic
1160994978 19:1878340-1878362 CACCACCAGCTCCCACCCAGGGG + Intronic
1161138274 19:2633568-2633590 ATCCACGACCACCGAGCCCGGGG - Intronic
1161165029 19:2782190-2782212 CTCCACCAACTCCAAACCAGGGG + Intronic
1161556600 19:4946182-4946204 CCCCACCCCCTCCCAGTCCCTGG + Intronic
1162504430 19:11074735-11074757 CCACACCCCCTCCCAGCCCGTGG - Intergenic
1162572120 19:11479953-11479975 CTCCCCCTCCCCGCAGCCCGAGG + Intronic
1162934201 19:13973006-13973028 CCCCGCCACCTCCCAGGCGGTGG - Exonic
1162948482 19:14057378-14057400 CTCCTCCACCTCCCGGCGCGCGG + Exonic
1162954452 19:14090513-14090535 CTCCTCCGCCTCCCCCCCCGGGG + Exonic
1162967428 19:14162536-14162558 CTCCACCCCCACCCACCCCTGGG - Intronic
1163235807 19:16029777-16029799 CTGCACCTCCTCCCAGCATGTGG + Intergenic
1163469231 19:17487090-17487112 ATGCACCAACTCCCTGCCCGGGG - Intronic
1163551787 19:17969550-17969572 CCCCACCCCCTCCCTGCCCAGGG + Intronic
1163590896 19:18193627-18193649 CTCCATCACCTCCCAACCCCCGG + Intronic
1163684731 19:18704940-18704962 CTCCATTCCCTCCCAGCCCCTGG + Intronic
1163811236 19:19433179-19433201 CTCCACCACCCCCCTGCCCCAGG + Intronic
1164996106 19:32720849-32720871 CTACCCCAGCTCCCAGCCCGGGG - Intronic
1165861663 19:38912254-38912276 CCCCGCCCCCTCCCCGCCCGCGG + Intergenic
1165942223 19:39420671-39420693 TTCCACACCCTCCCAGCCCAAGG - Intronic
1166354064 19:42216960-42216982 CTCATCCTCCTCCCAGCACGGGG + Exonic
1166688562 19:44809859-44809881 CACCCCCACCCCCCAGCCCCCGG - Intronic
1166991733 19:46696964-46696986 CCCCACCACTTTCCAGCCAGGGG - Intronic
1167360586 19:49028462-49028484 CTCCTCCACCTCCGAGCTCTGGG + Intronic
1167425779 19:49429012-49429034 CTCCAGCCCCTCCCACCCCAGGG - Intergenic
1167694365 19:51005971-51005993 CACCACCACATCCCACACCGGGG - Intronic
1168097898 19:54125868-54125890 CGCCACCGCCTCACAGCCCTGGG + Intronic
1168336209 19:55599215-55599237 CTCCTCCACCCCGCAGCCTGAGG + Intronic
1168471356 19:56643231-56643253 CTCCGCCTCCTTCCCGCCCGCGG - Intronic
925161351 2:1686198-1686220 CCCCAACAGCTCCCTGCCCGAGG + Intronic
926135248 2:10331553-10331575 CTCCACCACCAGCCAGCGCTTGG - Intronic
926171310 2:10554514-10554536 TTCCTCCTCCTCCCAGCCCCTGG - Intergenic
926291545 2:11535098-11535120 CTCCTCTACCTCCCACCCCAGGG - Intronic
927226049 2:20767166-20767188 CTGCACCCCCTCACAGCCTGGGG - Intronic
927267008 2:21162635-21162657 CTTCACCCCCTCACAGCCTGGGG + Intergenic
928100665 2:28435696-28435718 CTCCACCAGCACCCAGACAGTGG - Intergenic
929452718 2:42047908-42047930 CGCCTCCACCTCCCAGCTCCCGG - Intergenic
929488217 2:42373752-42373774 TTCCCCCTCCTCCCAGCCCCTGG + Intronic
929588621 2:43131327-43131349 GTCCTCCACCTCTGAGCCCGGGG + Intergenic
929810101 2:45182594-45182616 CTTCAGCACCTCCCAGGCCAGGG - Intergenic
929879082 2:45821049-45821071 CTCCTCCACCTCCCTACCCCAGG - Intronic
930036250 2:47087200-47087222 GTCCACCACATCCAAGCCAGTGG - Intronic
931253595 2:60552810-60552832 CCCCACCAGCTCCCACCCCCAGG + Intronic
931771148 2:65499259-65499281 CTCCACCTACTGCTAGCCCGAGG - Intergenic
931791295 2:65666495-65666517 CTCCACCAACTACCAGTCCCTGG + Intergenic
932291192 2:70581222-70581244 CTCTAACATCTCCCAGTCCGTGG + Intergenic
932341518 2:70965229-70965251 CCCCACCACCTCGGAGCCAGCGG - Exonic
932449071 2:71798220-71798242 CTCCACCACCAGCCATCCAGGGG - Intergenic
932657179 2:73620210-73620232 CTCCACCACCACCAAGGCTGGGG + Intergenic
932663849 2:73680453-73680475 CTCCACCACCACCAAGGCTGGGG + Intergenic
933919502 2:87030490-87030512 CTCCACCACCACCCAACATGAGG + Intergenic
934003492 2:87739412-87739434 CTCCACCACCACCCAACATGAGG - Intergenic
934296784 2:91748900-91748922 CTCCACCATCTCCAGGCCCGGGG + Intergenic
934609852 2:95727029-95727051 CTCGCCCACCTCCCAGCCTCTGG - Intergenic
934731921 2:96664345-96664367 TTCCACCCCCTCCCATCCCCAGG + Intergenic
935233652 2:101120082-101120104 CTCCACCACCACCAACACCGAGG + Intronic
935901295 2:107796600-107796622 TTCCCCCACCTCCCAGCCCCTGG + Intergenic
937917852 2:127107586-127107608 CTCCGCCTCCTCCCAGCCTTCGG + Intergenic
938100280 2:128493491-128493513 CCCCGCCCCCTCCCCGCCCGCGG + Intergenic
938875889 2:135531323-135531345 CTTTACCTCCTCCCAGGCCGCGG - Intergenic
939391140 2:141570860-141570882 CTCCAATAACTCCCAGCCAGAGG + Intronic
940292210 2:152088019-152088041 CTTCCCCACCTCCCAGCCCTAGG - Intronic
940479445 2:154210003-154210025 TTCCACCACCTCTCAGCCTCTGG + Intronic
941125599 2:161580101-161580123 CTCCACCAACTACCAGTCCCTGG + Intronic
941573565 2:167201451-167201473 CGACACCACCTCCCATCCCCTGG + Intronic
941853308 2:170206038-170206060 CTCCTCCATCTCCCTGCCCCAGG + Intronic
942301023 2:174562550-174562572 CACCACTCCCTCCCATCCCGAGG - Exonic
942460626 2:176165644-176165666 CTCCTCCACCCTCTAGCCCGGGG - Intronic
942629776 2:177942873-177942895 TTCCCCCTCCTCCCAGCCCCTGG + Intronic
943165990 2:184326757-184326779 CTCCTCCATCTCCCAGCCAGTGG - Intergenic
946111865 2:217426951-217426973 CCCTATCACCTCCCAGCCAGTGG + Intronic
946390692 2:219415074-219415096 CTTCCCCTCCTCCCAGCCCCTGG - Intergenic
946402375 2:219475406-219475428 CCCCACCACCTCCCAGCCCATGG + Intronic
947119063 2:226798339-226798361 CCCCACCACCTCCCGCCCCGAGG + Exonic
947208253 2:227682230-227682252 CCCCACCCCCACCCAGTCCGTGG - Intergenic
947521323 2:230848177-230848199 CGCCACCACCTCCAGGCCTGCGG + Intergenic
947910560 2:233798351-233798373 CTCCACCACATCCCAGCTGTGGG - Intronic
948191030 2:236058986-236059008 CACCACCACTTTCCAGCCTGGGG + Intronic
948584916 2:239013311-239013333 CACCAGCACCTCCCAGGCCATGG - Intergenic
949031955 2:241801584-241801606 CTCCACAACCTCCCAGCTGGTGG - Intronic
1171424898 20:25043109-25043131 CTCCACCACTTCCCAGACCCTGG + Intronic
1172656435 20:36541355-36541377 CGCCCCCGCCTGCCAGCCCGTGG + Intergenic
1172656551 20:36541670-36541692 CCCTACCACGTCCCAGTCCGTGG - Intronic
1173229806 20:41185347-41185369 CTCCCCCACCCTCCAGCCTGAGG + Intronic
1174115998 20:48226616-48226638 CACCACCACCTTCCTGCCCTGGG - Intergenic
1174284852 20:49465220-49465242 TTCCTCCACCTCCCACCCCCAGG - Intronic
1174383215 20:50170981-50171003 CTGCTCCACCTGCCAGCCCAGGG - Intergenic
1174657289 20:52182202-52182224 ATCCACCACCTAACAGCCCTAGG - Intronic
1175203580 20:57294013-57294035 CCCCACCTCCTCCCAGTCCGTGG - Intergenic
1175216574 20:57394486-57394508 CTCCAGCACCCCTCAGCCAGCGG - Intronic
1175264344 20:57693446-57693468 CCCCAACACCTCCCCGCCCCGGG + Intronic
1175903121 20:62367631-62367653 CACCAGCTCCTCCCAGCCCAGGG + Intergenic
1175958468 20:62623200-62623222 CTCCACAGCCTCCGAGGCCGCGG + Intergenic
1175973689 20:62699688-62699710 CACCCTCACCTCCCAGCCAGAGG + Intergenic
1175989631 20:62781602-62781624 GTCCACGTCCTCCCAGCCCCAGG + Intergenic
1176062008 20:63176572-63176594 CTCCAGCACTGCCCAGCCCATGG - Intergenic
1176179580 20:63743031-63743053 CCCCACCCCCTCCAGGCCCGGGG + Exonic
1177788049 21:25693947-25693969 CTTCTCCACCACCCAGCCCTGGG + Intronic
1179145262 21:38762578-38762600 CTCCACCTCTCCCCAGCCCCTGG + Intergenic
1179250793 21:39669737-39669759 CTCCACCACGTCTGAGCCCCCGG - Exonic
1179601009 21:42477061-42477083 CCCCTCCACCCCACAGCCCGGGG + Intronic
1179601043 21:42477143-42477165 CCCCTCCACCCCACAGCCCGGGG + Intronic
1179601060 21:42477184-42477206 CCCCTCCACCCCACAGCCCGGGG + Intronic
1179601091 21:42477257-42477279 CCCCTCCACCCCACAGCCCGGGG + Intronic
1180220243 21:46354077-46354099 CTCCCCCACTTCTCAGCGCGCGG - Intronic
1180876773 22:19178469-19178491 CTCCACGACTCCCCAGCCCACGG + Intronic
1180909703 22:19440764-19440786 CTTCCCCACCTCCCCGCCCAAGG + Intronic
1181081214 22:20417016-20417038 TTCCCATACCTCCCAGCCCGTGG + Intergenic
1181103225 22:20555354-20555376 CTCCTCCTCCTCCTAGCCCTGGG + Intronic
1181121034 22:20668874-20668896 CACCACCAGCTCCCACCCAGGGG + Intergenic
1181334000 22:22115900-22115922 CACCACCAGCTCCCACCCAGGGG + Intergenic
1182020291 22:27076000-27076022 CTCCCCCACGTCCCTGCTCGAGG + Intergenic
1182675642 22:32036929-32036951 TTCCCCCTCCTCCCAGCCCCTGG - Intergenic
1182782655 22:32880525-32880547 CTCCACCACCACCCACCAGGGGG - Intronic
1183323617 22:37179783-37179805 CCCCCCCACCTCCCGCCCCGGGG - Intergenic
1183408147 22:37640332-37640354 CTCCCCCTCCCCCCAGCCCAGGG + Intronic
1183742994 22:39678672-39678694 CTCCATCACCTTCCCGCCCTGGG - Intronic
1184177154 22:42794912-42794934 CTCTGCCACCGCCCACCCCGGGG + Intergenic
1184243914 22:43226460-43226482 CTCCACCAGCCCTCAGCCCGAGG - Intronic
1184431790 22:44445362-44445384 CCCCAGCACCACCCAGCCCCGGG + Intergenic
1185095841 22:48805723-48805745 CTCCCTCACCAACCAGCCCGGGG + Intronic
1185143465 22:49116818-49116840 CTCCTCCCCCTCCCAGCACATGG - Intergenic
1185388960 22:50548732-50548754 CTCCACCACCCCCCAACCCCCGG - Exonic
949537924 3:5010270-5010292 CTGCACCACCCCCCACCCCGTGG + Intergenic
950504483 3:13386033-13386055 CTTCACCCTCTCCCAGCCCTTGG - Intronic
950669594 3:14518140-14518162 CTCCACAACCTCCCAGCAGTGGG - Intronic
952120490 3:30237492-30237514 CTCCACCCCTTCCCAGTCCCTGG + Intergenic
952319035 3:32258966-32258988 CTCCTCCAACTGCCAGTCCGTGG + Intronic
952874114 3:37927846-37927868 TTCCCCCTCCTCCCAGCCCTTGG + Intronic
953068273 3:39494998-39495020 CTCCACCACCTCACAGGAAGTGG + Intronic
954111310 3:48434938-48434960 CACCACCGCCTCCCAGCACTGGG - Exonic
955228204 3:57078473-57078495 CTCCACCACCGCAAAGCCCAAGG + Intronic
955642965 3:61106458-61106480 CCCCACCTCCTCCCAGCCCTTGG + Intronic
955913864 3:63886235-63886257 CTCCCCCAACTCCCAGCCTCTGG - Intronic
956758993 3:72420879-72420901 CTTCCCCAACTCCCAGCCCTAGG - Intronic
959716054 3:109433902-109433924 CTCCTCCACCCCCAAGCCCTTGG + Intergenic
960659904 3:120046063-120046085 ATCCACCTCCTCCCATCCCCTGG - Intronic
961225354 3:125239911-125239933 CTCCACTCCCTTCCAGCCCTGGG - Intronic
961455048 3:127019858-127019880 CTCCACCACCTCACAGCGGGTGG + Intronic
961950959 3:130748252-130748274 CTCCTCCCCCTTCCAGCCCTAGG + Intergenic
962134786 3:132722305-132722327 CTCGATCACTTCCCCGCCCGCGG + Exonic
965608734 3:170522622-170522644 CTCCTCCCACTCCCAGCCCCTGG - Intronic
966362942 3:179148953-179148975 CTGCACGCCCACCCAGCCCGCGG + Intronic
966525328 3:180913061-180913083 CTCCCCCACCTCCCAGAGCTCGG - Intronic
967318049 3:188168966-188168988 CTCCCCCACCTCCCATCCCAAGG + Intronic
967571729 3:191037212-191037234 CTCCACCCCTTCCCAGCCTCTGG + Intergenic
967904096 3:194486784-194486806 CTCCTCCTCCTCCGCGCCCGCGG + Intronic
967963391 3:194942445-194942467 CTCCACCAGCTCACTGCCCAGGG + Intergenic
968093055 3:195909782-195909804 CCCCCCCACCCCCCACCCCGGGG - Intronic
968222163 3:196947461-196947483 CTCCTACACCTCCCAGGCCTGGG - Exonic
968514206 4:1009634-1009656 GCCCGCCACGTCCCAGCCCGCGG - Intergenic
968713773 4:2139346-2139368 CTCCTCCACCTGCCAGCCTTTGG + Intronic
968864225 4:3197544-3197566 CTCCAGCAGCTGCCACCCCGGGG + Intronic
968909631 4:3471037-3471059 ATCCACCACCTTCCACCTCGAGG - Intronic
968937675 4:3620936-3620958 CTCCCCCACCCCCCACCCCCAGG - Intergenic
968969016 4:3783927-3783949 CTGCAGCGCCTCCCAGCCCTGGG + Intergenic
969308127 4:6336937-6336959 CTCCAACCCCTCCCTGCCTGTGG + Intronic
969435657 4:7187858-7187880 CTCCACCCCCACCGAGCCTGAGG + Intergenic
969469173 4:7376895-7376917 CCCCACCCCCACCCAGCCCACGG + Intronic
969506489 4:7591341-7591363 ATCCAGCCCCTCCCAGCCCTGGG - Intronic
969705397 4:8788852-8788874 CTCTCCCTCCTCCCAGCCTGTGG - Intergenic
969705578 4:8789439-8789461 CTCTCCCTCCTCCCAGCCTGCGG - Intergenic
970238492 4:13983011-13983033 ATCCACCACCACTCAGCCAGTGG - Intergenic
971250752 4:24971339-24971361 ATACTCCACCTCCCAGGCCGAGG - Intronic
971350556 4:25852229-25852251 CTCCAACACCACCCAGCTGGTGG + Intronic
972417932 4:38861067-38861089 CTGCACCACCTCCCAGGCTCTGG - Intergenic
973060210 4:45715013-45715035 CACCACTACCTCCCATCCCCAGG - Intergenic
973611189 4:52637274-52637296 CTCCACCCTCTCCCAGGCCCAGG + Intronic
973774387 4:54231271-54231293 TTCCCACACCGCCCAGCCCGCGG - Intronic
973820626 4:54658762-54658784 CGCCACCACCTCCAGGCTCGCGG - Intronic
975701881 4:77075315-77075337 CTCCCGCATCCCCCAGCCCGGGG - Intronic
975896212 4:79094126-79094148 TTCCACCTCCTCTCAGCCCCTGG + Intergenic
976321115 4:83717096-83717118 TTCCACTACCTCCCAGCTCCTGG + Intergenic
976805754 4:89044906-89044928 TTCTCCCACCTCCCAGCCCCTGG - Intronic
979050187 4:115920850-115920872 CTCCACCAGCTTCCAGGCGGCGG + Intergenic
979725445 4:123955669-123955691 CTCCTCCTCCTCCCTGCCCTTGG - Intergenic
981802373 4:148673261-148673283 CCCCACCAACCCCCAGCCCTAGG - Intergenic
982644209 4:158002504-158002526 CTTCACCACCACACAGCCCCTGG - Intergenic
982770193 4:159390260-159390282 CCCCCCCACCCCCCACCCCGTGG + Intergenic
983117773 4:163840628-163840650 TTCCGCCACCTTCCAGCCCCTGG - Intronic
983575124 4:169252987-169253009 CACCCCCACCTCCCACCCCTAGG - Intronic
983631880 4:169857421-169857443 CTCCCCCTCCTCCCAGCCCCTGG - Intergenic
984194969 4:176648333-176648355 CCCCCCCAACTCCCAGCCCCTGG - Intergenic
984587771 4:181582491-181582513 CACCACTACTTCCCAGACCGTGG - Intergenic
985272971 4:188211524-188211546 CTCCGCCAGTTCCCAGCCCCTGG + Intergenic
985673562 5:1218835-1218857 CTCCGTCTCCTCCCCGCCCGAGG - Intronic
985758672 5:1733687-1733709 CTCCACCACTTCCAAGCCTCAGG + Intergenic
985786515 5:1898169-1898191 CTCCCACACAGCCCAGCCCGAGG - Intergenic
986305290 5:6509696-6509718 CTCCACCCCATCCCAGCTCCCGG + Intergenic
986324552 5:6662231-6662253 CTCCACCCCATCCCAGCTCCGGG + Intronic
986721210 5:10563078-10563100 GTCCACCAGCTGCCAGCCGGTGG - Intergenic
987804057 5:22739711-22739733 CTCCATTTCCTCCCAGCCCCTGG + Intronic
988705131 5:33718556-33718578 TCCCACCCCCTCCCAGTCCGTGG + Intronic
990446857 5:55901336-55901358 CTTTACCACCTCCCATCCTGGGG - Intronic
990612115 5:57468121-57468143 CTCCCCCACCCCCCAGTCTGTGG - Intergenic
990743496 5:58935950-58935972 CTCCAGTGTCTCCCAGCCCGAGG + Intergenic
991404877 5:66292138-66292160 ATGCACCACCTCCCACCCCCAGG + Intergenic
991437853 5:66614821-66614843 CCCCATCACCTCCCAACACGAGG - Intronic
991774067 5:70067403-70067425 CTCCACCACCCCCCATGCCAGGG + Exonic
991853361 5:70942827-70942849 CTCCACCACCCCCCATGCCAGGG + Exonic
991904140 5:71491668-71491690 TTCCTCCGCCTCCCAGCCCTTGG + Intronic
992106340 5:73451615-73451637 CTCCACTACCGCCCAGTCCCGGG - Intergenic
992134671 5:73732223-73732245 CTCCCCCACCTACCAACCCTTGG + Intronic
993230285 5:85226626-85226648 CACCACCACCCCTCAGCCCCAGG - Intergenic
993872363 5:93267816-93267838 CTCCACCTCCCCCCAGGCCCAGG - Intergenic
994360750 5:98846033-98846055 CACCACCACCGCCCAGCCCAAGG - Intergenic
995142381 5:108748769-108748791 CTCCACTACCTCCCAGGAGGCGG - Intronic
995688269 5:114795198-114795220 CTTCACCACTTCTCAGCCAGAGG + Intergenic
996872875 5:128211442-128211464 CTCCCCCACCCCCCAGCCCCTGG - Intergenic
997419771 5:133756647-133756669 CTCCCCCACCTCCATGCCGGAGG - Intergenic
997503698 5:134398831-134398853 CACCACCACCACCTAGCCCCAGG + Intergenic
997581584 5:135020453-135020475 CTTCACCACCTGCCAGGCTGTGG - Intergenic
998262126 5:140639559-140639581 CTCCTCCACCCCGCAGACCGTGG - Exonic
999002668 5:147940612-147940634 CTCCCCCACCTCCCTGGCAGGGG - Intergenic
999358151 5:150956737-150956759 CTCCTCCCCCTCCCAGCCGGTGG - Intergenic
999381447 5:151124203-151124225 CTCCATCCCCTGCCAGCCCACGG + Intronic
999403687 5:151287419-151287441 CTCCAACATCTGCCAGCCCAGGG - Exonic
999419842 5:151431380-151431402 CTCCACCAGCTGCCAGTCCCTGG - Intergenic
999553948 5:152720774-152720796 CTCCACCCCCTCTCTGCCAGTGG - Intergenic
1000410126 5:160929146-160929168 CTCCACCAATTGCCAGCCTGGGG - Intergenic
1000773009 5:165380564-165380586 CTTCACCACCTCCCAGCCCCAGG + Intergenic
1002043844 5:176531416-176531438 CTCCACCAGCTGCAAGCCCCAGG - Intronic
1002521524 5:179795441-179795463 CCCCGCCCCCTCCCCGCCCGAGG - Intronic
1002796322 6:473915-473937 CTCCACAGCCTCCCAGGCCTAGG + Intergenic
1003828643 6:9979872-9979894 ATCCACCACCTCACAGCGCTAGG + Intronic
1003868505 6:10383685-10383707 CCCCACCCCGTCCCGGCCCGGGG - Intergenic
1004777020 6:18859009-18859031 ATTCCCCACCTCCCAGCCCCTGG + Intergenic
1006030094 6:31171861-31171883 CTCCCCCACCTCCCTGGCCCAGG + Intronic
1006451583 6:34108724-34108746 CTCTGCCACCTCCCAGCACCTGG - Intronic
1006453719 6:34120303-34120325 CTCCCTCACCTCCCAGCCCTGGG - Intronic
1006465197 6:34189807-34189829 CTCCACCAACTACCAGTCCCTGG + Intergenic
1007081051 6:39104571-39104593 CTCCACCACCACCCCGTCCATGG + Exonic
1007228373 6:40330457-40330479 CGCCCCCACCTCCCACCCCCAGG - Intergenic
1007232041 6:40355070-40355092 CTCCCCCTCCTCCCAGTCCCTGG - Intergenic
1008358616 6:50587402-50587424 TTCCTCCACCTCCCAGGCCCTGG + Intergenic
1008540381 6:52541626-52541648 ATCCACCACCTGCCAGCCACAGG + Intronic
1009648703 6:66445064-66445086 TTCCCCCACCTCCCAGCCATTGG + Intergenic
1011242507 6:85287770-85287792 CTCCACCAACTACCAGTCCCTGG + Intergenic
1014495239 6:122113643-122113665 CTCCATCCCCTCCCTGCCCCAGG + Intergenic
1015717123 6:136204484-136204506 CTCCAGCAGCTCTCAGCCCCCGG + Intergenic
1016128889 6:140441424-140441446 CTCCCCCGCCTCCCAGGCCATGG + Intergenic
1016508158 6:144808669-144808691 TTCCTCCACCCCCCAGCCCCTGG + Intronic
1017914323 6:158819484-158819506 TTCCGCCCCCACCCAGCCCGAGG - Intergenic
1018127280 6:160693571-160693593 CTCCACCACCACCCAACATGAGG - Intergenic
1018399056 6:163404308-163404330 TGTCACCACCTCCCAGCCCTGGG - Intergenic
1018624414 6:165763998-165764020 TTCCACCACTTCCCAGCTCAGGG - Intronic
1019265189 7:111276-111298 CTCCTCCAGCTCCCAGCCCCAGG + Intergenic
1019288501 7:235660-235682 CTCCAGCAACTCCAAGGCCGCGG - Intronic
1019619063 7:1980644-1980666 CTCCCGCAGCTCCCAGCCCAGGG - Intronic
1019639772 7:2097163-2097185 CTCCACCACGCCCCACCCCACGG + Intronic
1020275508 7:6622301-6622323 CTGCACCACCACGTAGCCCGGGG - Exonic
1021054893 7:16035406-16035428 CTCCACCAATCCCCAGCCAGTGG + Intergenic
1021403471 7:20237175-20237197 CCCCACCACCTCCCTGCCTCAGG - Intergenic
1022237473 7:28475871-28475893 CTCCAGCCCCTCCAAGCCCAGGG + Intronic
1022511694 7:30938807-30938829 ATCCACCAGCTCCAAGCCCCCGG + Intronic
1023362757 7:39432682-39432704 CCCCACCACCCCCCAACCCCGGG - Intronic
1023562215 7:41488037-41488059 CTCCACCCCCTCCCCCCACGAGG - Intergenic
1023810510 7:43907631-43907653 CTCCACCAATTACCAGCCCCAGG + Intronic
1023844695 7:44114008-44114030 CTCCGACTCCTCCCAGCCAGCGG - Exonic
1023845308 7:44116972-44116994 CTCCACCGCCACCCAGGCCCAGG + Exonic
1023919909 7:44620648-44620670 CTTGTCCAACTCCCAGCCCGTGG + Intronic
1024196857 7:47067444-47067466 ATCCACCAACTCACAGCCCCAGG + Intergenic
1025619962 7:63159711-63159733 CTCCACCCACCCCCAGCCCCTGG + Intergenic
1026738863 7:72965975-72965997 GTCCACCACCTGCCAGCACATGG + Exonic
1027104871 7:75399094-75399116 GTCCACCACCTGCCAGCACATGG - Exonic
1027269775 7:76513062-76513084 CCCCACCACCTCCCATCCCCAGG + Intronic
1027320486 7:77006957-77006979 CCCCACCACCTCCCATCCCCAGG + Intergenic
1027568078 7:79824137-79824159 TTCCCCCACCTTCCAGCCCCTGG + Intergenic
1028773746 7:94656278-94656300 CCCCTCCACCCCCTAGCCCGCGG + Intergenic
1029083341 7:97992323-97992345 TTCCCCCACCTCCCAGCTCCTGG + Intergenic
1029750091 7:102538368-102538390 CTCCACCTCCTCCCTGGCCCAGG - Intronic
1029768042 7:102637476-102637498 CTCCACCTCCTCCCTGGCCCAGG - Exonic
1030148780 7:106382255-106382277 CTCCTCCTCCTCCCAGGCCTGGG - Intergenic
1030862907 7:114658826-114658848 CTCCCCCACCTGCCATCCCTGGG + Intronic
1031031572 7:116741210-116741232 CACCACCCCCTCCCTGCCCGAGG - Intronic
1033210369 7:139455663-139455685 CTCCACCACGTCCCCACCCTGGG - Intronic
1033283878 7:140024613-140024635 CACCACCTCCTCCAAGCCCTCGG - Exonic
1034227126 7:149492949-149492971 CTACGCCATCTCCAAGCCCGAGG - Exonic
1034681718 7:152934018-152934040 GGCCACCACCTCCCATCCCCAGG + Intergenic
1034853387 7:154517093-154517115 CTTCACCATCTCCCAGCCCTTGG - Intronic
1037302589 8:17468528-17468550 CTCCACCACTGCCCAGTCAGAGG - Intergenic
1037489049 8:19379177-19379199 CACCACCAACCCCCAGCCCCTGG + Intronic
1038320186 8:26518605-26518627 TTCCACCTCTTCCCAGCCCCTGG + Intronic
1039592011 8:38757247-38757269 CCCCACCGCCTCCCCGCCCAGGG + Intronic
1039608402 8:38901137-38901159 CCGCACCCCCTCCCAGCCCGCGG + Intergenic
1039866673 8:41511267-41511289 CTCCACCAACTACCAGTCCCTGG + Intergenic
1040699367 8:50042419-50042441 CTACAGGAGCTCCCAGCCCGCGG - Intronic
1040783544 8:51139483-51139505 CTCCACCACATCCCTGGCCCTGG + Intergenic
1043881675 8:85550354-85550376 TTCCTCCTCCTCCCAGCCCCTGG - Intergenic
1048094121 8:131272844-131272866 CTACCCCTCCTCCCAGCCCCTGG - Intergenic
1049167843 8:141137790-141137812 CTCAAGCACCTGCCAGCCAGTGG - Intronic
1049360900 8:142212227-142212249 CTCCATCAGCTCCCAGCTCCGGG + Exonic
1049531162 8:143156294-143156316 CTCCATCACCTCCCACCCTGAGG - Intergenic
1049826341 8:144671212-144671234 CTGCAGCATCTCCCAGCCAGGGG + Intergenic
1050438434 9:5633898-5633920 TTCACCCACCTCCCAGCCCCTGG + Intronic
1051170571 9:14315378-14315400 CTCCACCTCCTCCCCGCGCCCGG + Intronic
1052880004 9:33596017-33596039 CTCCACACCCGCCCAGCCCATGG + Intergenic
1054941377 9:70746446-70746468 CTCCACTACCTCCCAGTACAAGG - Intronic
1055660880 9:78502857-78502879 CTCCACCAGCTCCCAGGGCACGG + Intergenic
1056470752 9:86902888-86902910 CTCCACCGCCGCCGAGCCCGGGG + Intergenic
1056558817 9:87712058-87712080 CTCCAAATCCTCCCAGCCCAGGG + Intergenic
1056740541 9:89250692-89250714 CCCCACCCCCTCCCCCCCCGGGG - Intergenic
1058542232 9:106023658-106023680 CTCCACCACTTCCCAGCATTTGG - Intergenic
1059437152 9:114283839-114283861 CCCCACCACCTCCCAGCTGAAGG + Intronic
1059941876 9:119367659-119367681 CTCCACCGCCCCCCTGCCCTTGG + Intronic
1060348505 9:122837580-122837602 CTCCACCAACTACCAGTCCCTGG + Intergenic
1060749161 9:126157498-126157520 CACCACCCCCTCCCAGCACATGG + Intergenic
1060790290 9:126481453-126481475 CTCTGCCACCCCCCAGCCTGAGG + Intronic
1060793315 9:126499851-126499873 CTCCGCCCTCCCCCAGCCCGCGG + Intronic
1061225721 9:129279769-129279791 CACCACCCCCTCCCAGGCCATGG - Intergenic
1061309097 9:129750806-129750828 CTCCTCCACCCACCAGCCTGGGG - Intronic
1061450803 9:130666081-130666103 CTCCAACACCTGCCAGCCCGAGG + Intronic
1061576146 9:131507826-131507848 TTCCACCACCTCCCAGGCCTTGG + Intronic
1061594737 9:131621578-131621600 CTCCACCACCTCCCCACCCTGGG - Intronic
1061656232 9:132092561-132092583 ATCCACCATCTCCCAGCTCAAGG - Intergenic
1062023166 9:134328693-134328715 CTCCACCACCACTCACCCCGAGG - Intronic
1062040028 9:134400300-134400322 CTCCACCCCTCCCCAGCCCCAGG - Intronic
1062077892 9:134601967-134601989 CACCACCACCTCTCACCCCATGG - Intergenic
1062077939 9:134602284-134602306 CCCCACCAACTCCCAGCTCCTGG + Intergenic
1062191762 9:135251498-135251520 GTCACCCACCTCCCAGACCGGGG - Intergenic
1062272407 9:135715554-135715576 CTCCGTCACCACCCAGCCCTGGG + Intronic
1062322502 9:135997299-135997321 ACCCCACACCTCCCAGCCCGAGG + Intergenic
1062333936 9:136056699-136056721 CTCCTCCACCTCCCAGGCTGGGG - Intronic
1062445009 9:136589967-136589989 CTGCACCATTTCCCAACCCGGGG + Intergenic
1062607250 9:137353794-137353816 CTGCACGACCTCCCACCCCACGG + Intronic
1062637242 9:137498134-137498156 CTCCACCTCCACCCAGTCCAGGG + Exonic
1062736863 9:138142140-138142162 CTCCCCCTCCTCCCACCCAGGGG - Intergenic
1185612603 X:1401700-1401722 CTCCACCCCAGCCCAGCCCCAGG + Intergenic
1186446450 X:9634244-9634266 CTCCACCAGTCCCCAGCCCTAGG + Intronic
1186616003 X:11188723-11188745 CTCACCCTCCTCCTAGCCCGAGG + Exonic
1187381915 X:18809938-18809960 ATCCTCCACCTCTCAGCCCCTGG - Intronic
1187419034 X:19119024-19119046 CTCCCCCAACTCTCAGCCCCTGG - Intronic
1188945767 X:36299663-36299685 CCCCTCCACCTCCCAGCGCCTGG + Intronic
1189212971 X:39300363-39300385 ATCCACCAACTCCCATCCCTAGG + Intergenic
1189250026 X:39593568-39593590 CCCCACAACATCCCATCCCGAGG - Intergenic
1192436147 X:71145042-71145064 CTCCTCCACTCCCCAGCCAGTGG + Intronic
1192813793 X:74570920-74570942 CCCCACCACTTCCCAACCCCTGG - Intergenic
1193084303 X:77435441-77435463 CACCTCCACCCCCCAGCCCCTGG + Intergenic
1194209605 X:91055401-91055423 TTCCACCTCCTCCAAGCCCCTGG - Intergenic
1195584381 X:106548170-106548192 TTCCCCCACATCCCAGCCCCTGG + Intergenic
1197228823 X:123981321-123981343 CCCTCCCACCTCCCAGCCCCTGG + Intronic
1198235792 X:134734860-134734882 CCCCACCACCTCCCACCCCCTGG + Intronic
1198621144 X:138511434-138511456 TTCCCCCACCCCCCAGCCCCTGG - Intergenic
1199635935 X:149811456-149811478 CTCCCACTCCTCCCAGCCTGAGG + Intergenic
1199866005 X:151850790-151850812 ATCCCCCACCTTCCAGCCCCTGG - Intergenic
1199893681 X:152112795-152112817 CTCCCACTCCCCCCAGCCCGAGG - Intergenic
1200018834 X:153185070-153185092 TTCCCACTCCTCCCAGCCCGTGG + Intergenic
1200074864 X:153545932-153545954 CGTCACCACCTCCCAGCACACGG - Intronic
1200399074 X:156008191-156008213 CTCCCCCTCCTCCCACCCAGGGG - Intronic
1201900514 Y:19043102-19043124 CCACAGCGCCTCCCAGCCCGCGG + Intergenic