ID: 1117156834

View in Genome Browser
Species Human (GRCh38)
Location 14:52950665-52950687
Sequence TGGGAGGTGGTGGAGGACCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 650
Summary {0: 1, 1: 0, 2: 3, 3: 68, 4: 578}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117156815_1117156834 26 Left 1117156815 14:52950616-52950638 CCCCCAAAGAAAGGCGAATCCCA 0: 1
1: 0
2: 2
3: 7
4: 221
Right 1117156834 14:52950665-52950687 TGGGAGGTGGTGGAGGACCCGGG 0: 1
1: 0
2: 3
3: 68
4: 578
1117156816_1117156834 25 Left 1117156816 14:52950617-52950639 CCCCAAAGAAAGGCGAATCCCAC 0: 1
1: 0
2: 1
3: 8
4: 79
Right 1117156834 14:52950665-52950687 TGGGAGGTGGTGGAGGACCCGGG 0: 1
1: 0
2: 3
3: 68
4: 578
1117156821_1117156834 6 Left 1117156821 14:52950636-52950658 CCACCGAATTCGCAGCGCCGGCC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1117156834 14:52950665-52950687 TGGGAGGTGGTGGAGGACCCGGG 0: 1
1: 0
2: 3
3: 68
4: 578
1117156820_1117156834 7 Left 1117156820 14:52950635-52950657 CCCACCGAATTCGCAGCGCCGGC 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1117156834 14:52950665-52950687 TGGGAGGTGGTGGAGGACCCGGG 0: 1
1: 0
2: 3
3: 68
4: 578
1117156818_1117156834 23 Left 1117156818 14:52950619-52950641 CCAAAGAAAGGCGAATCCCACCG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1117156834 14:52950665-52950687 TGGGAGGTGGTGGAGGACCCGGG 0: 1
1: 0
2: 3
3: 68
4: 578
1117156817_1117156834 24 Left 1117156817 14:52950618-52950640 CCCAAAGAAAGGCGAATCCCACC 0: 1
1: 0
2: 1
3: 5
4: 74
Right 1117156834 14:52950665-52950687 TGGGAGGTGGTGGAGGACCCGGG 0: 1
1: 0
2: 3
3: 68
4: 578
1117156822_1117156834 3 Left 1117156822 14:52950639-52950661 CCGAATTCGCAGCGCCGGCCACG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1117156834 14:52950665-52950687 TGGGAGGTGGTGGAGGACCCGGG 0: 1
1: 0
2: 3
3: 68
4: 578

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117156834 Original CRISPR TGGGAGGTGGTGGAGGACCC GGG Intronic
900100578 1:960460-960482 TCGGAGGAGGAGGCGGACCCGGG + Intergenic
900166983 1:1247770-1247792 GTGAAGGTGGTGGAGGACCCTGG + Intergenic
900314349 1:2049718-2049740 TGGGCGGCGGTGGAGGGGCCTGG + Intergenic
900684569 1:3939906-3939928 AGTGACGTGCTGGAGGACCCAGG - Intergenic
901206115 1:7496828-7496850 TGGGAGGTGGTGTTGGGGCCTGG - Intronic
901261074 1:7871386-7871408 TGGGAGGTGAGGGAGGATGCTGG - Intergenic
902047975 1:13540146-13540168 GGGGTGGTGGTGGATGAGCCTGG + Intergenic
902169635 1:14599278-14599300 TCGGAGGTGGCCGGGGACCCGGG + Intronic
902405710 1:16182228-16182250 TGGGAGGTGTGGGGGGATCCAGG + Intergenic
902922069 1:19672041-19672063 TGGGAGATTGTGGAGGGTCCAGG + Intronic
903069419 1:20719419-20719441 AGGGAGGAGGAGGAGGACGCCGG + Intergenic
903383084 1:22910069-22910091 TGGGAGGAGCTGGTGGAACCAGG + Intronic
903517926 1:23924947-23924969 TGGGAGGTGGTGGAGGATGAAGG - Intergenic
903857422 1:26345255-26345277 AGGGAGGTCGTGAAGGGCCCCGG - Exonic
904284189 1:29443514-29443536 TGGGAGGTGGGAGGGGAACCTGG + Intergenic
904373516 1:30065855-30065877 TGGGAGGTGGTGGGTGAGCAGGG - Intergenic
904376684 1:30086173-30086195 GAGGAGGTGGCGGAGGTCCCGGG + Intergenic
904587061 1:31586491-31586513 TGGGAGGGGGTGGGGCACCAAGG - Intronic
904608928 1:31714711-31714733 TGGGAGGTGGTGGGGGGGCGGGG + Intergenic
904893747 1:33798776-33798798 TGGGAGATGGAGTGGGACCCTGG + Intronic
905031406 1:34886324-34886346 CGGGAGGGGGTGGAAGTCCCTGG + Intronic
905302601 1:36996038-36996060 AGGCAGGTGGTGGAGGATCTCGG - Intronic
905894861 1:41538963-41538985 TGGGTGGGGGAGGAGGACCCAGG - Intronic
905902273 1:41589449-41589471 TGGGAAGTAATGGAGGAGCCCGG + Intronic
906083146 1:43107525-43107547 TGGGAGGTGGTGGGGGGGCGGGG + Intergenic
906113161 1:43337978-43338000 TGGGAGGTGATGCAGGGCCCCGG + Intronic
906524356 1:46485777-46485799 TGGGAGGTGGAGGGGGCCGCGGG + Intergenic
906738866 1:48161118-48161140 TGGGAGGTGGCGCAGGAGCCTGG + Intergenic
907080496 1:51617270-51617292 TGGGTGGAGGTGGGGGACCGGGG + Intronic
907243822 1:53094737-53094759 TGCGTGGTGGTGGTGGAGCCCGG - Intronic
907425739 1:54378438-54378460 GGGGCTGTGGTGGAGAACCCAGG + Intronic
907440400 1:54475015-54475037 TGGGAGGCGGCGGAGGAGCCGGG - Intergenic
907527568 1:55062905-55062927 AGGGAGGCGGTGGAGGGTCCAGG + Intronic
908446452 1:64202411-64202433 AGGGAGGTTGTGGAGGAGCCTGG - Intergenic
910108201 1:83654072-83654094 GGGGAGGTGGTGGAAGACAGGGG - Intergenic
910624606 1:89293045-89293067 TGGGAGGAGGTGGGGGACCAGGG - Intergenic
911024260 1:93420183-93420205 TGGGAGGTGGAGGTGAACCTGGG + Intergenic
911734878 1:101326057-101326079 TGGGAGGACGGGGAGGAGCCTGG - Intergenic
912411437 1:109483401-109483423 TAGGAGGTGCTGAAGGACACAGG - Intergenic
912515946 1:110216667-110216689 TGGGTGGGGGTGAAGGGCCCAGG - Intronic
912551937 1:110490321-110490343 TGGGGGGTGGGGGAGGAAGCTGG - Intergenic
912682284 1:111737040-111737062 GGGGAGGGGGTGGAGCACCATGG + Intronic
913335735 1:117707855-117707877 TGGGAGGTGGAAGAGGAAACTGG + Intergenic
913966617 1:143382276-143382298 TTGGAGATGGAGGAGGACTCTGG + Intergenic
914060992 1:144207883-144207905 TTGGAGATGGAGGAGGACTCTGG + Intergenic
914118158 1:144758486-144758508 TTGGAGATGGAGGAGGACTCTGG - Intergenic
914430294 1:147614507-147614529 TGGGAGGGGGTAGAAGACCTGGG - Exonic
914824218 1:151129753-151129775 TGGGAGGTTATGGAGAAACCAGG - Intergenic
915141968 1:153773464-153773486 TGTGAGGGGCTGGAGGCCCCAGG - Exonic
915170319 1:153972925-153972947 TGGGGGCAGGTGAAGGACCCAGG + Intronic
915624937 1:157108733-157108755 TGGGAGGGGATGGAGGACGTGGG + Intergenic
915722638 1:157995506-157995528 TTGGTGGTGGAGGAGGCCCCTGG + Intronic
918040767 1:180912809-180912831 CGGGAGGGGCTGGAGGAGCCGGG - Intergenic
918206017 1:182310078-182310100 TGGGAGGTGGTGAAGAAGCAGGG + Intergenic
919038242 1:192345024-192345046 TGGGAGATGGTGTAGAACCAAGG - Intronic
919801794 1:201358861-201358883 GGGGAGAGGGTGGAGGGCCCAGG - Intergenic
920255118 1:204649466-204649488 TGGGAGGTGGTAGAAGAACATGG + Intronic
920338342 1:205259693-205259715 TGGGAGGAGGTGGAAACCCCAGG + Intronic
920435096 1:205942346-205942368 AGGGAGGTGGGGGAGGACTGTGG + Intronic
920517817 1:206599571-206599593 TGGGAGGTCGGGGAGGGCTCGGG + Exonic
920545087 1:206809745-206809767 TGGGAGGTGGGGTTGGGCCCAGG + Intronic
920656486 1:207879388-207879410 TGGAAGGTACTGGGGGACCCTGG - Intergenic
922551507 1:226497758-226497780 TGGGAGGTGGGGAGGGAACCAGG - Intergenic
922781499 1:228256525-228256547 TGGGAGGTGGTGGTGCAGCCTGG + Intronic
923058374 1:230447328-230447350 TTGGAGGTGATGGAGCATCCAGG - Intergenic
923596028 1:235361410-235361432 CAGGAGGTTGTGGGGGACCCTGG - Intergenic
924308953 1:242720379-242720401 TGGGAGGTGGTGGAGCACAGTGG - Intergenic
1062830808 10:604152-604174 AGTGAGATGGGGGAGGACCCTGG - Intronic
1063503757 10:6578898-6578920 TGGGGTGGGGTGGGGGACCCAGG + Intronic
1063574437 10:7249058-7249080 CGGGAGGTGGTGGCAGACCTTGG - Intronic
1064801421 10:19077775-19077797 TGGTAGGTGGTAGAGGAGCTGGG - Intronic
1064960142 10:20954702-20954724 GGGGTGGTGGTGGGGGAGCCAGG - Intronic
1067855056 10:49784815-49784837 TGGGAGCTGAAGGAGGGCCCAGG - Intergenic
1068513406 10:57995234-57995256 TCGGAGGGGGTGGGGGACCAGGG + Intergenic
1070304663 10:75233264-75233286 GGGGAGGTGGAGAAGGAACCAGG - Intergenic
1071277530 10:84069297-84069319 TTGGAGGCAGTGGAGGCCCCTGG + Intergenic
1072767577 10:98108155-98108177 TGGGAGATGGTGGAGGAGGGAGG - Intergenic
1074040311 10:109781652-109781674 TGGGAGGAGGCGGAGGAGGCAGG - Intergenic
1074366229 10:112859640-112859662 TGGGAGGTGGGGCTGGAACCGGG + Intergenic
1074428206 10:113370665-113370687 AGGGAGGTGGTGTTGGAACCTGG + Intergenic
1074871227 10:117577586-117577608 GGGGAGGTGGAGGACGAACCAGG + Intergenic
1075300786 10:121322242-121322264 TGGGACGTGGGGCAGCACCCTGG - Intergenic
1075589292 10:123679827-123679849 TGGGAGTGGGTAGAGGATCCTGG - Intronic
1075590565 10:123688214-123688236 TGGGAGGGCGTGGGGGCCCCTGG + Exonic
1075901370 10:126045098-126045120 TGCAAGCTGGTTGAGGACCCTGG - Intronic
1076372938 10:129966820-129966842 TGGGATGGGGTGGGGGACCAGGG - Intergenic
1076407722 10:130224194-130224216 TGGGGGGTGGAGGAAGACCATGG + Intergenic
1076574058 10:131452159-131452181 TGGGGGGTGGGGCAGGGCCCAGG - Intergenic
1076649827 10:131980206-131980228 TGGGAGGTGGAGGGGGCTCCGGG - Intronic
1076726628 10:132416928-132416950 TGGGGGGCGGTGGAGGTCCCGGG + Intronic
1076993827 11:289073-289095 TGGGAGGCGGGGGCGGTCCCTGG - Intergenic
1077182990 11:1224672-1224694 TGGGTCGGGGTGGAGGACTCAGG + Intronic
1077215390 11:1393347-1393369 TGGGAGGAGCTGGAGAACCTCGG + Intronic
1077377238 11:2210794-2210816 AGGGATGTGGTGGAGGCCCGAGG + Intergenic
1078431663 11:11292938-11292960 AGGGAGGTGGTGGAGGAGAGGGG - Intronic
1079567366 11:21899304-21899326 TGGGAGGTGGGGATGGGCCCAGG + Intergenic
1080573550 11:33578255-33578277 TGGGAGGTGAGGGATGGCCCCGG + Intronic
1080668903 11:34358284-34358306 TGGGAGGTGGAGGTGGAGACCGG + Intergenic
1081642430 11:44765308-44765330 TGGGAGGTTGTGGAAGGCCATGG + Intronic
1081686494 11:45046880-45046902 TGGGAGGAGGAGGAGGAGGCAGG - Intergenic
1081720521 11:45285562-45285584 TGGGTGGTGGTTGTGGAGCCAGG - Intronic
1082867207 11:57910979-57911001 TGGTAAGTGGTGGGGTACCCGGG - Intergenic
1083804996 11:65068175-65068197 TGGGGGGTGTGGGAGGACCCAGG - Intronic
1083957478 11:65993140-65993162 TGGGAGGGTGTGGAGGACTGGGG - Intergenic
1084363499 11:68684016-68684038 TGGGAGGTCATGGGGTACCCGGG - Intronic
1084709545 11:70835536-70835558 TGGGGGCTTATGGAGGACCCTGG + Intronic
1085301547 11:75461887-75461909 TGGGAGGAGGGCAAGGACCCAGG - Intronic
1085416975 11:76325369-76325391 TGGGACATGGTGGAAGACTCTGG + Intergenic
1085641903 11:78197963-78197985 TGGGAGGTGCTGGACCACGCTGG - Exonic
1085717892 11:78889342-78889364 AGGAAGGAGGTGGAGCACCCTGG - Intronic
1085777881 11:79382670-79382692 AGGGAGGGGGAGGAGGACACTGG + Intronic
1085848927 11:80097746-80097768 TGGGAGGTGAAGAAGGACACTGG - Intergenic
1086464243 11:87037500-87037522 TGGGAGCTGGTGGAGGAAGAGGG - Intergenic
1086549760 11:88042307-88042329 TGGGAGGTGATGGAGAAGCAAGG - Intergenic
1087234495 11:95703117-95703139 TGGGTGGTTGCTGAGGACCCTGG - Intergenic
1089519022 11:119051591-119051613 AGGGAGGTGGAGGAGGAGCCTGG - Exonic
1089602239 11:119623271-119623293 TGGGAGATGGAGGAGGAGTCTGG + Intergenic
1090418580 11:126557891-126557913 TGGGAAGAGCTGGAGCACCCAGG - Intronic
1090554318 11:127857653-127857675 TGGTAAGTGATGGAGGCCCCAGG + Intergenic
1090758597 11:129816079-129816101 CGGGAGGGGATGGAGGGCCCTGG + Intronic
1091218746 11:133918691-133918713 TGGGAGGTGGTCGAGGAGGAGGG - Intronic
1092257754 12:6936584-6936606 GAGGAGGTGGTGGGGGACCCTGG - Exonic
1092492261 12:8956241-8956263 TGGGAAGTGGTGGTGGCGCCAGG + Intronic
1093256988 12:16880971-16880993 TACCAGGTGGTGGAGGACTCTGG + Intergenic
1093392941 12:18644836-18644858 TGGGAAGTGGTAGAGGAGGCAGG - Intronic
1094211013 12:27891746-27891768 TGGGAGGTGGTGGAGCCCAGTGG + Intergenic
1095409517 12:41907113-41907135 TGGGAGGAGGTGGAGGAACTGGG - Intergenic
1096258160 12:50075170-50075192 AGGGAGGGGGTGGAGGACTGAGG - Intronic
1097583016 12:61481408-61481430 TAGGAAGTGGTTGAAGACCCTGG - Intergenic
1098154038 12:67578656-67578678 TGGGAGATGGTGGATGCCACTGG + Intergenic
1098541466 12:71663062-71663084 TGGGAGGAGGAGCAGGATCCGGG - Exonic
1098789672 12:74805698-74805720 TGGGAGGAGGGAGAGGATCCAGG + Intergenic
1100673761 12:96844750-96844772 TGGGAGCTGGGGGAGTGCCCAGG - Intronic
1101504259 12:105331267-105331289 TGGGAGGTGGGGGAGCGGCCGGG - Intronic
1101740745 12:107498013-107498035 TGGAAGGTGGTGAGGCACCCTGG + Intronic
1101858767 12:108465481-108465503 CGGGAGGTGGGGCAGGAACCAGG + Intergenic
1102452134 12:113049847-113049869 TGGGAGATGGAAGGGGACCCAGG - Intergenic
1102519583 12:113470209-113470231 GGTGGGGTGGGGGAGGACCCAGG + Intronic
1103719535 12:122966001-122966023 TGGGAGGTGTTGGAGGATCCTGG - Intronic
1103971500 12:124675587-124675609 TGAGGGGTGGGGTAGGACCCTGG + Intergenic
1103998922 12:124847784-124847806 TGGGAGCTGGGGGAGGATCCAGG + Intronic
1104107748 12:125680215-125680237 TGGGAGGTGAGGGAGAAGCCAGG - Intergenic
1104107769 12:125680312-125680334 TGGGAGGTGAAGGAGGAGCCAGG - Intergenic
1104107777 12:125680344-125680366 TGGGGGGTGAGGGAGGAGCCAGG - Intergenic
1104107788 12:125680376-125680398 TGGGAAGTGAGGGAGGAGCCAGG - Intergenic
1104107796 12:125680408-125680430 TGGGGGGTGAGGGAGGAGCCAGG - Intergenic
1104107823 12:125680505-125680527 TGGGGGGTGAGGGAGGAGCCAGG - Intergenic
1104107848 12:125680570-125680592 TGGGGGGTGAGGGAGGAGCCAGG - Intergenic
1104107875 12:125680667-125680689 TGGGGGGTGAGGGAGGAGCCAGG - Intergenic
1104107900 12:125680732-125680754 TGGGGGGTGAGGGAGGAGCCAGG - Intergenic
1104107912 12:125680764-125680786 TGGGAAGTGAGGGAGGAGCCAGG - Intergenic
1104604475 12:130177828-130177850 TGGGAGCCGCTGGAGGACTCCGG + Intergenic
1104682337 12:130760543-130760565 TGGGAGGGTGTGTTGGACCCAGG - Intergenic
1105431194 13:20339398-20339420 TGGGAGGAGGGGCGGGACCCTGG - Intergenic
1105431368 13:20340340-20340362 TGGGAGGTGGTGTGTGCCCCGGG + Intergenic
1106582989 13:31033707-31033729 TGGCAGGTGGGGAAGGCCCCGGG - Intergenic
1107372285 13:39766232-39766254 TGGTAGGTGGTGGAGGAACAGGG - Intronic
1109687731 13:65843602-65843624 TCGGAGGGGGTGGAGGAGGCAGG - Intergenic
1110430483 13:75417333-75417355 GGGCAGGTGGTGCAGGACACAGG - Intronic
1112363672 13:98739433-98739455 TGGGACCTGGGGGAGGACACTGG + Intronic
1112730625 13:102357032-102357054 TAGGAAGTGGTGGAGGAGCAGGG + Intronic
1113087151 13:106580377-106580399 TGGGAGGAGGTGGAGGATGGAGG + Intergenic
1113422701 13:110182637-110182659 TGGGAGTTGGGGGAGCGCCCAGG - Intronic
1113722475 13:112570087-112570109 TGGGATTGGGTGGAGGACCCAGG - Intronic
1114093193 14:19305946-19305968 TGGGGGGTGGTGGCGGGCACTGG - Intergenic
1117156834 14:52950665-52950687 TGGGAGGTGGTGGAGGACCCGGG + Intronic
1117825811 14:59702659-59702681 TGGGAGATGGTGGTGGAACAGGG - Intronic
1117982044 14:61351248-61351270 TGTGAGGGGATGGAGGACACAGG + Intronic
1118224208 14:63883978-63884000 TGGGTGGTGATGGGTGACCCAGG + Intronic
1118254910 14:64197033-64197055 TGGGAGGTGGAGGTGCAGCCGGG + Intronic
1118867537 14:69715258-69715280 TGGCAAGAGGTGGAGGAGCCAGG + Intergenic
1119115757 14:72019810-72019832 TGAGCTGTGGTGAAGGACCCTGG - Intronic
1119850205 14:77861450-77861472 TGGGAGGGGCTGGAGGAGGCTGG - Intronic
1120190173 14:81433463-81433485 TGGCAGATGATGAAGGACCCTGG - Intronic
1121117009 14:91350961-91350983 TGGTAGGTAGTGGTGGACCCGGG - Intronic
1121406144 14:93720452-93720474 GGGGAGATGATGGAGGACTCTGG + Exonic
1121565792 14:94908352-94908374 GGGGAGGCTGGGGAGGACCCTGG - Intergenic
1122243497 14:100384381-100384403 TGGCAGGGGCTGGAGGAGCCAGG + Intronic
1122889117 14:104724478-104724500 TGGGCGGTGGGGGAGGGACCCGG - Intronic
1122930500 14:104931202-104931224 TGGGAGGTGGTGGGAGGACCTGG + Intronic
1123541396 15:21295289-21295311 TGGGAGGTTGCGGAGGCGCCTGG + Intergenic
1123762889 15:23446546-23446568 TGTGGGGTGGTGGAGGGCCAGGG + Intronic
1124244686 15:28058892-28058914 TGGGAGCAGGGAGAGGACCCAGG - Intronic
1124248836 15:28094708-28094730 TGCGAGGTGGGGGTGGGCCCGGG + Intronic
1124937053 15:34183329-34183351 TGGGAGGGGCAGGAGGAGCCTGG - Intronic
1126158477 15:45587150-45587172 TGGGAGCTGGGGGAGGACGGTGG - Exonic
1126678738 15:51184181-51184203 TGGGAGGAGGTGCAGGAGCTGGG - Intergenic
1127295731 15:57607288-57607310 TGGTAGGGGCTGGAGGACCCTGG + Intronic
1127625008 15:60771816-60771838 TGAGAGGTAGGGGAGGAACCAGG - Intronic
1127843672 15:62851036-62851058 TGGAAGGTGGGGGAGGGCACAGG + Intergenic
1128061565 15:64738800-64738822 AGGGAGGAGGAGGAGGAGCCTGG - Intergenic
1128107587 15:65055976-65055998 CGGGAGGTGGTGTAGGACCAAGG - Intronic
1128291347 15:66480837-66480859 TGGGACTTGGTGAAGGCCCCTGG - Intronic
1128350795 15:66887051-66887073 AGGGAGGTGAGAGAGGACCCGGG + Intergenic
1128568144 15:68714668-68714690 TAGGAGGTGGGGGAGGGCCCGGG + Intronic
1129330870 15:74826536-74826558 GGGGAGGTGGGGGCGGGCCCGGG + Exonic
1130224349 15:82046060-82046082 AGGGAGGGAGTGGAGGAGCCGGG - Exonic
1130229666 15:82087009-82087031 AAGGAGGTGGAGGAGGATCCAGG + Intergenic
1130997604 15:88912581-88912603 TGGGAGGCGGAGGAGGACCGGGG + Intronic
1132063915 15:98714960-98714982 TGGGAGGGGCTTGTGGACCCTGG + Intronic
1132071139 15:98777413-98777435 AGGGAGGTGGTGAGGGGCCCGGG + Intronic
1202949709 15_KI270727v1_random:22430-22452 TGGGAGGTTGCGGAGGCGCCTGG + Intergenic
1132637211 16:957012-957034 TCGGATGTGGTGGTGCACCCCGG + Intronic
1132713684 16:1280146-1280168 CGGGACGTGCTGGCGGACCCAGG + Intergenic
1133007766 16:2894310-2894332 CGGGAGGCGCTAGAGGACCCGGG + Intronic
1133173641 16:3997691-3997713 TGGGAGGTGGGGGGAGAGCCAGG + Intronic
1133208215 16:4246852-4246874 CGGGAGATGCTGGAGGACACAGG + Intergenic
1133269210 16:4602408-4602430 TGGGAGGGGGTGGAAGTCACAGG - Intergenic
1134514150 16:14873353-14873375 TGGGAGGTGGTGGAGGCAGGGGG + Intronic
1134612190 16:15618316-15618338 CGGGAGGTGGAAGAGGACCAGGG - Intronic
1134701792 16:16271852-16271874 TGGGAGGTGGTGGAGGCAGGGGG + Intronic
1134970038 16:18522798-18522820 TGGGAGGTGGTGGAGGCAGGGGG - Intronic
1135525966 16:23213760-23213782 TGTGAGGTGCTGGGGGAACCAGG + Intronic
1135990349 16:27215094-27215116 TGGGAGGTTTTGGAGGAGCCAGG + Intronic
1136125112 16:28173737-28173759 CGGGAGGTGGTGGAGAACAGTGG + Intronic
1136171459 16:28492177-28492199 AGGGAGGGGCTGGAGAACCCTGG + Exonic
1136343920 16:29663263-29663285 CGGGAGGTGGTGGAGTGACCTGG + Exonic
1136410767 16:30075863-30075885 GGGAAGGAGGTGGAGGAACCCGG - Intergenic
1136777562 16:32879887-32879909 TGGGAGGAGGTTGAGGAGGCCGG + Intergenic
1136893062 16:33981627-33981649 TGGGAGGAGGTTGAGGAGGCCGG - Intergenic
1137486996 16:48899776-48899798 TGTGATGTGGTGCAGCACCCTGG - Intergenic
1137613997 16:49836287-49836309 TTGGAGGTGGAGGATGTCCCAGG - Intronic
1138895269 16:61197122-61197144 TGAGAGGTGGTGGAAGACCACGG - Intergenic
1139468129 16:67164884-67164906 TGGGCGCTGGTGGGGGACCCAGG + Exonic
1139491361 16:67287827-67287849 TGGGGGGTGGTAGAGGCCCAAGG + Intronic
1139636444 16:68261096-68261118 AGGGAGGTGGTGGAGGTACAAGG + Intergenic
1139706004 16:68741073-68741095 GGGGAGGTGGCGGGGGACCCTGG + Intronic
1139968905 16:70761639-70761661 TGGGAGGTGGAGGGGGCCCCTGG - Intronic
1140541287 16:75758611-75758633 GGGGAGGAGGTGGAGGACCAGGG + Intronic
1141345414 16:83240274-83240296 TGGGAGGGGGTGGATCACTCAGG + Intronic
1141527402 16:84620466-84620488 GGGGAGGCTGTGGAAGACCCAGG + Intergenic
1142029702 16:87832381-87832403 TGGGAGGGGGTGGGGGATCTGGG - Exonic
1142174052 16:88636877-88636899 GAGGAGGTGCTGGAGGGCCCAGG + Intergenic
1142213849 16:88821429-88821451 TGGGAGGTGTGGGTGGACCTGGG + Intronic
1142260271 16:89039554-89039576 TGGGACGTGGTGGGGGCACCTGG + Intergenic
1142287342 16:89176858-89176880 TGGGAGGTGCTGGGGGTCCCAGG - Intronic
1203079976 16_KI270728v1_random:1141996-1142018 TGGGAGGAGGTTGAGGAGGCCGG + Intergenic
1142496091 17:307034-307056 GGGGAGGTGGGGGAGGCCCCCGG - Intronic
1142772390 17:2107852-2107874 TGGGAGGGGCTGGAACACCCAGG + Intronic
1142795336 17:2303281-2303303 TGGGGTCTGGTGGAGGCCCCGGG - Intronic
1142979474 17:3663385-3663407 TGGGAAATGCTGGAGGAACCAGG - Exonic
1143462511 17:7112852-7112874 TGGGTGCTGGTGGTGGAGCCGGG - Intronic
1143799946 17:9370489-9370511 AGGGAGGTGGGGCAGGACCCTGG - Intronic
1143879667 17:10020226-10020248 TGGGAGGTGGTGGAGTGACAGGG - Intronic
1144523135 17:15967561-15967583 TGGGAGAAGGTGGAGGATGCAGG + Intronic
1144523363 17:15969116-15969138 TGGGAGGAGGTGGAGGATGCAGG - Intronic
1145014444 17:19387327-19387349 TGGGAGGTGGGGCTGGAGCCAGG + Intergenic
1145833025 17:27932700-27932722 GGGGAGGTAGGGGAGGAGCCAGG + Intergenic
1147019769 17:37521830-37521852 TGGGAGAGGTTGGGGGACCCGGG + Intronic
1147142347 17:38466665-38466687 TGGGAGGTGGAGCAGGGCCACGG - Exonic
1147207798 17:38850920-38850942 TGGGAGGAGTTGGGGGTCCCAGG - Intronic
1147442926 17:40458376-40458398 TGGCAGGGGGTGGAGGGTCCGGG + Intergenic
1147476977 17:40721594-40721616 TGGGAGGTGGTGGTGGCAACGGG - Intergenic
1147953508 17:44120001-44120023 TGGGAGGTGGTTTTGGATCCCGG - Intronic
1147987811 17:44316361-44316383 TGGGAGGGGGAGGAGGAGTCAGG - Intronic
1148085435 17:44990964-44990986 TGGGAGGTGGAGGTGGAGGCAGG + Intergenic
1148088354 17:45007882-45007904 TGGGAGATGGTGGAGGAAGATGG - Intergenic
1148151489 17:45398924-45398946 TGGGAGGTGGTGGGGACTCCTGG - Intronic
1148218127 17:45845055-45845077 TGGGGCGTGGTGCAGGTCCCGGG - Exonic
1148342926 17:46884144-46884166 TGGGAAGAGGTGGGGGTCCCGGG - Intronic
1148479808 17:47952714-47952736 AGGGGGAGGGTGGAGGACCCTGG + Exonic
1148989808 17:51656013-51656035 TGCCAGGTGGTGGAAGAACCAGG + Intronic
1149552791 17:57552423-57552445 TGCCAGGAGGTGGAAGACCCAGG - Intronic
1150315105 17:64162689-64162711 TGGGAGGTGGAGGAAGGCCCAGG + Intronic
1150802171 17:68291249-68291271 CGGGAGTGGGTGGAGGGCCCGGG - Intronic
1151342545 17:73481180-73481202 TGGAAGGTGGGGGAGGGCCCTGG + Intronic
1151578156 17:74963145-74963167 TTGGGGGTGGTGGAGGACAGGGG + Intronic
1151615168 17:75205412-75205434 CGGGAGGGGCAGGAGGACCCCGG - Intergenic
1151731552 17:75914392-75914414 TGGGAGGAGGTGGTGGAGCCAGG + Intronic
1151834030 17:76571844-76571866 TGGGTGTGGGTGGAGGAACCTGG + Intronic
1151891007 17:76950169-76950191 TGAGAGTTGGTGGAGGGGCCAGG + Exonic
1152475003 17:80512276-80512298 TGGCAGGTGGTCCAGGTCCCTGG - Intergenic
1152635420 17:81428792-81428814 TGAGAAGTGGTGGGGGTCCCCGG - Intronic
1152678100 17:81651811-81651833 TGGGAGGTTGGGGAGGAGGCGGG - Intronic
1152713767 17:81888352-81888374 TTGGTGGTGGTGGAGGCACCCGG - Exonic
1153323896 18:3798576-3798598 TGGAGGGTGGTTGAGTACCCTGG + Intronic
1154210597 18:12376210-12376232 CGGGTGGTGGTTGAGGTCCCCGG - Intronic
1157197943 18:45635008-45635030 TGGGAGGTTGTGGAAAACCAAGG + Intronic
1157220981 18:45828386-45828408 GGGGAGATGGAGGAGGACCTGGG - Intronic
1158509891 18:58080926-58080948 TGGGAGGTGGTAGAGGGCTGGGG + Intronic
1159095237 18:63894481-63894503 AGGGAGGTGCTGCAGGACCAAGG + Intronic
1159102949 18:63975354-63975376 GATGAGGTTGTGGAGGACCCCGG + Intronic
1159117983 18:64136829-64136851 TGAGAGGTGGTCCAGGACACAGG + Intergenic
1160357916 18:78244382-78244404 TTGGAGGAGGGGGACGACCCTGG - Intergenic
1160363683 18:78306466-78306488 TTGGAGGTGGAGGAGGGACCAGG - Intergenic
1160381108 18:78456839-78456861 GGGGATGTGGAGGTGGACCCAGG + Intergenic
1160925066 19:1540383-1540405 GGACAGGTGGTGGTGGACCCTGG - Intergenic
1160930578 19:1567973-1567995 GGGGCGGCGGGGGAGGACCCCGG - Exonic
1161352775 19:3803229-3803251 TGTGAGGTGGAGGAGGACGGTGG + Intergenic
1161380052 19:3960030-3960052 GGGGAGGTGGGGGAGCTCCCTGG - Intronic
1161699511 19:5787206-5787228 TGGGAGGTGGTGGGAGACGGTGG + Intronic
1161811005 19:6471364-6471386 TGGCGGGTAGTGGGGGACCCAGG + Intronic
1162326731 19:10003908-10003930 TGGGATGTGTTGGAGGTCACGGG + Intronic
1162332528 19:10039013-10039035 TGGGGGGTGGTGGTGGATCCTGG + Intergenic
1162419584 19:10558403-10558425 GGGGAGTTGGCGGAGGATCCTGG - Intronic
1162789146 19:13054119-13054141 CGGGAACTGGGGGAGGACCCTGG - Intronic
1163187948 19:15652850-15652872 TGCAAGGTGGTACAGGACCCAGG - Exonic
1163216943 19:15886004-15886026 TGCAAGGTGGTACAGGACCCAGG + Exonic
1163221139 19:15922117-15922139 TGCAAGGTGGTATAGGACCCAGG + Exonic
1163364013 19:16866148-16866170 AGGGAGGAGGTGGAGGAACCGGG + Intronic
1163373312 19:16914610-16914632 TGGGAGGAGGTGAGGGGCCCGGG + Intronic
1163426242 19:17242578-17242600 TGGCTGGTGCTGCAGGACCCAGG - Intronic
1163700096 19:18782589-18782611 TGGGTCGTGGAGGTGGACCCAGG + Intergenic
1164052198 19:21592993-21593015 TGTGAGGTGGTGCAGGCCTCTGG - Intergenic
1164120487 19:22261590-22261612 TGGCGGGTGGTTGGGGACCCGGG - Intergenic
1164567126 19:29334172-29334194 TTGGAGAGGGTGGGGGACCCAGG + Intergenic
1165066794 19:33234305-33234327 GGGGAGGTGGTGAAAGGCCCAGG - Intergenic
1165094675 19:33403583-33403605 AGCCAGGGGGTGGAGGACCCTGG + Intronic
1165312812 19:35039273-35039295 TGGGAGGTGGGAGGGCACCCAGG + Intronic
1165431541 19:35775976-35775998 TGGGAGCTGGGGAAGGACCCAGG - Intronic
1166352886 19:42208663-42208685 TGGGAGCAGGTGGAGGAGCCAGG - Intronic
1166716017 19:44968356-44968378 TGGGAGGTGGAGCAGGAACTGGG + Intronic
1166732651 19:45067699-45067721 TGGGGGGTGGTGTATGGCCCTGG + Intronic
1167016825 19:46846409-46846431 TAAGAGGTGGTGGAGGAGCCTGG - Intronic
1167096009 19:47375463-47375485 TAGGAGCTGTTGGAGGACCACGG + Exonic
1167574216 19:50309934-50309956 TGGGAGGTTGCAGGGGACCCAGG - Exonic
1167576703 19:50321105-50321127 TGGGATGTGGTGGTGGTGCCAGG + Intronic
1167608868 19:50496660-50496682 TGGGAGTAGGTGGAGACCCCAGG + Intergenic
1167650017 19:50723983-50724005 TGGGAGATGGAGGAGGACCAGGG + Exonic
1167687526 19:50965969-50965991 TTGGAGGAGCTGGAGGGCCCAGG - Intronic
1167742196 19:51330267-51330289 AGGGAGGGGGTGGGGGGCCCTGG + Exonic
1168124812 19:54277508-54277530 TGGGAGGTGGGCGGGGTCCCGGG - Intronic
1168254159 19:55156973-55156995 TGGGAGTGGGGGGAGGAGCCAGG - Intronic
1168259542 19:55185780-55185802 TTGGAGTTGGTGGAGGGTCCTGG + Intronic
1168298706 19:55390756-55390778 TGGGTTGGGGTGGAGGAACCAGG + Intronic
1168329594 19:55559581-55559603 TGGGAAGTGGTTGAGGACATGGG + Intergenic
1168333127 19:55580881-55580903 TGGGGGGTGGAGGAGGAGGCTGG + Intergenic
1168712726 19:58511267-58511289 CGGGTGCTGGTGGTGGACCCAGG - Exonic
1202700400 1_KI270712v1_random:159771-159793 TTGGAGATGGAGGAGGACTCTGG + Intergenic
925498574 2:4479740-4479762 TGGTAGGAGGTGGAGCAGCCAGG + Intergenic
925730044 2:6913241-6913263 CGGCAGCTGGTGGAGGAGCCTGG - Intergenic
925855285 2:8123636-8123658 AGGGAGGCAGGGGAGGACCCTGG + Intergenic
926036341 2:9638695-9638717 TGGGAGGGGCTGGAAGATCCAGG + Intergenic
926054506 2:9766475-9766497 TGGGAGGTGGGGGACAAGCCTGG - Intergenic
926123969 2:10260115-10260137 TAGGGGGTGATGGAGGAGCCAGG + Intergenic
926737448 2:16084194-16084216 TGGGAGGTGCTGGGAGGCCCAGG + Intergenic
927692733 2:25219659-25219681 TGGTGGGTGGAGAAGGACCCAGG + Intergenic
928069770 2:28202948-28202970 TGTGGGGGGGTGGAGGACACAGG - Intronic
928430901 2:31217631-31217653 TGGAAGGGAGTGGAGTACCCAGG + Intronic
929089579 2:38201606-38201628 TGGGTGGTGGGGGAGTAGCCTGG + Intergenic
930017077 2:46978277-46978299 TGGCAGGTGGTGGCGGAGCCAGG - Intronic
932432864 2:71686017-71686039 TGCCATGTGGGGGAGGACCCTGG + Intronic
932892445 2:75608870-75608892 GGGGAGGAGGTCGAGCACCCTGG + Intergenic
933646148 2:84814198-84814220 TGGGAGGTGGTGGGGGAGTGGGG - Intronic
934082876 2:88484295-88484317 TTGGTGATGGTGGAGGACCTGGG - Intergenic
934624635 2:95836052-95836074 GGTGGGGTGGTGGAGGCCCCAGG + Intergenic
934808946 2:97265368-97265390 GGTGGGGTGGTGGAGGCCCCAGG - Intergenic
934828559 2:97491801-97491823 GGTGGGGTGGTGGAGGCCCCAGG + Intergenic
935592025 2:104853264-104853286 AGAGAGGGGGTGGAGGAGCCAGG + Intergenic
936166843 2:110128317-110128339 TGGTAGGTGGTGGGTAACCCAGG - Intronic
936268810 2:111032756-111032778 TGGGAGGTTGTGTTGGACGCAGG - Intronic
937296666 2:120813646-120813668 AGGGTGGTGGTGGGGGACCTGGG - Intronic
937644459 2:124250646-124250668 GGGGAGCTGGAGGAGGAGCCTGG + Intronic
937991210 2:127663569-127663591 GGGGAGGGCCTGGAGGACCCAGG - Intronic
938068494 2:128294308-128294330 TGGGCTGTGATGGAGGGCCCCGG + Intronic
938493178 2:131776498-131776520 TGGGAAGTGGCAGGGGACCCCGG - Intergenic
938499303 2:131822155-131822177 TGGGAAGTGGCAGGGGACCCCGG + Intergenic
941394248 2:164955309-164955331 TGCGAGGTGGCGGAGGAGGCTGG - Exonic
942447296 2:176086310-176086332 TGGGAAGTGGTGCGAGACCCTGG + Intergenic
943344515 2:186722718-186722740 TGGCAGGAGGTGGAGGTCACTGG + Intronic
945639153 2:212400309-212400331 GGGGAGGTGGTGAAGCACCTAGG + Intronic
946391102 2:219417588-219417610 AGGGAGGGGGCGGGGGACCCAGG + Intergenic
948205549 2:236161073-236161095 TGGGAGCTGCGGGAGGACCCAGG - Intergenic
948371918 2:237495062-237495084 TTGGAGGTGGAGGAGGGGCCAGG - Intronic
948381042 2:237550216-237550238 AGGGAGGCGGTGGAGAGCCCCGG - Intronic
948384054 2:237570831-237570853 TGGGGGGTGGTGGTGGATGCCGG - Intergenic
948666572 2:239538448-239538470 TGGGAGTTGGTTGAGGATCAGGG - Intergenic
1169073770 20:2749596-2749618 TGGGAGGCAGGAGAGGACCCAGG - Intronic
1169855158 20:10094106-10094128 TGGAAGCTGGTGCAGGACACAGG + Intergenic
1170005228 20:11661491-11661513 TGGGAGGAGGGAGAGGACCAGGG - Intergenic
1170471755 20:16674793-16674815 TGTGAGGAGTTGGGGGACCCAGG + Intergenic
1171443652 20:25187398-25187420 TGGGAGGAGGGGCAGGCCCCAGG + Intergenic
1172106781 20:32521861-32521883 GGAGAGGTGCGGGAGGACCCAGG - Intronic
1172646069 20:36470412-36470434 TGGGAGGGGAGGCAGGACCCAGG - Intronic
1172781280 20:37438260-37438282 AGGGAGGGGGTGCAGGAGCCAGG + Intergenic
1172951337 20:38725029-38725051 TGGGAGGTGGTGGCGAATTCGGG + Exonic
1173745473 20:45433525-45433547 TGGGCTGGGCTGGAGGACCCAGG - Intergenic
1173869543 20:46332750-46332772 TGGGAGGAGCTGGCTGACCCTGG - Intergenic
1174896857 20:54458393-54458415 TGGAAGGTGGATAAGGACCCAGG + Intergenic
1175319962 20:58078632-58078654 TGGGGGGTGGGCGAGGACTCTGG - Intergenic
1175715623 20:61252792-61252814 TGGGGCTCGGTGGAGGACCCGGG + Intronic
1175782999 20:61695642-61695664 TGGGACGTGCTGGAGGATCCAGG - Intronic
1175817650 20:61891773-61891795 TGGGAGGTGCGGTTGGACCCGGG - Intronic
1175896237 20:62336688-62336710 TGGGAGATGGGTGAGGACCCAGG - Intronic
1175942833 20:62545891-62545913 TGGGAGCTCAGGGAGGACCCCGG - Intergenic
1175992533 20:62796806-62796828 TGGGAGGGGGCGGGGGTCCCGGG - Intronic
1176168836 20:63688081-63688103 TGGGAGGTGGGGGAGCACTGAGG + Intronic
1176728534 21:10465769-10465791 AGGGAGGAGGTGGAGGGCCTGGG + Intergenic
1178511837 21:33211885-33211907 TGGGCGGGGGTGGAGGAAACAGG - Intergenic
1179380283 21:40892243-40892265 TGGGAGGTGGGAGAGGACCAGGG + Intergenic
1179540490 21:42080292-42080314 TGGCAGATGTTGGAGGCCCCTGG + Intronic
1179617697 21:42592745-42592767 TGGGAGGTGGGTGAGGTCCTGGG + Intergenic
1179712949 21:43273534-43273556 AGGAAGGTGGTGGTGGCCCCAGG + Intergenic
1179928770 21:44552797-44552819 TGGCACGTGCTGGAGGCCCCAGG - Intronic
1180487540 22:15816619-15816641 TGGGGGGTGGTGGCGGGCACTGG + Intergenic
1181359539 22:22323790-22323812 AGGGAGGTGGTGGAGGTGTCTGG + Intergenic
1181369619 22:22405534-22405556 AGGGAGGTGGTGGAGGTGTCTGG + Intergenic
1181703206 22:24632382-24632404 TGGGGGGGGTTGGGGGACCCAGG + Intergenic
1182183140 22:28372471-28372493 TGGAAGCTGGTGGAGGATTCAGG - Intronic
1182511943 22:30826159-30826181 TGGGAATTGATGGAGGACACGGG + Intronic
1182856542 22:33522450-33522472 TGGGAGGTGGAGGTGGAGGCGGG + Intronic
1183272229 22:36869442-36869464 TGGGAGGTGTTTAAGGAGCCAGG - Intronic
1183342879 22:37291660-37291682 GGAGAGGTTGTGGAGGCCCCAGG + Intronic
1183359134 22:37374348-37374370 TGGGTGGTGGTGGAGGTGCTGGG + Exonic
1183441575 22:37825750-37825772 TAAGAGGTGGTGGAGGAAGCAGG - Intergenic
1183715535 22:39531184-39531206 GGGGAGGTGGGTGAGCACCCAGG + Intronic
1183980641 22:41537900-41537922 TGGGAGGTGGAGGTGGAGGCAGG - Intronic
1183984702 22:41563023-41563045 TGGGTGGTGGTGGGGAAACCAGG - Intronic
1184142091 22:42583836-42583858 TGGGAAGTGGAGGAGGACACAGG + Exonic
1184433671 22:44456895-44456917 GGGGAGGTGGTGGAGGCCTCAGG + Intergenic
1184741172 22:46429884-46429906 TGAGAGGCGGTGTGGGACCCAGG - Intronic
1185037163 22:48485429-48485451 TGACAGCTGGGGGAGGACCCAGG - Intergenic
1185080696 22:48707976-48707998 AGGGAGGTGGGGGAGGAGACAGG - Intronic
1185146738 22:49141246-49141268 TGTGAGGTGAGGGAGGACACAGG + Intergenic
1185148017 22:49149788-49149810 GGGGAGGGGAGGGAGGACCCTGG + Intergenic
1185218492 22:49617013-49617035 TGGGTGGTGGAGGAAGTCCCTGG - Intronic
1185266488 22:49906847-49906869 TGGGTGCTGGGGAAGGACCCGGG - Intronic
1185294944 22:50048571-50048593 TGGGAGCCGCTGGAGCACCCAGG + Intronic
950513649 3:13449327-13449349 TGGGAGGTGGAGGCGGAGGCGGG - Intergenic
950744611 3:15077115-15077137 TTGGATGTGGTGGAGGGTCCTGG + Exonic
950918634 3:16670319-16670341 TTGGAAGTAGTGGAGGACTCAGG + Intergenic
953147384 3:40291113-40291135 TGGGAAGTGGTGGTGGGGCCAGG - Intergenic
953661385 3:44894067-44894089 TGGGAGGTGGGAGAGGGCCAAGG - Intronic
953671671 3:44968052-44968074 AGTGAGGTGGTGGTGGAGCCAGG + Intronic
954421001 3:50418938-50418960 TGGGAGTTGGGGGATGATCCTGG + Intronic
954583435 3:51715862-51715884 TGGCTGGTGGTGGAGGCACCGGG + Exonic
954637744 3:52080486-52080508 TGTGAGGGGGTGGGTGACCCTGG - Intronic
954748555 3:52800817-52800839 GGGCAGGTGGTGGAGAGCCCTGG - Intronic
954983395 3:54767065-54767087 TGGGAGGTGGTGCAGGGCTTGGG + Intronic
955818521 3:62873748-62873770 TGGCAGGGCTTGGAGGACCCAGG + Intronic
956205723 3:66752912-66752934 TTGGAGGTGCTGGAGGATTCTGG + Intergenic
957290463 3:78271699-78271721 TGAGTGTTGGTGGAGGAACCAGG - Intergenic
958924308 3:100141106-100141128 TGGGAAGTGGAGGAGGAACCAGG - Intronic
958961945 3:100519103-100519125 TGGGTGGAGGTGGAGGCCACCGG + Intronic
959644042 3:108677562-108677584 TGGGTGGTGGAGGAGGAAGCTGG - Exonic
960582906 3:119295487-119295509 TGGGGGGTGGGGGAGGATCCTGG + Intronic
961041451 3:123681473-123681495 AAGGAGGTAGTGGAGGAGCCAGG + Intronic
961458525 3:127036101-127036123 AGGGAGGTGGAGGCGCACCCAGG - Exonic
961481039 3:127180955-127180977 TGGGAGGTGTTCCAGGGCCCAGG + Intergenic
961677501 3:128576653-128576675 CAGGAGGTGGAGGAGAACCCAGG + Intergenic
962290800 3:134134811-134134833 TGAGAGGTGGAACAGGACCCAGG - Intronic
962354440 3:134681583-134681605 TGGCAGGAGATGGAGGAGCCTGG + Intronic
962840402 3:139227328-139227350 TGGGGGTGGGTGGAGGAGCCAGG + Intronic
963337747 3:143996602-143996624 AAGGAGGTGGTGGAGGGACCAGG + Intronic
963857227 3:150267301-150267323 TGGGGGCTGGAGGAGGACCAAGG - Intergenic
964289835 3:155165467-155165489 GGAGAGGTGGGAGAGGACCCTGG + Intronic
964308528 3:155366876-155366898 TGGGATGTTGTAGAGGGCCCTGG + Intergenic
964741560 3:159971546-159971568 ATGGAGTTGCTGGAGGACCCTGG + Intergenic
964977553 3:162638480-162638502 GGGGAGGTGTGAGAGGACCCTGG - Intergenic
965400850 3:168210596-168210618 TGGAAGGTGGTGGAGAAATCAGG + Intergenic
966230159 3:177642675-177642697 TGGGAGGTTGTGGAGGGGGCTGG - Intergenic
966623448 3:181991214-181991236 TGGGAGCAGGTGGAGGGTCCTGG + Intergenic
966818225 3:183906169-183906191 TGGGAGGTGGCAGAGGGCCCAGG + Intergenic
966932636 3:184685745-184685767 TTGGGGCTGGGGGAGGACCCTGG + Intergenic
967631063 3:191743288-191743310 TGGGGGGTGGGGGAGTACACAGG - Intergenic
968084864 3:195869748-195869770 CGGGAGATGGAGGAGGCCCCAGG + Intronic
968119280 3:196113182-196113204 TGGGAGGTTGAGGTGGACCCAGG - Intergenic
968222168 3:196947469-196947491 TGGGAGGTGTAGGAGGTGCCGGG + Exonic
968577967 4:1376739-1376761 TGGCAGGCGCTGGAGTACCCAGG - Intronic
968734456 4:2288213-2288235 TGGGAGGTGATGCAGGTCCTCGG - Intronic
968840806 4:3004085-3004107 TGGGACGGGGTGGAGGGTCCAGG + Intronic
968897903 4:3415530-3415552 TGGGAGGTGCAGGAGAAGCCTGG + Intronic
968917476 4:3502897-3502919 TGTGAGGAGGTGGAGCACACGGG + Intergenic
968972500 4:3803354-3803376 TGGGAGGTGGAGCAGGACCAAGG + Intergenic
969594911 4:8143367-8143389 TGGGAGGTACCGGAGGACCACGG + Intronic
970504196 4:16710471-16710493 TGAGAGTTTGTGGAGGATCCAGG + Intronic
971805222 4:31350161-31350183 TGAGAGTTCGTGGAGGTCCCAGG + Intergenic
972525475 4:39906117-39906139 TGGGAGGTGGAGGTGGAAGCAGG + Intronic
973807378 4:54539367-54539389 TGTGAAGTGGTGAAGAACCCAGG - Intergenic
975946821 4:79716619-79716641 AGGAAGGTGGTGGAGTACCAAGG + Intergenic
977209865 4:94206503-94206525 TGTGGGGCGGGGGAGGACCCCGG + Intergenic
978118553 4:105050572-105050594 TAGGAGGTGGCAGGGGACCCTGG - Intergenic
978955513 4:114607894-114607916 TAGGAGGTGATGGAAGGCCCAGG - Intronic
980695989 4:136356176-136356198 AAGGAGGAGGAGGAGGACCCCGG - Intergenic
984467910 4:180124744-180124766 TGGGATGTCTTGGAGGACCAGGG - Intergenic
984654779 4:182306005-182306027 TGGGAGGAGCTGGAGGTGCCTGG + Intronic
984704824 4:182840069-182840091 TGGGAGGCAGTGGAGGGCCCTGG - Intergenic
985359192 4:189154651-189154673 TGGGAGTCCGTGGAGGCCCCTGG + Intergenic
985544275 5:501282-501304 TTGGAGGTGGCGGAGGCCCTGGG - Intronic
985670814 5:1205678-1205700 AGGGAGAGGGTGGAGGACACTGG + Intronic
985818716 5:2145699-2145721 GGTGAGGAGGTGGAGGATCCGGG - Intergenic
985818725 5:2145740-2145762 GGTGAGGAGGTGGAGGATCCGGG - Intergenic
985818771 5:2145983-2146005 GGTGAGGAGGTGGAGGACCTGGG - Intergenic
986073681 5:4312750-4312772 TGTGATGGGGTGGAGGACCCAGG - Intergenic
986169417 5:5303586-5303608 TGGGAAGGGGTGGAGGAAGCGGG + Exonic
986171698 5:5319654-5319676 GGGGAGGAGGAGGAGGAGCCTGG - Exonic
986300588 5:6475709-6475731 TGGGTGGTGCTGGAGGAGGCAGG + Intronic
987291403 5:16511892-16511914 TGGGAGGTGATGGGGGATCATGG - Intronic
987550950 5:19380660-19380682 TGGGAGGAGGGAGAGGACCAGGG + Intergenic
987906880 5:24088733-24088755 TAGGAGGTGGTTGGAGACCCAGG - Intronic
988138449 5:27204338-27204360 TGTCAGGGGGTGGAGGACTCGGG + Intergenic
990786295 5:59424134-59424156 TGGGAGATGGGGAAGGTCCCTGG + Intronic
990827193 5:59914280-59914302 TGGGGGGTGGTTAAGGAGCCTGG + Intronic
991014612 5:61917508-61917530 TGGGAGGAAGTGAAGAACCCAGG + Intergenic
992012452 5:72542081-72542103 GGGGAGATGGAGGAGGACCATGG + Intergenic
992082312 5:73246629-73246651 TGGGAGGAGCTGGAGGACAAAGG - Intergenic
994092422 5:95821008-95821030 TGGGAGGTTGAGGAGAACCCAGG + Intronic
994322063 5:98405579-98405601 TGGGAGGTTGTGGAGTCACCAGG - Intergenic
994525856 5:100903843-100903865 TGGGTGGTGGACGACGACCCTGG + Intergenic
995140372 5:108728422-108728444 TGGGAGGTGGGGCAGGAGCACGG + Intergenic
996551534 5:124735444-124735466 TGGGAGCAGATGGAGGGCCCTGG - Intronic
997369399 5:133348499-133348521 TAGGAGTTGGTGGGGGTCCCAGG + Intronic
997696725 5:135866770-135866792 TAGGAAGTGGAGGAGGGCCCAGG - Intronic
998358912 5:141567118-141567140 TGGGAGATGAAGGATGACCCAGG + Intronic
998866601 5:146510585-146510607 TGGGAGGTGGGGGTGGACCCCGG - Exonic
999074461 5:148781182-148781204 TGGGAGGTGGCTGAAGACCTTGG - Intergenic
999443542 5:151621021-151621043 TGGGGGGTGGTGGAGGAGGTTGG + Intergenic
999706137 5:154273909-154273931 TGGGAGGCGGAGGGGGAGCCCGG - Intronic
999730698 5:154474925-154474947 TGGGAGTCGGTGAGGGACCCCGG + Intergenic
1000860912 5:166455081-166455103 TGGAAGGTGGTGCAGGTCCCGGG - Intergenic
1001313898 5:170629532-170629554 TGGGGTGGGGTGGGGGACCCAGG - Intronic
1002071127 5:176679574-176679596 TGGGACGTGACGGGGGACCCTGG - Intergenic
1002105872 5:176879242-176879264 CAGGAGGTGGCGGTGGACCCGGG + Intronic
1002510974 5:179717370-179717392 TGGGAGTTGGGGGAGGAAACAGG - Intronic
1002662985 5:180803537-180803559 GAGGAGGTGGAGGTGGACCCAGG + Intronic
1003269377 6:4593630-4593652 TGGGAGCTTGTGGAGGTTCCAGG + Intergenic
1003652017 6:7969492-7969514 TGGCAGTTTGTTGAGGACCCAGG + Intronic
1003891106 6:10564507-10564529 TGGCTGGTGATGGAGGAGCCAGG - Intronic
1004358290 6:14948966-14948988 TGGCAGGTGGTGAAGGAGCTAGG - Intergenic
1005861733 6:29907585-29907607 TGGCAGGTAGTGGGGGAGCCAGG - Intergenic
1005945260 6:30590648-30590670 CGGGAGGTGTTGGAGGCCCTGGG + Exonic
1006091452 6:31631403-31631425 TGCGTGGTGGTGGGGGGCCCTGG - Exonic
1006342874 6:33456161-33456183 TGTCAGGGGGTGGAGGACCTGGG + Exonic
1006398789 6:33803844-33803866 TGGAAGGTGGCAGAGGGCCCTGG + Intronic
1006434894 6:34020957-34020979 TGGGAGGGGGTGCAGGACCCAGG + Intronic
1006447056 6:34085470-34085492 GGGCAGGAGGTGGAGGTCCCAGG + Intronic
1006954380 6:37854459-37854481 TTGGAGGTGGTGATGGATCCAGG + Intronic
1007221939 6:40285700-40285722 TGGAAAGGGGTGGAGGAACCAGG - Intergenic
1007612886 6:43161568-43161590 TGGGAGGTAGGGGTGGGCCCTGG + Intronic
1007717461 6:43865467-43865489 TGGGAGGGGGCACAGGACCCTGG + Intergenic
1010416501 6:75617516-75617538 TGGGAGGTGGAGGCGGAGGCGGG - Intronic
1013608264 6:111770959-111770981 AGAGAGGTTGAGGAGGACCCAGG - Intronic
1015130275 6:129801904-129801926 TGGCAGGAGTTGGAGCACCCTGG + Intergenic
1015790114 6:136957753-136957775 TGGGCGGTGGTGGGGGAGCCTGG - Intergenic
1016518177 6:144920505-144920527 TGTGAGATGGAGGAGGACTCTGG - Intergenic
1018081614 6:160263680-160263702 TGGGATGTGCTGCAGGACCAGGG + Intronic
1018111263 6:160538951-160538973 TGGGATGGTGGGGAGGACCCTGG + Intronic
1018752903 6:166822619-166822641 TGGGAGGTGGTGGGGCAGGCAGG - Intronic
1019153335 6:170023399-170023421 TGGGAGGGGGTGGAAGACAAAGG - Intergenic
1019342645 7:515857-515879 TGGGTGGGGGTGGAGGAGGCGGG + Intronic
1019442062 7:1052496-1052518 TTGGAGGTGCTGGAGGAGCAGGG + Intronic
1019447862 7:1080878-1080900 TGGGACGAGGTGCAGGGCCCAGG - Intronic
1019942036 7:4299326-4299348 TGGGAGGTGAGGGAGGATGCAGG + Intergenic
1021206475 7:17786872-17786894 TGGTAGGTAGTGGGGGAGCCAGG + Intergenic
1021613382 7:22478959-22478981 TGGGAGCTGGGCAAGGACCCCGG - Intronic
1022151994 7:27617845-27617867 TGGGGGATGGTGAATGACCCAGG - Intronic
1022246132 7:28561358-28561380 TGGGATAAGGTGGAGGACCAAGG + Intronic
1023639918 7:42247138-42247160 TGGGAGGTGGTGGTTCACTCTGG + Intergenic
1023743851 7:43303921-43303943 TGAGAGGGAGAGGAGGACCCAGG + Intronic
1023838630 7:44082804-44082826 TTGGAGGGGGTGGAGGAGGCGGG + Intergenic
1023849200 7:44140838-44140860 TGGGAGGTGGGGGAGAGACCTGG + Intronic
1024006496 7:45228213-45228235 TGGCAGGTGGAGGAGGCCCAGGG + Intergenic
1024896003 7:54263088-54263110 TGGGAGGTTTTGGATGACGCGGG - Intergenic
1026407029 7:70077047-70077069 TGGGGGGTCCTGGAGGACACAGG + Intronic
1026684051 7:72493148-72493170 GGGGAGGTGGTGGGAGACCCGGG - Intergenic
1026926481 7:74197653-74197675 TGTCTGGTGATGGAGGACCCCGG + Intergenic
1026933563 7:74238687-74238709 TGGTAGGTGAGGGAGGACCACGG - Intronic
1027269770 7:76513054-76513076 TGGGAGGTGGTGGGGGAGGAGGG - Intronic
1027320481 7:77006949-77006971 TGGGAGGTGGTGGGGGAGGAGGG - Intergenic
1029188444 7:98755534-98755556 TGGGAGGTGGAGAAGGTGCCTGG - Intergenic
1029325814 7:99807945-99807967 TGGGGGGTGGTTGAGTACACAGG - Intergenic
1029487615 7:100852947-100852969 TTGGGGGAGGAGGAGGACCCGGG + Intronic
1029529782 7:101117617-101117639 TGGGTGGGGGTGGAGGTCCCAGG - Intergenic
1029658751 7:101945041-101945063 TGGGAGGTGGGGTGGCACCCTGG - Intronic
1031125884 7:117772860-117772882 TGAGAGGTGGAGCACGACCCTGG + Intronic
1033757004 7:144403885-144403907 TGCGAGGGCGGGGAGGACCCGGG + Intronic
1034418353 7:150976782-150976804 TGAGAGGTGGGGGTGGGCCCAGG - Intronic
1034455819 7:151169080-151169102 TGGGAGGAGGGGGAGGACGATGG - Intronic
1034465641 7:151227001-151227023 GGCGGGGTGGGGGAGGACCCGGG - Intronic
1034497642 7:151431975-151431997 TGGGAGGAGCTGGATGATCCAGG - Intronic
1034975654 7:155448111-155448133 TGGGGGCTGGTGGAGGACGCAGG + Intergenic
1035553259 8:545341-545363 TCGGGGGTAGAGGAGGACCCAGG - Intronic
1035589292 8:800962-800984 TGGCAGGTGGATGGGGACCCAGG - Intergenic
1037743198 8:21623413-21623435 TGGGAGGTGGGGGTGGAGGCTGG - Intergenic
1037899276 8:22678092-22678114 GGGGAGCTGGAGGAGGACCATGG + Intergenic
1037924788 8:22835635-22835657 TGGGAGGCTGTGGAAGATCCTGG - Intronic
1038017920 8:23530238-23530260 TAGGAGGTGGTGTAGGAGCCTGG - Intronic
1038326913 8:26578721-26578743 TGGGTGGGGGCGGAAGACCCGGG - Intronic
1038719419 8:30020355-30020377 GGGGAGGTGGAGGAGGAGGCTGG + Intergenic
1038869273 8:31476380-31476402 TGGGAGATGGAGGATGGCCCTGG + Intergenic
1039550780 8:38441326-38441348 AGGGAGGAGGTGGGGGACACTGG - Intronic
1039792452 8:40886705-40886727 GGGGAGTTGTTGGAGAACCCAGG - Intronic
1040545000 8:48392208-48392230 TGGGAGTTCGTGCAGGACCCAGG + Intergenic
1041881898 8:62761333-62761355 GGGGAGGTGGGGGAGGACGGGGG + Intronic
1044286354 8:90415386-90415408 GGGGATGTGTGGGAGGACCCTGG - Intergenic
1044783085 8:95763482-95763504 TGGGAAGTGTTGAAGGAACCAGG - Intergenic
1048889817 8:138937019-138937041 TGGTGGGTGGTGGAGGACGTGGG - Intergenic
1049039171 8:140099444-140099466 TGGAAGGCTGTGGAGAACCCGGG - Intronic
1049197673 8:141324550-141324572 TGGGGTGTGGTGGAGGGGCCTGG + Intergenic
1049341481 8:142114871-142114893 TGGGAGGAGGAGGAGGACAGAGG + Intergenic
1049572539 8:143376007-143376029 TGGGAGGGGGTGGAAGACCTGGG + Intronic
1049586462 8:143434742-143434764 TGGGGGCTGGTGTAGGGCCCAGG + Intergenic
1049718905 8:144106685-144106707 AGGGAGGTGGGGGAGGAGGCGGG - Intronic
1049906929 9:226482-226504 TGGGAGGCAGTGGAGAATCCAGG + Intronic
1049985594 9:947985-948007 TGGGAGGTGCTGGAGCTCACTGG + Intronic
1052896331 9:33750925-33750947 CGGGAGGGGATGGAGGGCCCTGG + Intronic
1052978667 9:34430942-34430964 GGGGAGGTGGTTCAGAACCCTGG - Intronic
1053558878 9:39168434-39168456 TGGGATGGGGTAGAGGAACCAGG - Intronic
1053623286 9:39842576-39842598 TGGGACGTTGTAGAGGACACAGG + Intergenic
1053823001 9:41988666-41988688 TGGGATGGGGTAGAGGAACCAGG - Intronic
1053881583 9:42600654-42600676 TGGGACGTTGTAGAGGACACAGG - Intergenic
1053891082 9:42693643-42693665 TGGGACGTTGTAGAGGACACAGG + Intergenic
1054138233 9:61450509-61450531 TGGGATGGGGTAGAGGAACCAGG + Intergenic
1054220616 9:62408120-62408142 TGGGACGTTGTAGAGGACACAGG - Intergenic
1054230098 9:62501052-62501074 TGGGACGTTGTAGAGGACACAGG + Intergenic
1054607572 9:67198700-67198722 TGGGATGGGGTAGAGGAACCAGG + Intergenic
1056068397 9:82960754-82960776 TCAGATGAGGTGGAGGACCCGGG + Intergenic
1056346609 9:85702749-85702771 TGGGAGGTGAAGGAAGACCAGGG + Intronic
1056494379 9:87141637-87141659 TGGGAGGTGATGGGTGGCCCCGG + Intergenic
1056719128 9:89058381-89058403 TAGGATGTGGTGGAGGACAGTGG + Intronic
1056719301 9:89059151-89059173 AGGATGGTGGTGGAGGACCGTGG + Intronic
1056751780 9:89357122-89357144 TGGGATTTGGGGGAGGACACAGG + Intronic
1057229123 9:93308324-93308346 AGGCTGCTGGTGGAGGACCCTGG - Exonic
1057270673 9:93649036-93649058 TGGGAGGAGCTTGAGCACCCTGG - Intronic
1057540655 9:95965749-95965771 TGGGAGGTGGAGGTGGAGGCAGG - Intronic
1058055556 9:100445026-100445048 TGGAGGGTGGTGGAGAACCTTGG + Intronic
1059951142 9:119463524-119463546 TGGTAGAAGCTGGAGGACCCAGG - Intergenic
1060041791 9:120306659-120306681 TGGGAGGTGGTGTGGGCCACGGG + Intergenic
1060052375 9:120386592-120386614 TGGGAGGTGGAGGAGCAGCCTGG - Intergenic
1060394027 9:123303190-123303212 GGGGAGGTCTTGGAGGAACCTGG + Intergenic
1061162246 9:128902127-128902149 TGGGGAGTGGAGGAGGGCCCTGG - Intronic
1061218928 9:129237642-129237664 TGGGGGGTGGTGGAGGTGGCAGG + Intergenic
1061875346 9:133540805-133540827 TGGGAGGCAGTGGCGGCCCCGGG + Intronic
1062035242 9:134379956-134379978 TGGGGGTTGGTGGAGGCCTCGGG + Intronic
1062164581 9:135101130-135101152 TGGGAGGTTGCTGAGGAGCCCGG + Intronic
1062217314 9:135396217-135396239 TGGGAGGTGGGAGAGGATCGGGG + Intergenic
1062521407 9:136959460-136959482 CGGGAGGTGGTGGTGGCCACTGG - Intergenic
1062613652 9:137386650-137386672 TGGGAGGATGTGGTGGGCCCTGG - Intronic
1062646666 9:137551498-137551520 CGGGAGGTCGGGGAGGACGCGGG - Exonic
1185724404 X:2407780-2407802 TGGGAGGTGGAAGAGGAGCAAGG + Intronic
1186940975 X:14506912-14506934 TGGAAGGTGGTGGAAGAATCAGG + Intergenic
1187020421 X:15375794-15375816 TTGGAGGATGTGGAGGTCCCAGG - Intronic
1187290948 X:17952639-17952661 TGGGGGTTGGGGGAGAACCCTGG + Intergenic
1187902040 X:24034553-24034575 TGGGAAGTGGAGGAGGACACAGG + Intergenic
1188007101 X:25022927-25022949 TGGAAGGAGGTGCAGGAGCCCGG + Intergenic
1188268498 X:28108998-28109020 TGGGAGGAGGTGAAAGATCCAGG - Intergenic
1190862346 X:54357295-54357317 TGGGAGCTGATGGAAGACCAGGG - Intronic
1192533647 X:71910810-71910832 GGGGAGGAGGAGGAGGAGCCCGG + Intergenic
1192801134 X:74465811-74465833 GGGGAGGTGGTGGAGGATATGGG + Intronic
1192885010 X:75327838-75327860 GAGGAGGAGGAGGAGGACCCGGG - Intergenic
1193052094 X:77112144-77112166 TGGGAGGTGGCTGGAGACCCTGG - Intergenic
1193433244 X:81438115-81438137 GGGGATGTGTGGGAGGACCCAGG - Intergenic
1193818007 X:86126371-86126393 TGGGGGGAGGTTGAAGACCCCGG + Intergenic
1195148641 X:102043586-102043608 TAGGAGGTGGTTGGAGACCCCGG - Intergenic
1196061358 X:111411244-111411266 GGGGAGGGGGTGGAGCACCTGGG - Intronic
1196085470 X:111679125-111679147 TGGGAGGTGGAGGCGGAGGCGGG + Intronic
1197159294 X:123305913-123305935 TGGGAGGTGGTGGGGGAAGATGG + Intronic
1198767288 X:140092189-140092211 TGCGAGGTGGAGGAGGAGCGGGG - Intergenic
1199760088 X:150898592-150898614 TGGGAGCAGGCGGAGGGCCCCGG + Exonic
1200092434 X:153642275-153642297 TGGGAGGTGGAGGGAGACGCCGG + Intergenic