ID: 1117156832

View in Genome Browser
Species Human (GRCh38)
Location 14:52950658-52950680
Sequence CACGGGCTGGGAGGTGGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 964
Summary {0: 2, 1: 1, 2: 11, 3: 82, 4: 868}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117156816_1117156832 18 Left 1117156816 14:52950617-52950639 CCCCAAAGAAAGGCGAATCCCAC 0: 1
1: 0
2: 1
3: 8
4: 79
Right 1117156832 14:52950658-52950680 CACGGGCTGGGAGGTGGTGGAGG 0: 2
1: 1
2: 11
3: 82
4: 868
1117156817_1117156832 17 Left 1117156817 14:52950618-52950640 CCCAAAGAAAGGCGAATCCCACC 0: 1
1: 0
2: 1
3: 5
4: 74
Right 1117156832 14:52950658-52950680 CACGGGCTGGGAGGTGGTGGAGG 0: 2
1: 1
2: 11
3: 82
4: 868
1117156822_1117156832 -4 Left 1117156822 14:52950639-52950661 CCGAATTCGCAGCGCCGGCCACG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1117156832 14:52950658-52950680 CACGGGCTGGGAGGTGGTGGAGG 0: 2
1: 1
2: 11
3: 82
4: 868
1117156820_1117156832 0 Left 1117156820 14:52950635-52950657 CCCACCGAATTCGCAGCGCCGGC 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1117156832 14:52950658-52950680 CACGGGCTGGGAGGTGGTGGAGG 0: 2
1: 1
2: 11
3: 82
4: 868
1117156815_1117156832 19 Left 1117156815 14:52950616-52950638 CCCCCAAAGAAAGGCGAATCCCA 0: 1
1: 0
2: 2
3: 7
4: 221
Right 1117156832 14:52950658-52950680 CACGGGCTGGGAGGTGGTGGAGG 0: 2
1: 1
2: 11
3: 82
4: 868
1117156818_1117156832 16 Left 1117156818 14:52950619-52950641 CCAAAGAAAGGCGAATCCCACCG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1117156832 14:52950658-52950680 CACGGGCTGGGAGGTGGTGGAGG 0: 2
1: 1
2: 11
3: 82
4: 868
1117156821_1117156832 -1 Left 1117156821 14:52950636-52950658 CCACCGAATTCGCAGCGCCGGCC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1117156832 14:52950658-52950680 CACGGGCTGGGAGGTGGTGGAGG 0: 2
1: 1
2: 11
3: 82
4: 868

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117156832 Original CRISPR CACGGGCTGGGAGGTGGTGG AGG Intronic
900129187 1:1080421-1080443 CACTGGGTGGGAGGAGGAGGAGG + Intergenic
900141683 1:1141484-1141506 CAGGGGTGGGGATGTGGTGGGGG - Intergenic
900158428 1:1212601-1212623 CAGGGGCTGGGAGGGGCTGGGGG - Intronic
900366108 1:2312607-2312629 CAGGTGCTGGGACGTGGGGGTGG - Intergenic
900431603 1:2605502-2605524 CACGGGGTAGGGGGTGATGGGGG + Intronic
900500114 1:3000238-3000260 CACAGGCTGGGAGGGGGTATGGG - Intergenic
900664972 1:3809047-3809069 CACAGGGTGGAAGGTGGAGGGGG + Intergenic
900803996 1:4755539-4755561 CATGGGCAGGCAGGGGGTGGGGG - Intronic
900904052 1:5538212-5538234 CAGGGGCTGGGAGGAGTAGGAGG + Intergenic
901133208 1:6975809-6975831 CAAGGGCTGGGAGGAAGTTGGGG - Intronic
901137630 1:7008066-7008088 CAAGTGCAGGGAGGTGGTGGAGG + Intronic
901216975 1:7560407-7560429 CATGGGCTGGGAGCTGGAGCCGG + Intronic
901662598 1:10807985-10808007 CTGGGGCTGGGAGGTGGGGAAGG - Intergenic
901851743 1:12020068-12020090 CAAGGGCTGGGAGGAGGAGGCGG + Intronic
902039107 1:13480019-13480041 CACTGGGTGGGAGGTGTTGCTGG - Intronic
902229420 1:15018394-15018416 CCCTGGCTGGGGGTTGGTGGTGG + Intronic
902431522 1:16367213-16367235 CAGGCGCGGGGAGGGGGTGGGGG + Exonic
902455477 1:16530795-16530817 CATGGGGTGGCAGGGGGTGGGGG + Intergenic
902496695 1:16877093-16877115 CATGGGGTGGCAGGGGGTGGGGG - Intronic
902673709 1:17993830-17993852 CACAGGGTGGGAGGGGGTGCTGG - Intergenic
902835386 1:19043767-19043789 GACTGGGTGGGAGGGGGTGGAGG + Intergenic
902866875 1:19285603-19285625 CACGGAAGGGGCGGTGGTGGGGG + Intronic
903164042 1:21508859-21508881 CACGGGCAGGGAAGCGGGGGTGG + Intergenic
903365856 1:22805106-22805128 CCAGCCCTGGGAGGTGGTGGGGG - Intronic
903383083 1:22910062-22910084 CACAGGATGGGAGGAGCTGGTGG + Intronic
903773925 1:25781091-25781113 GTGGGGCTGGGAGGTGGTGCTGG + Exonic
903970741 1:27117318-27117340 CAGGGGCAGGGAGGCTGTGGAGG - Intronic
903977774 1:27162453-27162475 AAGGGGCTGGGTGGTAGTGGTGG - Intronic
904028749 1:27520923-27520945 CCAGGGCTGGGAGGTGGTGTGGG + Intergenic
904207115 1:28862621-28862643 CAAAGGCTGGGAGGAGGTGGTGG + Intronic
904608922 1:31714704-31714726 CCCGAGGTGGGAGGTGGTGGGGG + Intergenic
904911178 1:33935703-33935725 CAGTGGCTGGGAGGTGATGCTGG - Intronic
905311409 1:37051658-37051680 CCCGGGTGGGGAGGTGGTGGAGG - Intergenic
905416239 1:37806703-37806725 AGCTGGCAGGGAGGTGGTGGGGG - Intronic
906078399 1:43068385-43068407 CCCGGGCCGGGAGGGGGCGGCGG + Intergenic
906308868 1:44738783-44738805 CCCTGTCTGGGAGGTGGGGGGGG + Intergenic
906640453 1:47438020-47438042 CGCGGGCGGGGAGGGGGCGGGGG - Exonic
906738865 1:48161111-48161133 CACGTGGTGGGAGGTGGCGCAGG + Intergenic
906781342 1:48575709-48575731 CAAGGGGTGGGAGGAGGTGCAGG - Intronic
907283444 1:53365723-53365745 CACGGGGCAGGTGGTGGTGGTGG - Intergenic
907410632 1:54281135-54281157 CCTGGCCAGGGAGGTGGTGGGGG - Intronic
907478260 1:54722578-54722600 TACTGGCTGGTAGTTGGTGGGGG + Intronic
907751473 1:57267567-57267589 CTCGGGCTGCGAAGTGCTGGAGG - Intronic
908252018 1:62273205-62273227 CACTGGCGGGGAGGAGGAGGAGG + Exonic
909038433 1:70622189-70622211 CATGGGCTATGCGGTGGTGGTGG - Intergenic
909931465 1:81503747-81503769 CCCGAGCTGGGAGGTGGCTGGGG - Intronic
910404001 1:86866433-86866455 CACGGGCTGGCAGGAGGGCGGGG + Intronic
910449185 1:87329266-87329288 CGCGGGCCGGGAGGTGGGAGAGG + Intronic
911486664 1:98512819-98512841 CTCAGGGAGGGAGGTGGTGGGGG - Intergenic
912037097 1:105331673-105331695 CCAGGGTTGGGGGGTGGTGGTGG + Intergenic
912474031 1:109924458-109924480 GACGGGCAGGGAGCTGGAGGAGG + Intronic
912542176 1:110425348-110425370 CCTGGGCTGGGAGGTGGGCGAGG + Intergenic
913015868 1:114733866-114733888 GAAGGGGTTGGAGGTGGTGGGGG + Intronic
913197747 1:116472074-116472096 CACAGGATGGGGGGTGGTGGGGG - Intergenic
913498861 1:119452408-119452430 CAAGGGATGGGAGGTGGTTAGGG - Intergenic
913502290 1:119482461-119482483 CAGGGGGTGGGAGGTGGTCAGGG - Intergenic
913700095 1:121366005-121366027 CATGCGCAGAGAGGTGGTGGTGG + Intronic
914040643 1:144046458-144046480 CATGCGCAGAGAGGTGGTGGTGG + Intergenic
914137443 1:144914021-144914043 CATGCGCAGAGAGGTGGTGGTGG - Intronic
914363580 1:146957723-146957745 CCTGGGCTGGCAGGTGGGGGAGG + Intronic
914900898 1:151710515-151710537 TGGGGGCTGGGAGGTGGGGGAGG + Intronic
914918816 1:151834052-151834074 GAAGGGATGGGAGGTGGTGGTGG + Intergenic
915514766 1:156406349-156406371 CAGGGCCTGGGAAGGGGTGGTGG + Intronic
916246901 1:162697041-162697063 TAGGGGGTGGGAGTTGGTGGGGG + Intronic
916460089 1:165014890-165014912 CACCTGCTGGGAGGCAGTGGGGG + Intergenic
916473214 1:165143663-165143685 CAAGGGCTGGGAGGAGTTGAAGG - Intergenic
916598671 1:166271464-166271486 CAGGGGCTGGAAGCTGGAGGTGG - Intergenic
916605499 1:166338554-166338576 GACTGTCTGGGAAGTGGTGGAGG - Intergenic
916892262 1:169123390-169123412 GACCTGCTGGGAGGTGGGGGTGG + Intronic
917855953 1:179099856-179099878 CAGGGTCTGGGAGGAGATGGAGG + Exonic
917968596 1:180193689-180193711 CAGTGGGTGGGAGGGGGTGGGGG + Intronic
917974609 1:180230690-180230712 CAGGGGCCGGGAGGGGCTGGCGG + Intronic
918223520 1:182457494-182457516 CACTGGCTGTGAGGTGCTGAAGG - Intronic
918276813 1:182960318-182960340 CAGGGACTGGTAGTTGGTGGAGG + Intergenic
918296450 1:183161490-183161512 CATGGGGTGGGAGGTGGGGCAGG + Intergenic
918423750 1:184387631-184387653 GAGGGGCTGGGATGTGGTCGGGG + Intronic
918561006 1:185867571-185867593 TTCTGGGTGGGAGGTGGTGGTGG + Intronic
918818912 1:189226056-189226078 CCCCGTCTGGGAGGTGGGGGGGG + Intergenic
918945323 1:191057440-191057462 CAGGGCCTGTGAGGAGGTGGGGG - Intergenic
919406685 1:197193697-197193719 CACAGCGGGGGAGGTGGTGGTGG - Intronic
919996582 1:202757082-202757104 CAAGGGCTGGGAGGTGGGGGGGG + Intronic
920192586 1:204202992-204203014 AATGGGCAAGGAGGTGGTGGAGG + Intronic
920224923 1:204431593-204431615 TACGGGATGGGAGGTGGTCAGGG - Intronic
920250356 1:204618765-204618787 CACGGACCGGGAGGCGCTGGAGG + Exonic
920285554 1:204876299-204876321 CAGGGGCTGTGGGGTGGCGGTGG - Intronic
920336082 1:205246288-205246310 CAAGGGGTGTGAGGTGGGGGCGG + Intronic
920351835 1:205343054-205343076 CAGGGGCTGGGGTGTGGCGGCGG + Intronic
920418193 1:205812768-205812790 CTGGGGCGGGGAGGGGGTGGTGG - Intronic
920487511 1:206384724-206384746 CATGCGCAGAGAGGTGGTGGTGG + Intronic
920697770 1:208194726-208194748 GAGGGGCTGGGAGGTGGAGAAGG - Intronic
920928818 1:210367905-210367927 CAGGGGGTGGGGGGTGGGGGAGG - Intronic
921054249 1:211532128-211532150 CATGGGCTGGGATCTGGAGGAGG + Intergenic
921346425 1:214190246-214190268 CAGAGGCTGGGAAGTGTTGGAGG - Intergenic
922886581 1:229025114-229025136 CACTGGCTGGGTCCTGGTGGAGG + Intergenic
923107179 1:230863737-230863759 CACGGGCTGAGAGGAGAGGGCGG - Intronic
923414213 1:233739023-233739045 CACGGGCTGGGAGGATGGGGTGG + Intergenic
923748332 1:236724177-236724199 CACGTGGTGGGTGGGGGTGGGGG + Intronic
923754979 1:236784164-236784186 GACGGCCTGGCAGGTGGTGAGGG + Intergenic
923799056 1:237189049-237189071 CAAGGGCTGGGAGGAGGACGGGG - Intronic
924733520 1:246733626-246733648 CACGTGCTAGGAAGTGGAGGAGG + Intronic
1062814164 10:487446-487468 CATGAGCTGTGAGTTGGTGGAGG - Intronic
1063723459 10:8609826-8609848 CAGGGGATGGGGGGTGGGGGAGG + Intergenic
1064000706 10:11661685-11661707 CAGGTGCTGGGTGTTGGTGGTGG - Intergenic
1065239869 10:23694689-23694711 CGCGGGGTGGGGGGTGGTGGGGG + Intergenic
1065605201 10:27411549-27411571 CACTGGGTTGGGGGTGGTGGTGG + Intronic
1066126266 10:32346399-32346421 AACGGGCTGGGTGGCTGTGGGGG - Intronic
1066370410 10:34814838-34814860 CGCGGGCGGGGAGGGGGCGGCGG - Intronic
1066489843 10:35883827-35883849 CAGAGGCTGGGAGGTGGGGCTGG - Intergenic
1067067864 10:43113697-43113719 GTGGGGCTGGGAGGTGGTGGTGG - Intronic
1067175698 10:43944000-43944022 CCCTGGCTGGCAGGTGGTGGTGG + Intergenic
1068015950 10:51516371-51516393 CACAGGATGGGAGGTGGAGTGGG + Intronic
1068028926 10:51683760-51683782 CACAGGCTGGAGGGTGGTGGGGG - Intronic
1068132590 10:52913018-52913040 CAGGGGCTGGGAGGTGGAAATGG + Intergenic
1069702076 10:70434300-70434322 TAAGGTCTAGGAGGTGGTGGAGG - Intronic
1069915427 10:71784100-71784122 CAAGGGCTGGGATGTGCAGGTGG - Intronic
1069947659 10:71998904-71998926 CAGGGGGGTGGAGGTGGTGGGGG + Intronic
1069993804 10:72330571-72330593 AACGGGCTGGGAGCTTCTGGTGG + Intergenic
1070343058 10:75515207-75515229 CAGGGGCTGGTGGATGGTGGTGG + Intronic
1070393074 10:75988328-75988350 CACGGCCTTCAAGGTGGTGGAGG - Intronic
1070782140 10:79143782-79143804 TAGGGGCTGGGGGGTGGGGGTGG + Intronic
1071302600 10:84267592-84267614 CAGAGGCTGGGAAGTGATGGAGG - Intergenic
1071360193 10:84838928-84838950 CAGGGGTTTGGTGGTGGTGGCGG - Intergenic
1071598131 10:86942696-86942718 CCCGGCCAGGGCGGTGGTGGCGG + Exonic
1071893222 10:90035226-90035248 CACGGTCTGTCAGGGGGTGGGGG + Intergenic
1072553852 10:96499328-96499350 CCCGGGATGGGTGGAGGTGGGGG + Intronic
1072622127 10:97087169-97087191 GCTGGGCTGGGGGGTGGTGGCGG - Intronic
1072703752 10:97664887-97664909 CACAGACTGGGTGGTGGTGAAGG + Exonic
1072767580 10:98108162-98108184 TGGGGGCTGGGAGATGGTGGAGG - Intergenic
1072890216 10:99316767-99316789 CCCAGCCTGGGTGGTGGTGGTGG + Intergenic
1073047133 10:100646149-100646171 GGTGGGCTGGGAGTTGGTGGAGG + Intergenic
1074504868 10:114060588-114060610 CAGGGGCTGGGAGGAGGGGGAGG + Intergenic
1074870715 10:117573848-117573870 CACTGGCTGGTAAATGGTGGTGG + Intergenic
1074977246 10:118591694-118591716 CTCGGGGTGGGGGGTGGGGGCGG - Exonic
1075721725 10:124591367-124591389 CATGGCAGGGGAGGTGGTGGGGG - Intronic
1075733721 10:124651598-124651620 CACTGTCTCGGAGGTGGGGGTGG - Intronic
1076142817 10:128093157-128093179 CTGGGGCTGGGAGCCGGTGGGGG + Intergenic
1076182751 10:128423176-128423198 CAGGGGCTGGGTAGTGGGGGTGG + Intergenic
1076209925 10:128632334-128632356 CCCGGGCTGGGAGGAGGGGGAGG - Intergenic
1076244902 10:128939210-128939232 CACAAGCTGGGAGGTGGTGGGGG - Intergenic
1076528398 10:131127340-131127362 CACGGGCTGGCTGGTGCTTGGGG - Intronic
1076623392 10:131807322-131807344 TGTTGGCTGGGAGGTGGTGGAGG + Intergenic
1076644346 10:131942139-131942161 AACTGGGTGGGAGGTGGTGTTGG - Intronic
1076726626 10:132416921-132416943 CAGGAGCTGGGGGGCGGTGGAGG + Intronic
1076787780 10:132759633-132759655 CTCGGGAAGGGAGGTGGTGGGGG + Intronic
1076809010 10:132877082-132877104 CACTCGCTGGGACCTGGTGGTGG - Intronic
1077023648 11:430505-430527 GACGGGGTGGGAAGGGGTGGCGG + Intronic
1077081371 11:726040-726062 CAGGTGCTGGGAGGCGGGGGCGG + Intronic
1077187452 11:1241739-1241761 CAGGGCCTGGGTGGTGGTGGTGG - Exonic
1077460947 11:2709227-2709249 CTGGGGCTGGGGGGTGGGGGTGG - Intronic
1077494475 11:2880226-2880248 CACCTGCTGGGAGCTGGAGGAGG + Intergenic
1079941829 11:26690153-26690175 CATGGGATGGGGAGTGGTGGTGG + Intronic
1080386036 11:31811743-31811765 CCCCGGCTGGGATGGGGTGGGGG - Intronic
1080639180 11:34148834-34148856 CTGAGGCTGGGAGGTGGGGGAGG + Intergenic
1081413713 11:42788724-42788746 CATGGTCTTGGAGGTGTTGGTGG - Intergenic
1081693561 11:45094426-45094448 CATGGGCTGGGAGGGGGTGGGGG + Intergenic
1081736973 11:45410999-45411021 GAAGGGCAGGGAGGTGGAGGCGG - Intergenic
1081903169 11:46647231-46647253 GACTTGCTGGGTGGTGGTGGTGG + Intronic
1081940451 11:46936904-46936926 CAGGGTCTGGGAGGAGGCGGGGG + Intronic
1083220517 11:61249306-61249328 CCCAGGGTGAGAGGTGGTGGAGG - Intronic
1083390324 11:62344867-62344889 CAGAGGCTGGGAGATAGTGGGGG - Intronic
1083458993 11:62798688-62798710 CACAGGCTGGGAGGGAGTGGAGG - Intronic
1083553877 11:63610514-63610536 CACGGGCTGAGAGGGGCTGGAGG - Intronic
1083811471 11:65109035-65109057 CACGGTCTGGGGGGTGGGGAAGG + Intronic
1083960542 11:66012679-66012701 GACGGGGTGGGGGGGGGTGGGGG - Intronic
1084367035 11:68708463-68708485 CATCTCCTGGGAGGTGGTGGAGG - Exonic
1084701065 11:70786322-70786344 CAGGGGCTGGGTGGAGGTGAGGG + Intronic
1084974218 11:72787726-72787748 CTCAGGCTGGGTGGGGGTGGGGG + Intronic
1085186484 11:74580119-74580141 ACAGGGCTAGGAGGTGGTGGTGG - Intronic
1085456016 11:76665818-76665840 CTAGGGCAGGGAGGTGGGGGTGG + Intronic
1087930745 11:103974631-103974653 CAGGGCCTGTGAGGAGGTGGGGG - Intronic
1088547772 11:110978244-110978266 CAGAGGCTGGGGAGTGGTGGAGG + Intergenic
1088899319 11:114103284-114103306 CTCAGGCTGGGGGGTGGTGGGGG - Intronic
1089491410 11:118886472-118886494 CAGGGGCTGGGGGGTGGGGACGG + Intronic
1089611892 11:119673834-119673856 CACGGGTTGGCAGGTGGAAGGGG - Intronic
1089631653 11:119788082-119788104 TGGGGGCTGGGAGGTTGTGGGGG + Intergenic
1089671206 11:120058156-120058178 TAGGGGCTGGGACGTGATGGAGG - Intergenic
1089743918 11:120603806-120603828 CACGTGGTGGGTGGAGGTGGGGG + Intronic
1090023590 11:123149047-123149069 GATGGGCTGGGATGTGGTGAGGG + Intronic
1090231928 11:125113595-125113617 CAGGGACTGGTAGTTGGTGGAGG - Intergenic
1091219246 11:133920532-133920554 CACAGGGTGGCAGCTGGTGGGGG + Exonic
1091360829 11:134977491-134977513 CCCAGGCTGGGAGCTGGAGGTGG + Intergenic
1091449713 12:564973-564995 CACGGTCTGGGACAGGGTGGAGG - Intronic
1091645720 12:2270888-2270910 GAGGGGCTGGATGGTGGTGGGGG + Intronic
1091667591 12:2430558-2430580 CTCAGTCTGGGAGGTGGTGGGGG + Intronic
1091738227 12:2940878-2940900 GATGGGGTGGGGGGTGGTGGTGG - Exonic
1091773259 12:3167732-3167754 CAGGGGCTAGGAGCTGCTGGGGG + Intronic
1092284158 12:7119214-7119236 CAAGGGCTGGGGGGTAGGGGTGG + Intergenic
1092385341 12:8032622-8032644 CCCGCGCCGGGAGGCGGTGGCGG + Intergenic
1092492260 12:8956234-8956256 CACGTTATGGGAAGTGGTGGTGG + Intronic
1092913505 12:13169016-13169038 GACAGGGTGGGAGGTGTTGGGGG - Intergenic
1093102696 12:15047134-15047156 TAGGGGCTGGGAGTTGGTGGGGG - Intergenic
1093268461 12:17028058-17028080 CACAGGATGGGGGGTGGTGCGGG - Intergenic
1093490740 12:19701258-19701280 CAAGGGCAGGGTGCTGGTGGGGG - Intronic
1093896897 12:24584081-24584103 CACGGACTTGGAGGTGGTGTTGG + Intergenic
1094470375 12:30796599-30796621 CACGGGCCGGGAGGGGCGGGAGG - Intergenic
1094568083 12:31617818-31617840 CACTAGCTGGGTGGTGGTGGTGG - Intergenic
1095443704 12:42264005-42264027 CAGGGACTGGGAGGTGGGGTTGG - Intronic
1095570811 12:43683453-43683475 CTAAGGCTGGGGGGTGGTGGCGG - Intergenic
1096101291 12:48971823-48971845 CGCGCGCTGGGAGGAGGGGGAGG - Intergenic
1096253750 12:50050795-50050817 CATGGGCGGGGAGGGGGAGGGGG - Intergenic
1096254193 12:50052935-50052957 TATGGGTTGGCAGGTGGTGGGGG + Intergenic
1096456924 12:51795216-51795238 CACTCGCTAGGAGGTGGTGGAGG + Intronic
1096716113 12:53492760-53492782 GGCGGAGTGGGAGGTGGTGGGGG - Intronic
1096997371 12:55847228-55847250 CAGGGGGTAGGAGCTGGTGGAGG - Intergenic
1098304997 12:69094195-69094217 CAGAGGCTGGGAAGGGGTGGGGG + Intergenic
1099014120 12:77324928-77324950 CGCGGGCTGCTAGGTGGCGGCGG + Intergenic
1099290321 12:80769243-80769265 CCAGGGGTGGGAAGTGGTGGTGG - Intergenic
1100362928 12:93894711-93894733 CACGGGCCGGCAGCTGGCGGGGG - Intronic
1100404703 12:94263192-94263214 CGGGGGCGGGGAGGCGGTGGGGG - Intronic
1101629343 12:106477834-106477856 CACGGGCTGGGAGCTGTAGACGG + Intronic
1101639809 12:106579739-106579761 CAGGGGCAGGGAGGGGGTGATGG - Intronic
1101664109 12:106793919-106793941 CATGGGCGGGGTGGGGGTGGGGG + Intronic
1102394611 12:112575376-112575398 CGCTGGCTGGGGGGTCGTGGGGG + Intronic
1102572474 12:113835515-113835537 CTCTGGCTGGGAGGCAGTGGGGG + Intronic
1103049389 12:117766655-117766677 CACTGGCCAGGAGGTGGGGGTGG + Intronic
1103910582 12:124349942-124349964 CCAGGCCTGGGAGGTGGAGGTGG - Intronic
1103937035 12:124482362-124482384 CTTGGGCTGGCAGGAGGTGGGGG - Intronic
1104014362 12:124952369-124952391 CCCGGGCAGGGAGGCGGTGGGGG + Intronic
1104014992 12:124955926-124955948 CCGGGGAGGGGAGGTGGTGGAGG + Intronic
1104118424 12:125773256-125773278 GACGTGCTGGGTGTTGGTGGAGG - Intergenic
1104405667 12:128514499-128514521 AATGTGGTGGGAGGTGGTGGTGG + Intronic
1104721073 12:131045513-131045535 CCCGGGCAGGGAGGCGGGGGTGG - Intronic
1104757787 12:131279658-131279680 CACTGGATGGGAGGTGGGGGTGG - Intergenic
1104767540 12:131340275-131340297 CACCAGCGTGGAGGTGGTGGGGG + Intergenic
1104775279 12:131387151-131387173 CACTGGGCGGGAGGTGGGGGTGG + Intergenic
1104812235 12:131626314-131626336 CACCAGCATGGAGGTGGTGGGGG - Intergenic
1104890572 12:132137884-132137906 CCGGGGCCGGGAGTTGGTGGGGG - Exonic
1104893864 12:132152580-132152602 CACAGCCTGGGAGGGGATGGTGG + Intergenic
1105484461 13:20813188-20813210 CAGGGGCGGGGACCTGGTGGGGG - Intronic
1105525186 13:21170876-21170898 CACGTGGGGGGTGGTGGTGGTGG + Intronic
1106382699 13:29255699-29255721 CACAGCCTGGGGGGTGGGGGAGG + Intronic
1106659627 13:31784924-31784946 CAAGGCCTGGGAGTTGGGGGAGG - Intronic
1107300557 13:38961550-38961572 AACCTTCTGGGAGGTGGTGGTGG - Intergenic
1108099841 13:46943066-46943088 CACGGGGTGGGGGGTTGGGGAGG + Intergenic
1108358972 13:49652418-49652440 GAAGGGTTGGGAGGGGGTGGGGG - Intergenic
1110779797 13:79451679-79451701 CAGTGTGTGGGAGGTGGTGGTGG + Intergenic
1111487867 13:88927210-88927232 CAAGGGCTGGGCAGTGTTGGGGG + Intergenic
1111951144 13:94710764-94710786 CACGGACCGGGAGGGGGTTGGGG + Exonic
1112091609 13:96090108-96090130 CACCGGCTGGCGGGTTGTGGCGG + Intergenic
1112369894 13:98785231-98785253 CGCTGGCTGAGAGGGGGTGGTGG - Intergenic
1112652539 13:101415804-101415826 CGCGGGTGGGGAGGTGGGGGTGG - Intronic
1113087149 13:106580370-106580392 CAGGAGGTGGGAGGAGGTGGAGG + Intergenic
1113676061 13:112208811-112208833 CAGGAGCTGGGAGCTGGGGGAGG + Intergenic
1113765447 13:112877998-112878020 CAGGGGGTGGGAGGGGCTGGCGG + Intronic
1114954830 14:27805035-27805057 CACAGGCTGGGAGGTTTTAGAGG + Intergenic
1116426622 14:44798966-44798988 CAGGAGCGGGGAGGTGGGGGCGG - Intergenic
1117156832 14:52950658-52950680 CACGGGCTGGGAGGTGGTGGAGG + Intronic
1118157428 14:63255544-63255566 GTGGGGCTGGGTGGTGGTGGTGG - Intronic
1118719818 14:68586072-68586094 CATAGGCTAGGAGGTGATGGGGG - Intronic
1118932428 14:70255065-70255087 GGCGGGCGGGGAGGGGGTGGGGG - Intergenic
1119545618 14:75469477-75469499 CATGGGCTGGGAGGAGGTGGAGG + Exonic
1119724767 14:76915221-76915243 CACTTGCTGGGAGGTAGGGGTGG + Intergenic
1119842607 14:77804597-77804619 CAGGGGCTGGGAGGTGGTGTTGG + Intronic
1121226809 14:92327243-92327265 CACCGGGAGGGACGTGGTGGTGG + Intronic
1121450020 14:94001149-94001171 CACGGGATGGGAGGAGCCGGAGG + Intergenic
1121645509 14:95515368-95515390 CAGGAGCTGGGAGGTGGGAGGGG - Intergenic
1122120564 14:99551293-99551315 CACGGGATTGGAGGCAGTGGGGG + Intronic
1122412877 14:101534883-101534905 CAGGGTCTGGGCTGTGGTGGGGG + Intergenic
1122413276 14:101536776-101536798 CATGGGCTGGGAGCTCCTGGAGG - Intergenic
1122779167 14:104136405-104136427 CGCGGGCGGGGCGGCGGTGGCGG + Intergenic
1122997713 14:105274521-105274543 TAGGGGCTGCGAGGTGCTGGAGG + Intronic
1123120708 14:105915143-105915165 CATGGGCTGGGAGGAGGGGCAGG - Intergenic
1202922247 14_KI270723v1_random:36285-36307 CCCGGGCTGGGTGGTGGAGGTGG - Intergenic
1123833954 15:24169289-24169311 CGGGGGCAGGGTGGTGGTGGGGG - Intergenic
1123893297 15:24802772-24802794 TGTGGGCTGGGAGGGGGTGGTGG + Intergenic
1124404296 15:29380055-29380077 AAGGGGCTGGGGGGAGGTGGGGG + Intronic
1124936050 15:34171934-34171956 CATGGGGTGGGGGGTGGGGGAGG + Intronic
1125529060 15:40399633-40399655 CTGGGGTTGGGGGGTGGTGGCGG - Intergenic
1125645267 15:41267167-41267189 CCAGGGCTGGGGGATGGTGGTGG + Intronic
1126849729 15:52789659-52789681 CAGGGGCCCGGTGGTGGTGGTGG + Exonic
1127327947 15:57913614-57913636 AATGGGCGGGGAGGGGGTGGAGG + Intergenic
1127826328 15:62707219-62707241 CACAAGCTGGGAGGTGGAGAGGG - Exonic
1128341521 15:66825806-66825828 CAAAGGCTGGGAGGTGTAGGAGG - Intergenic
1128374734 15:67066508-67066530 CGCGGGCAGGAAGGGGGTGGGGG + Intronic
1128380425 15:67107976-67107998 CACAGCGCGGGAGGTGGTGGGGG - Intronic
1128425812 15:67541725-67541747 CAGGGGTTGGGGGCTGGTGGGGG + Intergenic
1128459145 15:67853017-67853039 CATGGTCTGGGAGGTGGCAGGGG - Intergenic
1128671792 15:69579228-69579250 CAGGGGCTGGGGGGTGGGAGAGG - Intergenic
1128678767 15:69631032-69631054 CTCGGCTTGGGAGGTCGTGGGGG + Intergenic
1128781234 15:70359986-70360008 CCTGGGGTGGGAGGTGGGGGTGG - Intergenic
1128926447 15:71660601-71660623 CACGGGCTGTCAGGTTGTGTCGG + Exonic
1129167318 15:73786073-73786095 GAGGGGCAGGGAGGTGCTGGGGG + Intergenic
1129296108 15:74600991-74601013 CAGGGGCTGCAAGGTGGAGGTGG + Intronic
1129459974 15:75695647-75695669 CCCTGTCTTGGAGGTGGTGGGGG + Intronic
1129693857 15:77729474-77729496 GGAGGGCTGGGAGCTGGTGGAGG + Intronic
1129779677 15:78262337-78262359 CACGGACAGGGTGGTGGGGGTGG - Intergenic
1129792068 15:78348123-78348145 CAAGGCCTGGGGGGTGGGGGTGG - Exonic
1129904813 15:79179047-79179069 CACCGGCGGGGAGTGGGTGGTGG + Intergenic
1130937514 15:88482779-88482801 CACTGGGTGGGAGGTGGGGGTGG + Intergenic
1132025708 15:98402964-98402986 CACGGGGTGGGGGGTGGGGACGG - Intergenic
1132200678 15:99952631-99952653 CATGGGCTGGGGGCAGGTGGAGG + Intergenic
1132250939 15:100335020-100335042 CACTGGCTGAGAGGCGATGGAGG - Intronic
1132294668 15:100726352-100726374 CAGGGGCTGGGTTGGGGTGGGGG + Intergenic
1132321266 15:100927246-100927268 CACGAGCTTGGAGGTGGGGATGG - Intronic
1132495781 16:262656-262678 CACCGGCAGGGAGGTGCTCGGGG + Intronic
1132652902 16:1029488-1029510 CACAGGCTGGAGGGAGGTGGTGG - Intergenic
1132670989 16:1102254-1102276 CAGGGGACGGGAGGTGCTGGGGG + Intergenic
1133130350 16:3672873-3672895 CCCTGGCTGGGAGGTGGGGGCGG + Intronic
1133335827 16:5006125-5006147 GTGGGGCTGGGAGGTGGAGGGGG + Intronic
1133816177 16:9199009-9199031 CAAGGCCAGGGAGGTGGTCGGGG - Intergenic
1133820387 16:9231187-9231209 CAGGGGCTTGGAGATGGTGATGG + Intergenic
1134208036 16:12253584-12253606 CACAGGCAGGGGGATGGTGGCGG + Intronic
1134245824 16:12539280-12539302 CAAGGGCTTAGAGGTGGGGGAGG - Intronic
1134671587 16:16059813-16059835 GGGGGGCTGGGAGGGGGTGGGGG - Intronic
1135114127 16:19711410-19711432 CACGGACTTAGAGGTGGTGTTGG - Exonic
1135412805 16:22247930-22247952 CCAGGGAGGGGAGGTGGTGGTGG - Intronic
1135479686 16:22812956-22812978 CTATGGCTGGGTGGTGGTGGAGG + Intergenic
1135904175 16:26495518-26495540 GAAGGGATGGGAGGGGGTGGAGG + Intergenic
1136109236 16:28054256-28054278 CTGGGGATGGGAGGTGATGGAGG - Intronic
1136234048 16:28903713-28903735 CACGGGCTCAGAGATGGAGGAGG - Intronic
1136459662 16:30401755-30401777 CAAGGGGTGGGTAGTGGTGGAGG - Intergenic
1136525370 16:30826208-30826230 AAGGGGTTGGGTGGTGGTGGGGG - Intergenic
1136813596 16:33199216-33199238 CCCGGGGTGGGGGGTGGGGGGGG + Intronic
1136820072 16:33309296-33309318 CCCGGGGTGGGGGGTGGGGGGGG + Intergenic
1137236316 16:46621278-46621300 CATGGGCTGGGCGGTGGAGCAGG - Exonic
1137280568 16:46973355-46973377 CCCGGGCTGGGAGTCGGCGGCGG - Intronic
1137403041 16:48168878-48168900 CAGGGCCTGTCAGGTGGTGGGGG + Intronic
1137665935 16:50249061-50249083 CAAGGCCTGGGAGGTGGGAGTGG - Intronic
1137785166 16:51132375-51132397 CACGGGATGGGTGGGGGTGAGGG + Intergenic
1137789579 16:51163820-51163842 CACCAGCTGGGCGGGGGTGGTGG + Intergenic
1138299490 16:55914426-55914448 CACGGTCTGGTAGTAGGTGGTGG + Intronic
1138707137 16:58926983-58927005 CATGGGCTGGGAGCAGCTGGTGG - Intergenic
1138838466 16:60467848-60467870 CAGAGGCTGGGAGTTGGGGGAGG + Intergenic
1139310349 16:66023333-66023355 CCTGGGCTGGGAGGTGGTGATGG - Intergenic
1139671270 16:68493555-68493577 CACGAGCTGGGAGGTGGGACAGG + Intergenic
1139676898 16:68530096-68530118 CACGGGCTGGAAGGGGAGGGCGG - Intronic
1140075997 16:71699351-71699373 CACAGGATGGGAGGTGCTGTAGG - Intronic
1140405209 16:74705675-74705697 CAGGGCCTGTCAGGTGGTGGGGG - Intergenic
1140780321 16:78290282-78290304 CATGGGATGGGGGGTGGGGGGGG - Intronic
1141032794 16:80604171-80604193 GAAGGGCAGGGAGGTGGGGGAGG + Exonic
1141132584 16:81445632-81445654 CAGGGCCTGGGGGGCGGTGGGGG + Intronic
1141647803 16:85376779-85376801 CTGGGGCTGGGAGATGGAGGTGG + Intergenic
1141650822 16:85392081-85392103 CACGGGAAGGGAGGGAGTGGGGG - Intergenic
1141693919 16:85611318-85611340 CCAGGGCTGGGAGGGGGAGGGGG - Intergenic
1141831131 16:86510498-86510520 GACGGGCCGGGAGGAGGAGGAGG - Intergenic
1141920903 16:87134698-87134720 CATGGCCTGGGAGTTGCTGGTGG - Intronic
1142022398 16:87791846-87791868 CACGGGGTGGGCGGGGGGGGGGG + Intergenic
1142029072 16:87829492-87829514 CCCGTGCTGGGAGGTGGATGAGG + Intergenic
1142153675 16:88523662-88523684 CACAGGCTGGGAAGGGGTGAGGG - Intronic
1142165770 16:88586799-88586821 TACTGGCTAGGTGGTGGTGGTGG + Intronic
1142189385 16:88710840-88710862 CCCGCGCAGGGAGGTGGAGGCGG + Intronic
1142256356 16:89015555-89015577 CCTGGGCTGGGAGCTGGAGGAGG + Intergenic
1142263051 16:89051402-89051424 CCCGGGCTTGGAGGAGCTGGGGG + Intergenic
1142263806 16:89054482-89054504 CACGGGCTGGGAACAGGTGAGGG - Intergenic
1142325331 16:89411196-89411218 CACGAGAGGGGATGTGGTGGAGG - Intronic
1142354153 16:89594214-89594236 CTGGGGTTGGGAGGGGGTGGGGG + Intronic
1142408859 16:89906098-89906120 CTCGTGCTGGGTGGGGGTGGGGG + Intronic
1142434475 16:90047769-90047791 GACCTGCTGGGGGGTGGTGGGGG + Intergenic
1203141919 16_KI270728v1_random:1772307-1772329 CACGGGCTGCAAGGGGGAGGAGG - Intergenic
1142605013 17:1076712-1076734 CACGGGGGGGGTGGGGGTGGGGG + Intronic
1142607852 17:1091806-1091828 CACGGGCTGGGAGGTGGTGGCGG + Exonic
1142670547 17:1485758-1485780 CCCGGGCTCGGCGGCGGTGGCGG + Intronic
1142875917 17:2852320-2852342 CCCCGGCAGGGAGGGGGTGGGGG + Intronic
1142958097 17:3534980-3535002 GAGGGGCTGGGAGGAGGTGTTGG - Intronic
1143007340 17:3845809-3845831 AGGGGGCTGGGGGGTGGTGGCGG - Intronic
1143410664 17:6706575-6706597 CCAGGGCTGGAAGGGGGTGGAGG - Intronic
1143538931 17:7558220-7558242 CCCTGGCTGGGAGGTGGGGCGGG + Intronic
1143585556 17:7848668-7848690 GCCGGGCTGGGGGGTGGGGGTGG - Exonic
1143958863 17:10697702-10697724 CGCGGGCTGGGCGGTGCTGCGGG + Intronic
1144681067 17:17195032-17195054 CGGGGGGTGGGTGGTGGTGGAGG - Intronic
1144689366 17:17250065-17250087 CAGGGGCTGGGAGGAGAAGGAGG - Intronic
1144739946 17:17576191-17576213 CACAGTCTGGGAGGTGTGGGAGG + Intronic
1146422399 17:32700195-32700217 TATGGACTGGGAGGTGGTAGGGG + Intronic
1146571730 17:33958670-33958692 CACAGGCTGGGAGGTCTAGGAGG - Intronic
1146906125 17:36619049-36619071 CAAGGGCTGGGTGGTGGATGGGG - Intergenic
1147141159 17:38461285-38461307 CAGGGCCTGGGGGCTGGTGGTGG + Intronic
1147164550 17:38586396-38586418 TCAGGGCTGGGAGGTGGAGGAGG - Intronic
1147508685 17:41046857-41046879 CACAGGCTGGCAGCAGGTGGTGG + Exonic
1147508713 17:41046962-41046984 CACAGGCTGGCAGCAGGTGGTGG + Exonic
1147509431 17:41054816-41054838 CACAGGCTGGCAGCAGGTGGTGG + Exonic
1147509452 17:41054906-41054928 CACAGGCTGGCAGCAGGTGGTGG + Exonic
1147509960 17:41059745-41059767 CACAGGCTGGCAGCAGGTGGTGG + Exonic
1147510553 17:41065540-41065562 CACAGGCTGGCAGCAGGTGGTGG + Exonic
1147648899 17:42050770-42050792 CAGGGGCTGGGGGGTGGGGCCGG - Intronic
1147717801 17:42519950-42519972 CAGGGGCTGGGAGGTGGCTGGGG - Intronic
1147992549 17:44343988-44344010 CACGGGCTGGGCTGTGGTGGGGG - Intergenic
1148558473 17:48592512-48592534 CACTGGGTGGGAGGGGGCGGGGG + Intronic
1148617782 17:49013774-49013796 CAGGGGCTGCGGGGTGGGGGTGG - Intronic
1148697758 17:49571241-49571263 TAGAGGCTGGGAGGTGATGGTGG - Intergenic
1148953927 17:51337847-51337869 CATGGGCTGGGTAGTGGTGAGGG - Intergenic
1149640904 17:58201772-58201794 CAAGGTCTGGGAAATGGTGGGGG + Intronic
1149678585 17:58488093-58488115 CCCGGGCCGGGGGGCGGTGGCGG - Exonic
1150259136 17:63774190-63774212 AACGGGCCGTGAGGCGGTGGCGG + Exonic
1151202507 17:72478979-72479001 CTCTGGCTTGGTGGTGGTGGGGG - Intergenic
1151327455 17:73388032-73388054 GACGGTCTGGGAGGTGGCAGAGG + Exonic
1151404663 17:73878563-73878585 CTGGGGTTGGGAGGTGGTTGTGG + Intergenic
1151578153 17:74963138-74963160 CCAGGGCTTGGGGGTGGTGGAGG + Intronic
1152002329 17:77654559-77654581 CTTGGGCTGGGAGATGGTGGTGG - Intergenic
1152111923 17:78361232-78361254 CACTGGCGGGGAGGGGGTAGAGG + Intergenic
1152206582 17:78977561-78977583 CATGGGCGGGGAGATGGAGGAGG + Intronic
1152230263 17:79110831-79110853 CCCAGGCTGGGAGGTGGGAGTGG - Intronic
1152547520 17:81009273-81009295 CAGTGGCAGGGCGGTGGTGGCGG - Intronic
1152586116 17:81190231-81190253 CACAGGCTGAGAGGTGGGTGTGG - Intronic
1152597153 17:81243364-81243386 CCTGGGCTGGGGGGTGGGGGTGG + Intergenic
1152635421 17:81428799-81428821 GAGGGGCTGAGAAGTGGTGGGGG - Intronic
1152782249 17:82231566-82231588 CTGGGGCCGGGAGGTGGTGGGGG - Intronic
1152798752 17:82321582-82321604 GCCGGGCTGGGAGGCGGCGGCGG - Exonic
1152876314 17:82788381-82788403 CAATGGCTGGGAGGCGGCGGCGG + Intronic
1152879859 17:82808602-82808624 CAAGGGCTGGCAGGTGCTGGGGG + Intronic
1152879878 17:82808663-82808685 GAGGGGCTGGCAGGTGCTGGGGG + Intronic
1152879956 17:82808928-82808950 CAGGGGCTGGCAGGTGCTGGGGG + Intronic
1154231406 18:12559171-12559193 CACGGGGTGGGGTGGGGTGGGGG + Intronic
1154247148 18:12709367-12709389 CACAGGCTGGAGTGTGGTGGCGG + Intronic
1154494475 18:14945466-14945488 CCCAGGCTGGGAGCTGGAGGTGG - Intergenic
1156275620 18:35581170-35581192 CACGGGGTGGGAGGAGATGGAGG - Intronic
1157127181 18:44967788-44967810 CAGGGGCTGTGGTGTGGTGGGGG - Intronic
1157375630 18:47161699-47161721 GATGGGTTGGGGGGTGGTGGTGG + Intronic
1157728456 18:49983552-49983574 CAGGGGCCGGGATGGGGTGGTGG - Intronic
1157899176 18:51497507-51497529 CAGGAGCTTGGAGGTGATGGAGG + Intergenic
1159458471 18:68693426-68693448 CAGGGGTTGGGGGGTGGGGGTGG - Intronic
1159985229 18:74833751-74833773 CTCGGGCCAGGTGGTGGTGGTGG + Intronic
1160155025 18:76426985-76427007 CATGGGCTGGGACTTGGAGGTGG - Intronic
1160511691 18:79456576-79456598 CGCGGGCGGGGAGGAGGTGAGGG + Intronic
1160729805 19:636239-636261 GTGGGGCTGGGGGGTGGTGGCGG - Intergenic
1160756279 19:758521-758543 CTGGGGCTGGGAGGTGGCTGGGG + Exonic
1160808525 19:1002995-1003017 CTGGGGCTGGGGGGAGGTGGAGG + Intronic
1160838950 19:1137511-1137533 CTCGGGCTGGGGTGCGGTGGGGG + Intronic
1160838974 19:1137565-1137587 CTCGGGCTGGGGTGCGGTGGGGG + Intronic
1160838986 19:1137592-1137614 CTCGGGCTGGGGTGCGGTGGGGG + Intronic
1160839038 19:1137717-1137739 CTCGGGCTGGGGTGCGGTGGGGG + Intronic
1160839050 19:1137744-1137766 CTCGGGCTGGGGTGCGGTGGGGG + Intronic
1160839062 19:1137771-1137793 CTCGGGCTGGGGTGCGGTGGGGG + Intronic
1160839092 19:1137842-1137864 CTCGGGCTGGGGTGCGGTGGGGG + Intronic
1160839116 19:1137896-1137918 CTCGGGCTGGGGTGCGGTGGGGG + Intronic
1160839128 19:1137923-1137945 CTCGGGCTGGGGTGCGGTGGGGG + Intronic
1160839169 19:1138021-1138043 CTCGGGCTGGGGTGCGGTGGGGG + Intronic
1160839181 19:1138048-1138070 CTCGGGCTGGGGTGCGGTGGGGG + Intronic
1160839193 19:1138075-1138097 CTCGGGCTGGGGTGCGGTGGGGG + Intronic
1160839205 19:1138102-1138124 CTCGGGCTGGGGTGCGGTGGGGG + Intronic
1160839235 19:1138173-1138195 CTCGGGCTGGGGTGCGGTGGGGG + Intronic
1160886937 19:1354593-1354615 CCCGGGCTGGGAGGTGCCGTAGG + Intergenic
1160900628 19:1426223-1426245 CTGGGGCTGGGAGGCTGTGGCGG + Intronic
1160909702 19:1468937-1468959 CAGGGGCTGGGAGGCGGGCGAGG - Exonic
1161031322 19:2059080-2059102 CACGCTTTGGGAGGTGGAGGTGG - Intergenic
1161165087 19:2782581-2782603 CAGCGGGTGGGAGGTGGTGGTGG + Intronic
1161317522 19:3624638-3624660 CGCGGGCAGGGAGGTGGCTGGGG + Intronic
1161449515 19:4337071-4337093 CATGGGCAGGGAGGAGCTGGGGG + Intronic
1161551481 19:4915253-4915275 CAGTGGGTGGGAGCTGGTGGTGG - Intronic
1161872386 19:6880159-6880181 CAGGGGATGGGAGGTGGGAGGGG + Intergenic
1161928339 19:7318166-7318188 CAGGGGCTGGGGAGTGGGGGTGG - Intergenic
1162044139 19:7987603-7987625 CATGGGCTGGGCACTGGTGGCGG - Intronic
1162077009 19:8194634-8194656 GCCGGGCTGGGCGGTGGAGGAGG - Intronic
1162340326 19:10087714-10087736 CAAAGGCTGGGAGGTGGGGAAGG + Intronic
1162770065 19:12944070-12944092 AAAGGGCGGGGAGGGGGTGGGGG - Exonic
1162777693 19:12989905-12989927 CACAGGCTGGCAGGTGGGGTAGG + Intergenic
1162798121 19:13096857-13096879 CCCGGGCGGGCAGGGGGTGGGGG + Intronic
1162934203 19:13973007-13973029 CACCGCCTGGGAGGTGGCGGGGG + Exonic
1162948481 19:14057377-14057399 CGCGCGCCGGGAGGTGGAGGAGG - Exonic
1162959501 19:14117675-14117697 CAGGGGCTGGGCGGGGGTCGCGG - Exonic
1163098579 19:15079385-15079407 CACGGCCTGTCAGGTGGTGTGGG + Intergenic
1163235806 19:16029776-16029798 CACATGCTGGGAGGAGGTGCAGG - Intergenic
1163371868 19:16905658-16905680 GATGGAGTGGGAGGTGGTGGTGG - Intronic
1163684730 19:18704939-18704961 CAGGGGCTGGGAGGGAATGGAGG - Intronic
1163811235 19:19433178-19433200 CTGGGGCAGGGGGGTGGTGGAGG - Intronic
1163815339 19:19461675-19461697 ACTGGGCTGGCAGGTGGTGGGGG - Intronic
1164508678 19:28880046-28880068 CAGGGGCTGGGAAGGGTTGGGGG - Intergenic
1164737054 19:30549251-30549273 GACGGGCTGGGAGGTGCCTGTGG - Exonic
1164762076 19:30735714-30735736 GAAGGGCTGGCAGGTGGAGGAGG + Intergenic
1165027550 19:32972643-32972665 GACGGGATGTGTGGTGGTGGAGG - Intronic
1165307417 19:35011175-35011197 GAGGGGCTGGGATGTGATGGGGG - Intronic
1165395125 19:35559711-35559733 GACAGGCAGGGAGGTGATGGGGG + Intronic
1165861661 19:38912253-38912275 CGCGGGCGGGGAGGGGGCGGGGG - Intergenic
1165903291 19:39178655-39178677 CCCGGGCTGGGAGGAGTGGGAGG - Exonic
1166060888 19:40324757-40324779 AACATGGTGGGAGGTGGTGGTGG + Intronic
1166100917 19:40570858-40570880 CCAGAGCTGGGGGGTGGTGGTGG + Intronic
1166105157 19:40594548-40594570 CACAGGGTAGGAGGTGGTGAGGG + Intronic
1166390614 19:42407052-42407074 CAGGAGCTGGGAGGTGTGGGGGG + Intronic
1166688563 19:44809860-44809882 CGGGGGCTGGGGGGTGGGGGTGG + Intronic
1166750698 19:45162794-45162816 CACGGGGAGGGAGGGAGTGGAGG + Intronic
1166785184 19:45363292-45363314 CGCAGGCTGGGAGCTGGAGGAGG - Intronic
1166864950 19:45830187-45830209 CACAGGCTGGCAGGCGCTGGTGG - Exonic
1166897943 19:46035915-46035937 CCCGGGCTGGGAAGTGGGAGTGG + Intergenic
1167259397 19:48450087-48450109 CAGGGGGTGGGAGTGGGTGGGGG - Intronic
1167368173 19:49065378-49065400 GCGGGGTTGGGAGGTGGTGGGGG - Intergenic
1167506385 19:49873171-49873193 CCCGGGCGGGGTGGTGGCGGCGG + Exonic
1167636606 19:50659340-50659362 CAGGGGAAGGGAGGTGATGGGGG + Intronic
1168396605 19:56053836-56053858 GCCGGGCTGGGAGGAGGTGGGGG + Intronic
1168611612 19:57805074-57805096 AATTGGCTGGGCGGTGGTGGGGG - Intronic
1202706363 1_KI270713v1_random:27171-27193 CATGGGGTGGCAGGGGGTGGGGG + Intergenic
925375694 2:3383397-3383419 CTCGGGCGGGGCGGGGGTGGGGG - Intronic
925514006 2:4659183-4659205 CAAGGTATGGGTGGTGGTGGTGG + Intergenic
925929247 2:8694074-8694096 AGGGGGCTGGGAGCTGGTGGGGG + Intergenic
926143887 2:10385202-10385224 CAGGGGCTGGGAGGGGCTGATGG - Intronic
929452719 2:42047909-42047931 CGGGAGCTGGGAGGTGGAGGCGG + Intergenic
929819603 2:45262685-45262707 GATGGCCTGGGAGGAGGTGGAGG - Intergenic
930035622 2:47083569-47083591 GGGAGGCTGGGAGGTGGTGGGGG - Intronic
931488297 2:62716182-62716204 CCCGGGTTGGGGCGTGGTGGGGG - Intronic
931758156 2:65392816-65392838 CAAGGGCTTGGAGGAGGGGGAGG - Intronic
932341520 2:70965230-70965252 CGCTGGCTCCGAGGTGGTGGGGG + Exonic
932605586 2:73163321-73163343 GATGGGGTGAGAGGTGGTGGGGG - Intergenic
932629975 2:73332569-73332591 CACAGGCAGGGTGGTGGTGTGGG + Intergenic
932684374 2:73855552-73855574 CATGGGATGGAAGGTGGTGTTGG + Intronic
933278000 2:80303412-80303434 CATGGGCCGGAAGGTGGTGTTGG + Exonic
933278496 2:80306683-80306705 AAAGGGTTGGGAGGTGGGGGAGG + Intronic
934482490 2:94664258-94664280 CACAGGCTGGGAGGTTTTAGAGG - Intergenic
934609853 2:95727030-95727052 CAGAGGCTGGGAGGTGGGCGAGG + Intergenic
935487741 2:103678526-103678548 GAGGGTCTGTGAGGTGGTGGTGG - Intergenic
935634838 2:105242359-105242381 CACGGGCTGGACGCTGGTGGAGG + Exonic
935741269 2:106150692-106150714 GACAGGGTGGGAGGTGGCGGGGG + Intronic
936234639 2:110732572-110732594 CACCTGCTGGGAGCTGGAGGAGG + Exonic
937112516 2:119377484-119377506 CTTGGGCTGGGAAGTGGTGAGGG + Intergenic
937441606 2:121920290-121920312 CATGGACTAGGGGGTGGTGGGGG - Intergenic
938415982 2:131104094-131104116 CAGGGGTTGGGGGGTGGTGTAGG - Intergenic
939367512 2:141252186-141252208 TAGGGGGTGGGGGGTGGTGGGGG - Intronic
939630265 2:144520467-144520489 GACGGGCGGGGAGGGGGGGGTGG - Intronic
939776367 2:146392572-146392594 CACCAGCATGGAGGTGGTGGGGG - Intergenic
939882469 2:147645928-147645950 AAAGGCCTTGGAGGTGGTGGAGG - Intergenic
940316973 2:152336043-152336065 CGCGGGCTGGGAGGAGGAGGTGG + Intronic
941016502 2:160363475-160363497 CACCGGATGGGAGGTAGTAGAGG + Intronic
941283976 2:163586064-163586086 CAAAGGCTGGGAGGAGGTGAAGG + Intergenic
942226521 2:173821578-173821600 CATGGACTGGGAGGAGGTTGTGG - Intergenic
942301024 2:174562551-174562573 CTCGGGATGGGAGGGAGTGGTGG + Exonic
943165991 2:184326758-184326780 CACTGGCTGGGAGATGGAGGAGG + Intergenic
944327654 2:198425782-198425804 CAGGGCCTGTGAGGGGGTGGGGG - Intronic
944673487 2:202015746-202015768 CAAAGGCTGGGAGTTGGGGGTGG + Intergenic
944722775 2:202440612-202440634 AGGCGGCTGGGAGGTGGTGGAGG + Intronic
946375977 2:219309183-219309205 CTTGGGCTGGCGGGTGGTGGGGG - Intronic
946390693 2:219415075-219415097 CAGGGGCTGGGAGGAGGGGAAGG + Intergenic
946402373 2:219475405-219475427 CATGGGCTGGGAGGTGGTGGGGG - Intronic
946684945 2:222258509-222258531 CAGGGGCAGGGTGGTGGTGGTGG - Intronic
947119061 2:226798338-226798360 CTCGGGGCGGGAGGTGGTGGGGG - Exonic
947208255 2:227682231-227682253 CACGGACTGGGTGGGGGTGGGGG + Intergenic
947800372 2:232925875-232925897 GTCAGGCTGGGTGGTGGTGGTGG - Intronic
947817035 2:233044509-233044531 CCTGGGGTGGGAGGTGATGGTGG + Intergenic
947865969 2:233397920-233397942 GAGGGGCTGTGGGGTGGTGGGGG + Intronic
948035908 2:234858163-234858185 GAGGGGTTGGGAGGTGGTGGTGG - Intergenic
948088153 2:235267681-235267703 CCTGGGCTGGGAGGAGGTGGAGG - Intergenic
948584917 2:239013312-239013334 CATGGCCTGGGAGGTGCTGGTGG + Intergenic
948722927 2:239912704-239912726 CCTGGGCGGAGAGGTGGTGGTGG - Intronic
948742116 2:240054972-240054994 GGTGGGCTGGGGGGTGGTGGTGG + Intergenic
948856086 2:240731296-240731318 CAGAGGCAGGGAGGGGGTGGGGG + Intronic
948958689 2:241315451-241315473 CGCGGGAGGGCAGGTGGTGGCGG - Intronic
1168807321 20:679629-679651 CACAGGTTGGAAGGTGGTGTGGG + Intergenic
1169051795 20:2584972-2584994 CAAGGGCTGGGAGCTGGGAGAGG - Intronic
1169132453 20:3173259-3173281 CCCGGCCTGGGGGGAGGTGGCGG - Intronic
1169921980 20:10744761-10744783 CAAGGGATGAGAGGTGATGGAGG - Intergenic
1170401713 20:15992477-15992499 GAAGGGATGAGAGGTGGTGGTGG - Intronic
1170528285 20:17262965-17262987 GACAGGCTGGGAAGTGGTGCAGG - Intronic
1170634561 20:18093201-18093223 GACAGGCTGGCAGGTGATGGCGG - Intergenic
1170914208 20:20606636-20606658 TGGAGGCTGGGAGGTGGTGGTGG - Intronic
1171262685 20:23747766-23747788 CAGGGGGTGGGAGTGGGTGGTGG + Exonic
1171358934 20:24572996-24573018 CGGGGGCTGGGAGGTGGAGGAGG - Intronic
1171424897 20:25043108-25043130 CAGGGTCTGGGAAGTGGTGGAGG - Intronic
1172055694 20:32152789-32152811 CTCGGGGTAGGAGGTGGGGGAGG - Intronic
1172331685 20:34080035-34080057 CACTGGCTGGGATGCGTTGGGGG - Exonic
1172367849 20:34363528-34363550 CCCGGGCCGGGCGGTGGGGGTGG + Intronic
1172381036 20:34491989-34492011 CTGGGGCTGGGGGGTGGTGGTGG + Intronic
1172435164 20:34923810-34923832 CAAGGCCGGGGAGGTGGGGGGGG - Intronic
1172439889 20:34957868-34957890 CACGGGATGGGGGGAGATGGTGG + Intergenic
1173191000 20:40875489-40875511 AAAGGGCTGGGGGGTGGGGGTGG - Intergenic
1173226119 20:41163297-41163319 CCCAGGCTGGTAGGTTGTGGGGG + Intronic
1173454456 20:43191255-43191277 CACGGTCATGGTGGTGGTGGTGG - Intergenic
1173610565 20:44364287-44364309 CAGGGGCTGGGAGGCTGAGGCGG - Intronic
1173656840 20:44705275-44705297 CCCAGCCTGGGAGGTGGAGGAGG - Intergenic
1174199695 20:48798582-48798604 CATGGGCTGGGAGGTGGGAAAGG - Intronic
1174365269 20:50053003-50053025 CACAGGCCGGGATGTGGGGGTGG - Intergenic
1174377070 20:50133284-50133306 CACGGGAGGGGTGGTGGGGGTGG + Intronic
1174670201 20:52299968-52299990 CAGGGGCTGTCAGGGGGTGGGGG + Intergenic
1174749629 20:53099090-53099112 GCTGAGCTGGGAGGTGGTGGGGG - Intronic
1174796488 20:53526918-53526940 CAGGGGGTGGGAGGGGGAGGTGG + Intergenic
1175203582 20:57294014-57294036 CACGGACTGGGAGGAGGTGGGGG + Intergenic
1175521517 20:59605135-59605157 AACGGGCTGGGCGGGGGCGGCGG + Intronic
1175529696 20:59666026-59666048 CAGGGGCTGGGACTTAGTGGTGG + Intronic
1175809026 20:61847508-61847530 CACGGCATGGCAGGAGGTGGTGG - Intronic
1175860854 20:62149299-62149321 CACATGGAGGGAGGTGGTGGAGG - Intronic
1175903119 20:62367630-62367652 CCTGGGCTGGGAGGAGCTGGTGG - Intergenic
1175950670 20:62581516-62581538 CACAGGCTGGGTGGTGGTGGTGG - Intergenic
1175973688 20:62699687-62699709 CTCTGGCTGGGAGGTGAGGGTGG - Intergenic
1175978910 20:62727322-62727344 CAAGGGCTGGGTGGAAGTGGGGG + Intronic
1176236622 20:64056517-64056539 CATGGGGTGGCAGGGGGTGGGGG + Intronic
1176237250 20:64059333-64059355 CTGGGCCTGGGAGCTGGTGGGGG - Intronic
1176429520 21:6567332-6567354 CAAGGACTTGGAGGGGGTGGGGG + Intergenic
1178361549 21:31952719-31952741 CACTGGGTGGGGGGTGGGGGCGG - Intronic
1178378617 21:32089840-32089862 CCTGGGCTGGGATGTGGAGGTGG + Intergenic
1178472466 21:32905607-32905629 CACAGGCTGGGAAAGGGTGGGGG + Intergenic
1178550457 21:33533902-33533924 CTCAGGTTGGGGGGTGGTGGTGG + Intronic
1178922554 21:36748016-36748038 GCCGGGCGGGGAGGTGGCGGCGG - Exonic
1179480349 21:41673024-41673046 CAGGGGGTGGGGGGCGGTGGGGG - Intergenic
1179601006 21:42477060-42477082 CCCGGGCTGTGGGGTGGAGGGGG - Intronic
1179601040 21:42477142-42477164 CCCGGGCTGTGGGGTGGAGGGGG - Intronic
1179601088 21:42477256-42477278 CCCGGGCTGTGGGGTGGAGGGGG - Intronic
1179704914 21:43174794-43174816 CAAGGACTTGGAGGGGGTGGGGG + Intergenic
1179883170 21:44301869-44301891 CATGGGGTGGCAGGGGGTGGGGG - Intronic
1180125181 21:45785447-45785469 CCCCGTCTGGGAGGAGGTGGGGG + Intronic
1180163115 21:46006819-46006841 CAGGGGCTGGGAGGAGGCTGGGG + Intergenic
1180515694 22:16140942-16140964 GAAGGACTGGGAGGGGGTGGGGG + Intergenic
1181049157 22:20230606-20230628 CACGGGTGGGGAGCGGGTGGAGG + Intergenic
1181167096 22:20989667-20989689 CACCTGCTGGGAGGAGGTGAGGG + Exonic
1181280146 22:21714038-21714060 CATGGGGTGGGGGGCGGTGGGGG - Intronic
1181687969 22:24542473-24542495 CATGGGTAGGCAGGTGGTGGTGG + Exonic
1181730331 22:24841652-24841674 CTTGGACTGGGAGGTGGTGGTGG + Intronic
1181958383 22:26604937-26604959 GATGGGAGGGGAGGTGGTGGTGG - Intronic
1182281464 22:29220030-29220052 GATGGGCTGGCAGGAGGTGGGGG - Intronic
1182551487 22:31103191-31103213 CACGAGATGGGAGGTGGTCTTGG + Intronic
1182576981 22:31279457-31279479 CTTGGGCTGGGAAGAGGTGGTGG + Intronic
1182882869 22:33748381-33748403 TACGGGATGGGAGGTGGAAGTGG - Intronic
1183341758 22:37285341-37285363 AACGGGGTGTGTGGTGGTGGTGG + Intronic
1183380549 22:37488583-37488605 CAAGGGCTGGGAGGACCTGGTGG + Intergenic
1183584132 22:38742404-38742426 CCTGGCCAGGGAGGTGGTGGTGG - Exonic
1183716199 22:39535017-39535039 CCCGGGCTAGGTGGGGGTGGGGG + Intergenic
1183745147 22:39687629-39687651 CAGGGGCTGGCAGGTGGGGTGGG - Exonic
1184074192 22:42165598-42165620 CACAGGCTGGGAGGCAGGGGCGG + Intronic
1184135924 22:42549868-42549890 CAGGGGGTGGGAGGTGGGGAGGG + Intergenic
1184243915 22:43226461-43226483 CTCGGGCTGAGGGCTGGTGGAGG + Intronic
1184275759 22:43408833-43408855 CAAGGGCTGGGATGAGCTGGAGG - Intergenic
1184286969 22:43477326-43477348 CTGGGGCTGGGAGCAGGTGGTGG + Intronic
1184363007 22:44030190-44030212 CCTGGGCTGGGAGCTGGGGGTGG + Intronic
1184398127 22:44257389-44257411 CACGGTATGGGAGGTGGCTGAGG - Intronic
1184404324 22:44291668-44291690 CAGGGGGTGGGAGGTGGGGAGGG - Intronic
1184747610 22:46465301-46465323 CATGGGGTGGGATGGGGTGGGGG - Intronic
1184920252 22:47600784-47600806 CACAGGCTGGGAGGGGCAGGGGG - Intergenic
1185310874 22:50153578-50153600 CACCGGGAGGGAGGCGGTGGTGG - Intronic
1185388961 22:50548733-50548755 CGGGGGTTGGGGGGTGGTGGAGG + Exonic
949935177 3:9110692-9110714 CCAGGGCTGGGAGAAGGTGGGGG - Intronic
950127230 3:10517317-10517339 CCTGGGGAGGGAGGTGGTGGTGG + Intronic
950504484 3:13386034-13386056 CAAGGGCTGGGAGAGGGTGAAGG + Intronic
950635688 3:14312732-14312754 GACGGGGTGGGATGCGGTGGTGG - Intergenic
950874025 3:16253962-16253984 CACGGCGTGGGAGCTAGTGGAGG - Intergenic
950903937 3:16520558-16520580 CACAGGGTGGGCGGGGGTGGGGG + Intergenic
951497671 3:23348993-23349015 CTCCTGCGGGGAGGTGGTGGGGG - Intronic
952281504 3:31927902-31927924 CAAGGGCTAGTAGGTGGGGGTGG - Intronic
952450309 3:33425956-33425978 CTCGGGGTGGGAAGTGGGGGAGG + Intronic
952990013 3:38823778-38823800 CACGGGCTGAGAGGTCGAGGAGG + Intergenic
953147387 3:40291120-40291142 CATGTGATGGGAAGTGGTGGTGG - Intergenic
953292588 3:41681042-41681064 CAGGGGTTGGGTGGAGGTGGCGG - Intronic
953749613 3:45599330-45599352 CAGGAGCTGGGAGGGGATGGGGG - Intronic
954613622 3:51958762-51958784 CGCGGGCTGGGCGGCAGTGGGGG - Intronic
954752889 3:52823615-52823637 CAAGGGCTCAGAGATGGTGGTGG - Exonic
955642963 3:61106457-61106479 CAAGGGCTGGGAGGAGGTGGGGG - Intronic
956035055 3:65081517-65081539 CCCAGGCTGGGAGGTGGGGCAGG - Intergenic
957107345 3:75907090-75907112 CACAGGCTGGGAGGGGGCGGAGG + Intronic
958717841 3:97808447-97808469 GACGTCCAGGGAGGTGGTGGTGG + Intergenic
959899947 3:111649723-111649745 TACTTGATGGGAGGTGGTGGTGG - Exonic
960430708 3:117565327-117565349 CAGGGCCTGTCAGGTGGTGGGGG + Intergenic
960971063 3:123140609-123140631 CAGGGGCTGGGAGGAAGAGGTGG + Intronic
961583965 3:127906997-127907019 CAGGGCCTGTGAGGGGGTGGGGG + Intergenic
961679485 3:128589559-128589581 CAGGGGCTGGAAGGGGATGGTGG - Intergenic
962489038 3:135873026-135873048 GAGAAGCTGGGAGGTGGTGGTGG - Intergenic
962746364 3:138400033-138400055 CAAGAGCTGGGATGAGGTGGGGG + Intronic
963742893 3:149097800-149097822 CACAGGATGGGGGGGGGTGGGGG + Intergenic
964767355 3:160191652-160191674 CTGGAGCTGGGAGGTGGTGTGGG - Intergenic
965608735 3:170522623-170522645 CAGGGGCTGGGAGTGGGAGGAGG + Intronic
966366770 3:179196771-179196793 CACTGGCTATGAGGTGGAGGTGG + Intronic
966432447 3:179846482-179846504 CACAGCTGGGGAGGTGGTGGGGG - Intronic
966487823 3:180490687-180490709 CATGGGGTGGGGGGTGGGGGAGG + Intergenic
967318048 3:188168965-188168987 CTTGGGATGGGAGGTGGGGGAGG - Intronic
967571728 3:191037211-191037233 CAGAGGCTGGGAAGGGGTGGAGG - Intergenic
968069918 3:195778376-195778398 GATGGTCTGGGAGGTTGTGGGGG + Exonic
968442154 4:629501-629523 GAGGAGCTGGAAGGTGGTGGAGG - Intronic
968597853 4:1494621-1494643 GCCGGGCTGGGGGGTGATGGCGG - Intergenic
968607326 4:1541683-1541705 GTCGGGCTGGGAGGAGGTGGGGG - Intergenic
968629489 4:1642671-1642693 CAAGGACTGGGAGGTGGCGGGGG - Intronic
968730465 4:2267132-2267154 CAGTGGCTGGGTGCTGGTGGAGG + Intergenic
968894370 4:3390107-3390129 CAGGGGCTCTGAGCTGGTGGAGG - Intronic
969206706 4:5652606-5652628 CAAGGGCTTGGAGCTGCTGGTGG + Intronic
969277436 4:6146222-6146244 CAGGGGCTGGGGGGAGGTTGCGG + Intronic
969308126 4:6336936-6336958 CACAGGCAGGGAGGGGTTGGAGG - Intronic
969457451 4:7308281-7308303 CAGGGGGTTGGAGGCGGTGGTGG - Intronic
969469171 4:7376894-7376916 CGTGGGCTGGGTGGGGGTGGGGG - Intronic
969705398 4:8788853-8788875 CACAGGCTGGGAGGAGGGAGAGG + Intergenic
969939069 4:10712308-10712330 CAGGGGTGGGGTGGTGGTGGTGG + Intergenic
969961774 4:10952009-10952031 CATGGCCTGGGAGGTGGGGCGGG - Intergenic
970709272 4:18842977-18842999 CATGGGCTGGAGTGTGGTGGTGG - Intergenic
971196021 4:24472110-24472132 GCTGGGCTGGGAGGTGGTGGGGG + Intergenic
971265913 4:25096115-25096137 CACGGGATGGGGGGTGCAGGGGG - Intergenic
972063692 4:34911973-34911995 CACAGCCTAGCAGGTGGTGGTGG - Intergenic
972098231 4:35377024-35377046 CACGGACTGGCAGGTAGGGGTGG + Intergenic
972417933 4:38861068-38861090 CAGAGCCTGGGAGGTGGTGCAGG + Intergenic
973060211 4:45715014-45715036 CTGGGGATGGGAGGTAGTGGTGG + Intergenic
973755646 4:54070776-54070798 AACAGGCTGGGAAGTGGTGCAGG - Intronic
974019071 4:56676946-56676968 CATGCACTGGGAGGGGGTGGGGG + Intronic
975268685 4:72402843-72402865 TAAGGTCTGGGAGGTGGTGTGGG + Intronic
977162265 4:93649993-93650015 CTGGGTCAGGGAGGTGGTGGTGG - Intronic
977863447 4:101995101-101995123 CAGGGCCTGTCAGGTGGTGGGGG - Intronic
978244598 4:106557789-106557811 CAGAGGCTGGGAAGGGGTGGGGG + Intergenic
979114958 4:116812020-116812042 CAGGGGCTGGGGGCTGGTGCTGG + Intergenic
979347128 4:119601448-119601470 CAAGGTATGGGAGGTGGCGGGGG - Intronic
979725446 4:123955670-123955692 CAAGGGCAGGGAGGAGGAGGAGG + Intergenic
981686126 4:147456897-147456919 CACTGGCTGGGAGGAGTTCGTGG - Intergenic
982069073 4:151679431-151679453 GACTGGCTGGGAGGCGGTGTGGG + Intronic
982484438 4:155950850-155950872 CACGGACTGGGGTGTGGGGGTGG - Intronic
982533711 4:156581220-156581242 CAGATGCGGGGAGGTGGTGGTGG - Intergenic
982644210 4:158002505-158002527 CAGGGGCTGTGTGGTGGTGAAGG + Intergenic
983076369 4:163331956-163331978 GTCGGGCTGGGAGCTGGCGGAGG - Intronic
983631881 4:169857422-169857444 CAGGGGCTGGGAGGAGGGGGAGG + Intergenic
983919825 4:173333863-173333885 CTCGGGCCGGGAGGAGGAGGAGG - Intronic
983941553 4:173538515-173538537 CAGGGTCTGGGAGGTGAGGGTGG - Intergenic
984466742 4:180109443-180109465 GATGGGGTGGGTGGTGGTGGTGG - Intergenic
984587772 4:181582492-181582514 CACGGTCTGGGAAGTAGTGGTGG + Intergenic
984655562 4:182314023-182314045 CACGGGCTGGCTGGGCGTGGTGG + Intronic
985478025 5:90859-90881 GACGGGCTGGGAGGAGGGTGTGG + Intergenic
985531309 5:435304-435326 CACAGGCTGGGAGCTGCAGGTGG - Exonic
985552308 5:539936-539958 CACGGGTGGGGAGGGGCTGGGGG - Intergenic
985560345 5:582900-582922 CAGGGGATGAGATGTGGTGGTGG - Intergenic
985694124 5:1330398-1330420 GTCGGGCTGGGAGGGGGTGCAGG + Intronic
986733218 5:10649923-10649945 CTCGGGCTGGAAGGTGGGCGCGG - Exonic
986987562 5:13516388-13516410 CAGTGCCTGGGAAGTGGTGGTGG - Intergenic
987804056 5:22739710-22739732 CAGGGGCTGGGAGGAAATGGAGG - Intronic
988809152 5:34767610-34767632 AATGGGGTGGGGGGTGGTGGGGG - Intronic
989379252 5:40797865-40797887 CACAGGCCGGGTGGGGGTGGGGG - Intronic
991388303 5:66114573-66114595 CAGGGCCTGGGGGGTGGGGGTGG + Intergenic
992098005 5:73380603-73380625 GATGGGCTGGGGGGTGGAGGAGG - Intergenic
992134670 5:73732222-73732244 CAAGGGTTGGTAGGTGGGGGAGG - Intronic
992343602 5:75852152-75852174 CAGGGCCTGTCAGGTGGTGGGGG + Intergenic
993238262 5:85344593-85344615 CACAAGCTGGGAGGTGTAGGAGG + Intergenic
993415465 5:87624500-87624522 CTGGGGCTGGGAGCTGGAGGTGG - Intergenic
993909512 5:93664111-93664133 CCCAGGCTGGGCGGGGGTGGGGG + Intronic
994360751 5:98846034-98846056 CTTGGGCTGGGCGGTGGTGGTGG + Intergenic
995438039 5:112159983-112160005 CCCGGGCGGGGTGGGGGTGGAGG - Intronic
995745176 5:115395080-115395102 CCAGGGCTTGGGGGTGGTGGGGG - Intergenic
996386926 5:122918229-122918251 TACGAATTGGGAGGTGGTGGTGG + Intronic
996570714 5:124930025-124930047 CGGTGGCTGGGGGGTGGTGGTGG - Intergenic
996597528 5:125222687-125222709 CCAGGGATGGGAGGTGGGGGTGG - Intergenic
996931971 5:128900835-128900857 CTTGGTCTGGGTGGTGGTGGAGG - Intronic
997883681 5:137612419-137612441 CACAAACTGGGAGGTGGAGGTGG - Intergenic
998366659 5:141636842-141636864 CACGGCCGGGGAGGGGCTGGCGG - Exonic
998490551 5:142542619-142542641 GTCGGGCTGGGGGGTGGTGGGGG - Intergenic
999174721 5:149624017-149624039 CAGGCTCTGGGACGTGGTGGTGG - Exonic
999419843 5:151431381-151431403 CAGGGACTGGCAGCTGGTGGAGG + Intergenic
999553949 5:152720775-152720797 CACTGGCAGAGAGGGGGTGGAGG + Intergenic
999829715 5:155306966-155306988 GATGGGAGGGGAGGTGGTGGTGG + Intergenic
1000016585 5:157283133-157283155 CAAGTGCTGGCAAGTGGTGGAGG - Intronic
1000172198 5:158713066-158713088 CAAGGGCCGGGAGTTGGTTGTGG + Exonic
1000183165 5:158832600-158832622 CAGGGGCTGGGAGTCGGTGGAGG + Intronic
1001134812 5:169093462-169093484 CAGGGGCTTGGGGGTGGGGGTGG + Intronic
1001315022 5:170635893-170635915 CACAGGCCGGGAGGTGCAGGTGG + Intronic
1002061594 5:176628992-176629014 CTCGGCCTTGGAGGTGCTGGAGG + Intronic
1002426301 5:179178262-179178284 CACAGGCGGGGAGGTGCGGGGGG - Intronic
1002454873 5:179340200-179340222 CATGGGCTGGGCGGTGGAGATGG - Intronic
1002480844 5:179499740-179499762 GAGGGGCAGGGAGGTGGTTGAGG + Intergenic
1002501180 5:179648659-179648681 CACGTGCTGGGAGATGGCCGTGG + Intergenic
1002605111 5:180378314-180378336 GACGGGATGGGATGGGGTGGGGG - Intergenic
1002646512 5:180659185-180659207 CGCGGGGTGGGGGGTGGCGGCGG - Intergenic
1002845200 6:939212-939234 CAAGCACAGGGAGGTGGTGGGGG + Intergenic
1003397089 6:5762877-5762899 CACTGGCTGGGAGCTGGGGGAGG + Intronic
1003559068 6:7166160-7166182 CAGGGGCTGGCAGTTGGGGGTGG - Intronic
1004092468 6:12517998-12518020 GAGGGGCTGGGATGTGGGGGAGG + Intergenic
1004327229 6:14686349-14686371 CATGGACTGGCTGGTGGTGGGGG + Intergenic
1004540280 6:16543218-16543240 CACAGAATGAGAGGTGGTGGTGG - Intronic
1005621100 6:27621074-27621096 CACAGGCTGGAATGTCGTGGGGG + Intergenic
1005822210 6:29607315-29607337 CACGGGCAGGGAGCTCATGGTGG + Intronic
1005975548 6:30795779-30795801 CATGGGGTGGGAGGAGGTGGGGG - Intergenic
1006453721 6:34120304-34120326 CCAGGGCTGGGAGGTGAGGGAGG + Intronic
1007081050 6:39104570-39104592 CATGGACGGGGTGGTGGTGGAGG - Exonic
1007228374 6:40330458-40330480 CTGGGGGTGGGAGGTGGGGGCGG + Intergenic
1007344861 6:41221955-41221977 CACAGGGTGGGAGCTGGAGGTGG + Intergenic
1007392540 6:41558355-41558377 CAAGGGCTGGGAGAGGGGGGTGG + Intronic
1007456149 6:41978613-41978635 CATGGGTGGGGAGGTGTTGGGGG + Intronic
1007595102 6:43046360-43046382 CAAGTGCTGGGAGAAGGTGGAGG - Exonic
1007619079 6:43200688-43200710 CAAGTGCTGGGAGAAGGTGGAGG + Exonic
1007745677 6:44041610-44041632 CAAGGGCAGGGAGGTTGAGGGGG + Intergenic
1008332347 6:50260064-50260086 CAAGGGCAGGGTGCTGGTGGGGG + Intergenic
1008882935 6:56399809-56399831 CTCGGGGTGGGGGGTGGGGGAGG + Intergenic
1008906341 6:56681445-56681467 CACGGGATGGGAATTGGTGAGGG - Intronic
1008909880 6:56721065-56721087 CCCCGTCTGGGAGGTGGGGGGGG - Intronic
1009858477 6:69293812-69293834 CACAGTCTGGAAGGGGGTGGGGG + Intronic
1010282564 6:74038282-74038304 CACAGGCTGGGAGATCTTGGAGG + Intergenic
1011154530 6:84315323-84315345 AAAGGGATGGGTGGTGGTGGTGG + Intergenic
1013312923 6:108914444-108914466 CAGGTGGTGGCAGGTGGTGGTGG - Intronic
1013821417 6:114157416-114157438 CAGGGGCTGGGAGTTGCAGGGGG + Intronic
1015185306 6:130408933-130408955 CAGGGTCAGGGAGGGGGTGGTGG - Intronic
1016128888 6:140441423-140441445 CATGGCCTGGGAGGCGGGGGAGG - Intergenic
1017846650 6:158264247-158264269 TACGGGCTCTGAGGTGGTGAGGG + Intronic
1018197572 6:161368583-161368605 CACAAGCTGGGTGCTGGTGGTGG - Intronic
1018388805 6:163327750-163327772 CAGGGCCTGGGATGTGGGGGTGG + Intergenic
1018543788 6:164913585-164913607 CACGTGCTGACAGGAGGTGGGGG - Intergenic
1018549989 6:164984839-164984861 CAGGGGCTTGGGGGTGTTGGGGG - Intergenic
1019265188 7:111275-111297 CTGGGGCTGGGAGCTGGAGGAGG - Intergenic
1019338629 7:496890-496912 CGTGGGCCTGGAGGTGGTGGAGG + Intergenic
1019422635 7:958176-958198 CAGGGGAGGGGAGGTTGTGGAGG + Intronic
1019493179 7:1324480-1324502 CAGGGGCTGGGAGGGGCAGGGGG + Intergenic
1019501701 7:1368147-1368169 CACGGGCAAGGTGGTGTTGGTGG - Intergenic
1019775331 7:2909237-2909259 CACGGGCAGGGTGGCGGTGTGGG - Intronic
1019805146 7:3118081-3118103 CACTGGGTGGGAGGCGATGGTGG - Intergenic
1019828567 7:3302607-3302629 CGGGGGCGGGGAGGGGGTGGAGG - Intronic
1019920829 7:4162329-4162351 CTGGGGGTGGGTGGTGGTGGTGG + Intronic
1020290575 7:6719544-6719566 CACCTGGTGGGAGGTGGTGGAGG + Intergenic
1021054892 7:16035405-16035427 CACTGGCTGGGGATTGGTGGAGG - Intergenic
1021403473 7:20237176-20237198 CTGAGGCAGGGAGGTGGTGGGGG + Intergenic
1021535069 7:21694352-21694374 CAGGGCCTGTCAGGTGGTGGGGG - Intronic
1021694224 7:23260731-23260753 GAAGGTCTGGGTGGTGGTGGCGG - Exonic
1021771688 7:24009111-24009133 CAGGGGATGGGGGGTGGGGGGGG - Intergenic
1021972480 7:25979675-25979697 AAAGGGTTGGGTGGTGGTGGTGG - Intergenic
1022199403 7:28102072-28102094 CACAGGCTGGGAGGGGTTGTTGG - Intronic
1022507382 7:30915483-30915505 CACAGGCTAGGAGGAGGTGAGGG + Intronic
1022522928 7:31019606-31019628 AAGGTCCTGGGAGGTGGTGGGGG - Intergenic
1022956589 7:35386686-35386708 CAGGGGGTGGGGGATGGTGGGGG - Intergenic
1023416038 7:39933571-39933593 CCTGGGCAGGGTGGTGGTGGTGG + Intergenic
1023450924 7:40284131-40284153 CAGGGGCTGGGGGTTGGAGGTGG + Intronic
1023825151 7:44003992-44004014 CATCTGGTGGGAGGTGGTGGAGG - Intronic
1023927038 7:44676929-44676951 CACGGGCTGGTAGGAGACGGAGG + Intronic
1023939905 7:44762772-44762794 CAGGGGCTGCCAGGTGGGGGAGG - Intronic
1023956677 7:44892045-44892067 CCAGGGCTGGGAGATGGTTGTGG + Intergenic
1024045447 7:45582569-45582591 CGGGGGGTGGGGGGTGGTGGGGG + Intronic
1024348683 7:48339858-48339880 CACGGGTGGGGTGGCGGTGGGGG + Intronic
1024498367 7:50072219-50072241 CACTGGCCTGGGGGTGGTGGTGG + Intronic
1024735800 7:52303022-52303044 TGGGGGCAGGGAGGTGGTGGTGG + Intergenic
1024942224 7:54775104-54775126 CACTGGCTGGGGGGCGGTGTGGG + Intergenic
1025152666 7:56572223-56572245 TACAGGCTGGAGGGTGGTGGTGG - Intergenic
1025619961 7:63159710-63159732 CAGGGGCTGGGGGTGGGTGGAGG - Intergenic
1025956981 7:66190380-66190402 CCCAGGCTGGGAGGCGCTGGAGG - Intergenic
1026088699 7:67282774-67282796 CATCTGGTGGGAGGTGGTGGAGG - Intergenic
1026225273 7:68434734-68434756 CACGGACTGGGGGTTGGGGGTGG + Intergenic
1026231802 7:68490275-68490297 TTGGGCCTGGGAGGTGGTGGAGG + Intergenic
1027033845 7:74910732-74910754 CATCTGGTGGGAGGTGGTGGAGG + Intergenic
1027118295 7:75498077-75498099 CATCTGGTGGGAGGTGGTGGAGG - Intergenic
1027269773 7:76513061-76513083 CTGGGGATGGGAGGTGGTGGGGG - Intronic
1027273506 7:76537390-76537412 CATCTGGTGGGAGGTGGTGGAGG + Intergenic
1027320484 7:77006956-77006978 CTGGGGATGGGAGGTGGTGGGGG - Intergenic
1027326954 7:77056447-77056469 CATCTGGTGGGAGGTGGTGGAGG + Intergenic
1027425252 7:78055576-78055598 CAGGGTCTGGGAGGTGTCGGTGG - Intronic
1027475795 7:78630071-78630093 CAGGGGCTGGGTGGTGATGAGGG - Intronic
1027714927 7:81658622-81658644 CACGGGGTGGGGGGTTGTGGGGG - Intergenic
1028128902 7:87147279-87147301 CACGTGATGGGAAGCGGTGGTGG - Intergenic
1028282400 7:88947503-88947525 CAGGGCCTGTCAGGTGGTGGGGG + Intronic
1028773744 7:94656277-94656299 CGCGGGCTAGGGGGTGGAGGGGG - Intergenic
1029309594 7:99650317-99650339 TACTGGTTGGGAGGTGGAGGGGG - Intronic
1029397103 7:100315926-100315948 CATCTGGTGGGAGGTGGTGGAGG - Intronic
1029410432 7:100406253-100406275 CATGGGCAGGGTGGAGGTGGGGG + Intronic
1029538781 7:101171189-101171211 GCCGGGCGGGGTGGTGGTGGTGG - Exonic
1029719198 7:102351963-102351985 CATCTGGTGGGAGGTGGTGGAGG + Intergenic
1029753417 7:102557303-102557325 CATCTGGTGGGAGGTGGTGGAGG - Intronic
1029771366 7:102656387-102656409 CATCTGGTGGGAGGTGGTGGAGG - Intronic
1030708793 7:112724231-112724253 CATGGGTTGGGAGTTGGAGGTGG + Intergenic
1032291237 7:130591376-130591398 CCCTGTCTGGGAGGAGGTGGGGG + Intronic
1032481989 7:132254754-132254776 CAAGGGGTGAGTGGTGGTGGTGG + Intronic
1032947324 7:136869369-136869391 CCCCGGCTGCGAGGTGGTGGAGG - Exonic
1033115425 7:138620623-138620645 GAGGGGCAGGGAGGTGGTGTGGG - Intronic
1033137676 7:138798346-138798368 CAGGGGGTGGGAGGTGGGGCTGG + Intronic
1033148028 7:138887906-138887928 CAATGGCTGGGAGATGGTCGAGG - Intronic
1033526313 7:142217609-142217631 CAGAGGCTGGGAAGGGGTGGGGG + Intronic
1034162113 7:149001572-149001594 CAGGAGCTGGGAGGAGGAGGAGG - Intergenic
1034267132 7:149786476-149786498 CATGGACTGGGAGGTAGGGGTGG - Intergenic
1034466391 7:151232498-151232520 CAGGGGCTGTGAGGTGGCAGCGG + Exonic
1034692929 7:153028437-153028459 CACGAGCTGGATGCTGGTGGTGG - Intergenic
1034839126 7:154379346-154379368 CAGGGCCTGTCAGGTGGTGGGGG + Intronic
1035035503 7:155891652-155891674 GAGGTGCTGGGTGGTGGTGGAGG + Intergenic
1035135470 7:156698729-156698751 CACAGGCTGGGAGGTTTAGGAGG - Intronic
1035187544 7:157138565-157138587 CACGGGCCGGGATGGGGTGCAGG - Intergenic
1035451109 7:158977450-158977472 CTGGGGCTGGCAGGTGGTCGGGG + Intergenic
1035754960 8:2023952-2023974 CACGGGCCAGGAGGGGGAGGCGG + Intergenic
1036307197 8:7611161-7611183 CTGGGGCGGGGAGGTGGTGCAGG + Intergenic
1036358039 8:8059148-8059170 CTGGGGCGGGGAGGTGGTGCAGG + Intergenic
1036454051 8:8892888-8892910 CACGAGCTGGGGGGAGGCGGGGG + Exonic
1036892908 8:12607798-12607820 CTGGGGCGGGGAGGTGGTGCAGG - Intergenic
1037803773 8:22048765-22048787 CCGGGGCTGGGAGTTGGGGGTGG - Exonic
1037977881 8:23225954-23225976 CACGGGATGAGACTTGGTGGGGG + Intergenic
1037994653 8:23343438-23343460 CAGGGACTGGGAGGTGGGGCTGG + Intronic
1038406572 8:27326611-27326633 CACGTGGTGTGATGTGGTGGTGG + Intronic
1038436945 8:27542980-27543002 GATGGGATGGGAGGAGGTGGGGG - Intronic
1038652784 8:29420824-29420846 CAGGGGCCTGGAGGTGCTGGGGG + Intergenic
1039143854 8:34423342-34423364 CAAGGGCTGGGAGGGGGTGGGGG - Intergenic
1039314982 8:36361091-36361113 CAGGGGGTGGGATGGGGTGGGGG + Intergenic
1039902289 8:41761863-41761885 TGGGGGCTGGGAGGTGGTGTGGG - Intronic
1040540338 8:48347930-48347952 CAAGGGCAGGGTGTTGGTGGGGG - Intergenic
1040783543 8:51139482-51139504 CAGGGCCAGGGATGTGGTGGAGG - Intergenic
1041015063 8:53584881-53584903 CACGCACTGGGAGTTGCTGGTGG + Intergenic
1041901256 8:62985522-62985544 CCCTGGCTGGGTTGTGGTGGAGG - Intronic
1043126249 8:76399332-76399354 CACGGACAGGGTGGTGGAGGTGG - Intergenic
1043370459 8:79584603-79584625 CAAGGGCAGGGAGCAGGTGGAGG + Intergenic
1044935041 8:97285766-97285788 CAGGGGCTGGGAGGGAGTGCGGG + Intergenic
1045750765 8:105481362-105481384 CATGGTCTGGTTGGTGGTGGGGG + Intronic
1045968343 8:108051895-108051917 CATGGGTTGGAGGGTGGTGGAGG + Intronic
1046027947 8:108747700-108747722 CAGGGGGTGGGAGGTGGGAGAGG - Intronic
1046513663 8:115230386-115230408 CAGGGTCTGTCAGGTGGTGGGGG + Intergenic
1046692752 8:117304218-117304240 CACCGGCGGTGAGGGGGTGGGGG - Intergenic
1046984302 8:120370438-120370460 CAGGGGCTTGGTGGTGGTGGTGG - Intronic
1047324321 8:123821643-123821665 CAGGGCCTGTCAGGTGGTGGGGG + Intergenic
1047358194 8:124143217-124143239 GATGCACTGGGAGGTGGTGGAGG - Intergenic
1047478661 8:125259523-125259545 CACAGACTGGGGTGTGGTGGGGG - Intronic
1047509561 8:125505958-125505980 AAACGGCTGGGAGGTGGGGGTGG + Intergenic
1047520901 8:125594651-125594673 CAAGGGCTGGGAGGTGGGCTGGG - Intergenic
1048330647 8:133468453-133468475 CAGGGGCTGGGAGGAGGAGGAGG + Intronic
1049020144 8:139951049-139951071 CACAGGTGGGGAGGTGGCGGTGG - Intronic
1049038598 8:140095916-140095938 TACATGCTGGGAAGTGGTGGAGG - Intronic
1049168402 8:141141397-141141419 CAGGGGGCTGGAGGTGGTGGGGG + Intronic
1049318106 8:141980443-141980465 CAGGGGCTGTGAGGTGCTGTGGG - Intergenic
1049447208 8:142636753-142636775 CACTGACTGGGAGGAGGTGCTGG + Intergenic
1049632150 8:143664658-143664680 CACCAGCTGGTAGGTGGTGCGGG - Intergenic
1049803048 8:144527021-144527043 GCCGGGCTGGGAGGGGGCGGGGG + Exonic
1050694241 9:8261207-8261229 GATGGGCAGGGAGGTGGAGGGGG + Intergenic
1052523899 9:29587374-29587396 CCAGGGGTTGGAGGTGGTGGTGG + Intergenic
1053530846 9:38879378-38879400 CAGGGGCAGGGTGCTGGTGGAGG - Intergenic
1053675354 9:40420480-40420502 CACAGGCTGGGAGGTTTTAGAGG + Intergenic
1053925142 9:43046817-43046839 CACAGGCTGGGAGGTTTTAGAGG + Intergenic
1054203069 9:62103811-62103833 CAGGGGCAGGGTGCTGGTGGAGG - Intergenic
1054288626 9:63259006-63259028 CACAGGCTGGGAGGTTTTAGAGG + Intergenic
1054386452 9:64560543-64560565 CACAGGCTGGGAGGTTTTAGAGG + Intergenic
1054509268 9:65955812-65955834 CACAGGCTGGGAGGTTTTAGAGG - Intergenic
1054635294 9:67484554-67484576 CAGGGGCAGGGTGCTGGTGGAGG + Intergenic
1054817706 9:69491453-69491475 CATGGGGTGGGGGGAGGTGGAGG + Intronic
1055250077 9:74293364-74293386 CACGGGATGGGGGATGGTGGTGG - Intergenic
1055318167 9:75054927-75054949 CAGGATTTGGGAGGTGGTGGTGG - Intergenic
1055743713 9:79418816-79418838 CAGAGGCTGGGAGGTGTAGGAGG - Intergenic
1056347912 9:85717831-85717853 CACGGCCTGTTAGGGGGTGGGGG - Intronic
1056461667 9:86814825-86814847 GGCGGGCTGGGAGGGGGTGGTGG + Intergenic
1056470750 9:86902887-86902909 CCCGGGCTCGGCGGCGGTGGAGG - Intergenic
1056740544 9:89250693-89250715 CCCGGGGGGGGAGGGGGTGGGGG + Intergenic
1056760351 9:89410060-89410082 CACGGGGTGGGCAGTGGGGGTGG + Intronic
1056787655 9:89604386-89604408 CAAGGGCGGGGAGGTGGGGTGGG + Intergenic
1057647931 9:96894403-96894425 CACTACCTGGGAGATGGTGGAGG - Intergenic
1057674842 9:97130559-97130581 CCCCGTCTGGGAGGTGGGGGGGG - Intergenic
1057725252 9:97563896-97563918 CAGGGGCTGGGTGGGGGTAGGGG - Intronic
1059195196 9:112364947-112364969 CAGAGGCTGGGTTGTGGTGGGGG - Intergenic
1059334267 9:113558971-113558993 CTGAGGCTTGGAGGTGGTGGGGG + Intronic
1059529987 9:115026849-115026871 GATGGGGTGGGAGGGGGTGGGGG + Intronic
1059541365 9:115133550-115133572 CACCGGCAGGAAGGTGGTGAGGG - Intergenic
1059830220 9:118086883-118086905 CAGGGGTTGGGAGGTGGAAGAGG - Intergenic
1059941875 9:119367658-119367680 CAAGGGCAGGGGGGCGGTGGAGG - Intronic
1060475398 9:123983042-123983064 CAGGGGCTGGGAAGAGTTGGAGG - Intergenic
1060527266 9:124327652-124327674 CAAGGGCTGGGAGGTGATCAGGG - Intronic
1060553947 9:124498902-124498924 CCCTGGCTGGTAGGTGGGGGTGG - Intronic
1060554689 9:124502129-124502151 TGGGGGCTGGGCGGTGGTGGTGG + Intronic
1060749160 9:126157497-126157519 CATGTGCTGGGAGGGGGTGGTGG - Intergenic
1061084028 9:128389012-128389034 CATGGTCTGGGTGGTGGTGCTGG + Intronic
1061133203 9:128719770-128719792 CACGGGCTGTGGACTGGTGGGGG + Exonic
1061225722 9:129279770-129279792 CATGGCCTGGGAGGGGGTGGTGG + Intergenic
1061262931 9:129489992-129490014 CAGGTGCTGGGTGGAGGTGGGGG - Intergenic
1061402780 9:130377632-130377654 CACGGGCTGTGAGGAGGATGAGG - Intronic
1061405780 9:130392290-130392312 CAGGGAAGGGGAGGTGGTGGGGG + Intronic
1061450802 9:130666080-130666102 CTCGGGCTGGCAGGTGTTGGAGG - Intronic
1061516079 9:131091373-131091395 GAAGGGCTGGGAGGTGGGTGAGG - Intronic
1062023167 9:134328694-134328716 CTCGGGGTGAGTGGTGGTGGAGG + Intronic
1062067396 9:134536146-134536168 CAGGGGCTGGGGGCTGGAGGGGG - Intergenic
1062077937 9:134602283-134602305 CAGGAGCTGGGAGTTGGTGGGGG - Intergenic
1062096225 9:134705385-134705407 CAGGGGCTGGGAGGCAGTGAGGG - Intronic
1062191262 9:135249073-135249095 CAAGGGCTGGCATGGGGTGGGGG - Intergenic
1062275542 9:135728650-135728672 CACGGGCTGGGAAGGGGAGAGGG + Intronic
1062291855 9:135798956-135798978 CTTGGGCTGGGAGGTGGTGGTGG - Intergenic
1062324624 9:136006088-136006110 CATGGCCCGGGAGGGGGTGGGGG + Intergenic
1185506986 X:638966-638988 GACTGTCAGGGAGGTGGTGGTGG + Intronic
1185550524 X:980189-980211 CACGGGCTGCAAGGGGGAGGAGG + Intergenic
1186223920 X:7377061-7377083 CACAGGGTGGGAGGGGATGGTGG - Intergenic
1186301559 X:8204953-8204975 CAGGGGGTGGGGGATGGTGGGGG + Intergenic
1187419035 X:19119025-19119047 CAGGGGCTGAGAGTTGGGGGAGG + Intronic
1188114768 X:26229428-26229450 CACAGGCTGGCAAGAGGTGGTGG - Intergenic
1188833798 X:34932295-34932317 CACGGGCAGGGTGCTGGTTGGGG - Intergenic
1189306596 X:39991353-39991375 CACGGGGTGGGAAGCGCTGGTGG - Intergenic
1189655853 X:43244423-43244445 CTGGGTCAGGGAGGTGGTGGTGG + Intergenic
1191721275 X:64230671-64230693 CACGGCCTGGGAAGAGGGGGTGG - Intergenic
1192324623 X:70122201-70122223 CCGGGGCGGGGGGGTGGTGGCGG + Intergenic
1192583733 X:72304964-72304986 AACGGGCTAGAGGGTGGTGGAGG - Intronic
1192813795 X:74570921-74570943 CAGGGGTTGGGAAGTGGTGGGGG + Intergenic
1192926562 X:75760157-75760179 CAGGGGCTAGGTGCTGGTGGGGG - Intergenic
1194692992 X:97009886-97009908 CACTGCCTGGGTGGTGGTGGGGG + Intronic
1194714552 X:97275230-97275252 CCCCGTCTGGGAGGTGGGGGGGG - Intronic
1195100748 X:101552008-101552030 CACGGGGTGGGGGGGGGGGGCGG + Intronic
1195252398 X:103062036-103062058 CATGGGCTGGGGGCAGGTGGGGG + Intergenic
1195988880 X:110662876-110662898 CAGGGCCTGTCAGGTGGTGGGGG + Intergenic
1196393536 X:115234173-115234195 GGCGGGCTGGGAGGAGGTGTTGG + Intergenic
1197301746 X:124789272-124789294 CACAGGCTGGGAGGTCTAGGAGG - Intronic
1197771179 X:130090466-130090488 CACAGGCACGGAGGTGGAGGTGG - Intronic
1198084457 X:133269115-133269137 CACGGGCTGGGAGCAGGAGGAGG - Intergenic
1198086508 X:133287480-133287502 CATGGGTTGGGGGTTGGTGGCGG - Intergenic
1198600927 X:138283267-138283289 AGGCGGCTGGGAGGTGGTGGAGG + Intergenic
1199601400 X:149543483-149543505 CAAGTGCTGGGGGGGGGTGGGGG + Intronic
1199648976 X:149936001-149936023 CAAGTGCTGGGGGGGGGTGGGGG - Intronic
1199694531 X:150334571-150334593 CCCTGGATGGGAGGTAGTGGTGG + Intergenic
1199848882 X:151711292-151711314 CACAGTCTGGGGGGTGGGGGAGG - Intergenic
1199936032 X:152574606-152574628 TACGGGGTGAGAGGGGGTGGGGG - Intergenic
1200063620 X:153494738-153494760 GAGGGGGGGGGAGGTGGTGGGGG + Intronic
1200074865 X:153545933-153545955 CGTGTGCTGGGAGGTGGTGACGG + Intronic
1200256523 X:154585663-154585685 TAAGGGCTGGGAGGTAGAGGGGG + Intronic
1200261246 X:154618740-154618762 TAAGGGCTGGGAGGTAGAGGGGG - Intronic