ID: 1117156835

View in Genome Browser
Species Human (GRCh38)
Location 14:52950666-52950688
Sequence GGGAGGTGGTGGAGGACCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 614
Summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 559}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117156818_1117156835 24 Left 1117156818 14:52950619-52950641 CCAAAGAAAGGCGAATCCCACCG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1117156835 14:52950666-52950688 GGGAGGTGGTGGAGGACCCGGGG 0: 1
1: 0
2: 3
3: 51
4: 559
1117156821_1117156835 7 Left 1117156821 14:52950636-52950658 CCACCGAATTCGCAGCGCCGGCC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1117156835 14:52950666-52950688 GGGAGGTGGTGGAGGACCCGGGG 0: 1
1: 0
2: 3
3: 51
4: 559
1117156829_1117156835 -10 Left 1117156829 14:52950653-52950675 CCGGCCACGGGCTGGGAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 243
Right 1117156835 14:52950666-52950688 GGGAGGTGGTGGAGGACCCGGGG 0: 1
1: 0
2: 3
3: 51
4: 559
1117156816_1117156835 26 Left 1117156816 14:52950617-52950639 CCCCAAAGAAAGGCGAATCCCAC 0: 1
1: 0
2: 1
3: 8
4: 79
Right 1117156835 14:52950666-52950688 GGGAGGTGGTGGAGGACCCGGGG 0: 1
1: 0
2: 3
3: 51
4: 559
1117156815_1117156835 27 Left 1117156815 14:52950616-52950638 CCCCCAAAGAAAGGCGAATCCCA 0: 1
1: 0
2: 2
3: 7
4: 221
Right 1117156835 14:52950666-52950688 GGGAGGTGGTGGAGGACCCGGGG 0: 1
1: 0
2: 3
3: 51
4: 559
1117156822_1117156835 4 Left 1117156822 14:52950639-52950661 CCGAATTCGCAGCGCCGGCCACG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1117156835 14:52950666-52950688 GGGAGGTGGTGGAGGACCCGGGG 0: 1
1: 0
2: 3
3: 51
4: 559
1117156817_1117156835 25 Left 1117156817 14:52950618-52950640 CCCAAAGAAAGGCGAATCCCACC 0: 1
1: 0
2: 1
3: 5
4: 74
Right 1117156835 14:52950666-52950688 GGGAGGTGGTGGAGGACCCGGGG 0: 1
1: 0
2: 3
3: 51
4: 559
1117156820_1117156835 8 Left 1117156820 14:52950635-52950657 CCCACCGAATTCGCAGCGCCGGC 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1117156835 14:52950666-52950688 GGGAGGTGGTGGAGGACCCGGGG 0: 1
1: 0
2: 3
3: 51
4: 559

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117156835 Original CRISPR GGGAGGTGGTGGAGGACCCG GGG Intronic
900100579 1:960461-960483 CGGAGGAGGAGGCGGACCCGGGG + Intergenic
900105531 1:979351-979373 GGCAGGTGCTTGAGGATCCGAGG + Exonic
900158380 1:1212491-1212513 GGGAGGTGCTGGTGGCCCTGGGG - Intronic
900166984 1:1247771-1247793 TGAAGGTGGTGGAGGACCCTGGG + Intergenic
900300414 1:1974114-1974136 GTGAGGAGGTGGAGGCCACGGGG - Exonic
900354191 1:2252110-2252132 AGGAGGAGGAGGAGGAACCGAGG + Intronic
900369781 1:2326548-2326570 GGGAGGTGGTGCAGGAGCCCTGG + Intronic
901420944 1:9150702-9150724 GGGAGGAGGGTGAGGACCAGAGG + Intergenic
902169636 1:14599279-14599301 CGGAGGTGGCCGGGGACCCGGGG + Intronic
902283033 1:15388307-15388329 GGGAGGTGGGGCAGGGCCTGGGG - Intronic
902323197 1:15683188-15683210 GGGAGGCTGTGGAGGGCCAGGGG + Intergenic
902502536 1:16920688-16920710 GGGAGGTGGTGGGTGACCTCTGG + Intronic
903123950 1:21235388-21235410 GGGAGGTGGAGGAGGGCCGCAGG + Intronic
903445115 1:23418084-23418106 GGGAGGTGGTGGTAGAGCTGGGG - Intronic
904045817 1:27607535-27607557 CGGAGGTGGTGAGGGACCTGGGG + Intergenic
904376685 1:30086174-30086196 AGGAGGTGGCGGAGGTCCCGGGG + Intergenic
904383888 1:30129403-30129425 GGCAGGGGGTGGAGGAGGCGGGG + Intergenic
904972750 1:34431894-34431916 AGGAGGTGGTGCAGGACCCTAGG + Intergenic
905031407 1:34886325-34886347 GGGAGGGGGTGGAAGTCCCTGGG + Intronic
905302600 1:36996037-36996059 GGCAGGTGGTGGAGGATCTCGGG - Intronic
905894860 1:41538962-41538984 GGGTGGGGGAGGAGGACCCAGGG - Intronic
906083147 1:43107526-43107548 GGGAGGTGGTGGGGGGGCGGGGG + Intergenic
906113162 1:43337979-43338001 GGGAGGTGATGCAGGGCCCCGGG + Intronic
906281872 1:44559989-44560011 GGGAGGTGCTGAAGGAGCCGTGG - Intronic
906524357 1:46485778-46485800 GGGAGGTGGAGGGGGCCGCGGGG + Intergenic
906960271 1:50415799-50415821 GTGAGGTAGTGGGGCACCCGAGG - Intergenic
907308343 1:53525823-53525845 GGGAGGAGGTGGAGGATGCGAGG - Intronic
907425740 1:54378439-54378461 GGGCTGTGGTGGAGAACCCAGGG + Intronic
907440399 1:54475014-54475036 GGGAGGCGGCGGAGGAGCCGGGG - Intergenic
907513856 1:54980987-54981009 GTGTGGTGGTGGAGGACGCCAGG - Exonic
907833514 1:58087612-58087634 GGGAGGAGCTTGAGGACCAGTGG + Intronic
908446451 1:64202410-64202432 GGGAGGTTGTGGAGGAGCCTGGG - Intergenic
908521496 1:64947577-64947599 GGGGGTTGGGGGAGGACCCATGG - Intronic
908523442 1:64966299-64966321 CGGGGGAGGTGGAGGAGCCGGGG - Intronic
910728027 1:90359341-90359363 GTGAGGTGGTGGATGATCAGAGG + Intergenic
912127917 1:106563163-106563185 GGGAGGGGGTGGAGGAGAAGTGG + Intergenic
912215696 1:107608665-107608687 GGAAGGTGGAGGAGGGCCCGAGG + Intronic
912495294 1:110087938-110087960 GGGACGTGGTGGAGGGCGGGAGG - Intergenic
912682285 1:111737041-111737063 GGGAGGGGGTGGAGCACCATGGG + Intronic
912799883 1:112714220-112714242 GGGAGGTGGTGGTGGGTCCATGG + Intronic
912884048 1:113450321-113450343 TGGAGGTGGTGGAGGAGCTATGG + Intronic
913189385 1:116400673-116400695 GGGATGGGATGGAGGACCCCAGG - Intronic
913594544 1:120360737-120360759 GGGAGGTGGTGCGGGAACCGTGG + Intergenic
914092720 1:144518249-144518271 GGGAGGTGGTGCGGGAACCGTGG - Intergenic
914305809 1:146415626-146415648 GGGAGGTGGTGCGGGAACCGTGG + Intergenic
914430293 1:147614506-147614528 GGGAGGGGGTAGAAGACCTGGGG - Exonic
914596246 1:149157180-149157202 GGGAGGTGGTGCGGGAACCGTGG - Intergenic
914704698 1:150161036-150161058 GGGAGGAGGGGGAGGAAACGGGG + Intronic
915135547 1:153728691-153728713 GGGAGGTGGAGGAGGAGGAGCGG + Exonic
915835420 1:159171880-159171902 GGGAGGTGGGGAGTGACCCGAGG + Intronic
916024780 1:160824014-160824036 GGAAGGTGTTGGAGAACCAGAGG + Intronic
918040951 1:180913326-180913348 GGGCGGGGGTGGCGGACCGGCGG + Intronic
918232280 1:182547386-182547408 GGGAGGTAATGGAGGAGCAGAGG + Intronic
918533646 1:185550673-185550695 TGGAGGTGGTGGAGGAGGGGTGG + Intergenic
919801793 1:201358860-201358882 GGGAGAGGGTGGAGGGCCCAGGG - Intergenic
920250359 1:204618773-204618795 GGGAGGCGCTGGAGGTCCGGAGG + Exonic
920250406 1:204618989-204619011 GGCAGGTGGTGGAAGGCGCGGGG + Exonic
920435097 1:205942347-205942369 GGGAGGTGGGGGAGGACTGTGGG + Intronic
920522214 1:206635913-206635935 AGGAGGTGGGGGCGGTCCCGGGG - Intronic
921132345 1:212230418-212230440 GGGAGGTGGAGGAGGACTCTTGG + Intergenic
922427668 1:225514710-225514732 AGGAGGTGGTGGAGGAGGAGGGG + Exonic
922546856 1:226464361-226464383 GGGCAGTGCTGGGGGACCCGGGG - Intergenic
922724389 1:227915667-227915689 GGGAGGAGGTGAAGGAGACGAGG - Intergenic
922758455 1:228109538-228109560 GCGAGGTCGAGGGGGACCCGCGG + Intergenic
923141359 1:231163245-231163267 GGGAGGTGGCGGAGACCACGCGG + Exonic
923337960 1:232986250-232986272 TGGAGCTGGTGGAGGAGCCCAGG + Exonic
923482593 1:234397762-234397784 GGGAGGAGGGGGAGGAGGCGGGG + Intronic
923482604 1:234397783-234397805 GGGAGGAGGGGGAGGAGGCGGGG + Intronic
924439980 1:244077949-244077971 GGGAGGAGGTGGGAGACTCGTGG - Intergenic
1062864515 10:840107-840129 GGGAGGGGGTAGAGGACGCTTGG + Intronic
1062908889 10:1199500-1199522 TGGAGGGTGTGGAGGGCCCGGGG + Intronic
1062908980 10:1199928-1199950 GGAAGGAGGTGGAGGGCCCCCGG + Intronic
1063574436 10:7249057-7249079 GGGAGGTGGTGGCAGACCTTGGG - Intronic
1064598688 10:16971938-16971960 GGGTGGTGGTGGAAGACTCAAGG - Intronic
1065059980 10:21890178-21890200 GGGGGGGGGTGGATGACCTGAGG + Intronic
1066080517 10:31927496-31927518 GGGAGGTGGTGGAGGAAGGAAGG - Intronic
1068065542 10:52126170-52126192 GGGAGGTGGTGGTGGGGCAGGGG + Intronic
1068513407 10:57995235-57995257 CGGAGGGGGTGGGGGACCAGGGG + Intergenic
1069771139 10:70901326-70901348 GGGAGGTGGGGTAGGAGGCGGGG - Intergenic
1070414751 10:76179240-76179262 GGGGGGTGGTGGAGGAGTAGAGG + Intronic
1070502385 10:77083861-77083883 GGGAGGTGGGAGAGGAGCAGAGG + Intronic
1070717175 10:78731159-78731181 GGGATGTGATAGAGGACCCCCGG - Intergenic
1071290163 10:84182865-84182887 AGGAGGTGGAGGAGGATCAGGGG + Intronic
1073094074 10:100969463-100969485 GGGTGGTGGAGGCGGAGCCGGGG - Intronic
1073137954 10:101230022-101230044 GGAAGGGGGTGGAGGACCCCAGG + Intergenic
1073206086 10:101770205-101770227 GGGAGGTGCTGGGGGAGCCCTGG - Intronic
1073240726 10:102056090-102056112 GGGTGGTAGAGGAGGAGCCGCGG - Exonic
1073435361 10:103512917-103512939 GGCAGGTGGTGGGGGCCCCTAGG + Intronic
1073578156 10:104641821-104641843 GGGAGGAGGTGAAGGCGCCGCGG + Exonic
1075007474 10:118841136-118841158 GGGTGCTGGTGGAGGAACCATGG + Intergenic
1075491735 10:122877345-122877367 GGGAAGTGGTGGAGGTCGCTAGG + Intronic
1076372937 10:129966819-129966841 GGGATGGGGTGGGGGACCAGGGG - Intergenic
1076574019 10:131451997-131452019 TGGGGGTGGTGGAGGTCCCAAGG - Intergenic
1076619655 10:131779060-131779082 GTCAGGTGGTGGAGGACAAGTGG - Intergenic
1076638925 10:131901048-131901070 CGGCGGTGGTGGCGGCCCCGGGG + Exonic
1076649826 10:131980205-131980227 GGGAGGTGGAGGGGGCTCCGGGG - Intronic
1076787782 10:132759641-132759663 GGGAGGTGGTGGGGGGCTCTCGG + Intronic
1076809529 10:132879384-132879406 GGGAGGTGCTGCAGGAGCAGGGG + Intronic
1077138795 11:1014468-1014490 GGGAAGTGGAGCAGGCCCCGTGG + Intronic
1077307783 11:1875706-1875728 GGAAGGTGCTAGAGGCCCCGGGG + Intronic
1077325042 11:1960041-1960063 GGGAAGGGGTGGAGGGCCCTCGG + Intronic
1077413188 11:2412985-2413007 AGGAGCTGGTGGAGGCGCCGAGG - Exonic
1079081549 11:17416856-17416878 GGGTGGGGGTGGAGGACTTGTGG - Intronic
1082987424 11:59180616-59180638 GGGAGGTCGGGGAGGGCCCCTGG - Intronic
1084110371 11:67010479-67010501 GGGAGGGGTGGGGGGACCCGAGG - Intronic
1084193558 11:67510100-67510122 GGGAAGTGGAGGTGGAGCCGTGG + Intergenic
1084363498 11:68684015-68684037 GGGAGGTCATGGGGTACCCGGGG - Intronic
1084364719 11:68690151-68690173 GGGAGGTGGTGGAGGGGAGGAGG + Intronic
1084448404 11:69217852-69217874 GGAAGGTGGTGGGGGAACCTCGG + Intergenic
1084460970 11:69296336-69296358 AGGAGGTGGTGGAGGAGGAGAGG - Exonic
1084623572 11:70291115-70291137 GGGAGCTGGTGGATAACCTGAGG - Intronic
1084858759 11:72004857-72004879 TGGAGATGGAGGAGGACCTGGGG + Intronic
1085045390 11:73349773-73349795 GGGAGAGGGTGCAGGACCTGTGG + Intronic
1085199840 11:74695222-74695244 GGGAGGGGATGGAGGAGCCGTGG + Intergenic
1085717891 11:78889341-78889363 GGAAGGAGGTGGAGCACCCTGGG - Intronic
1085777882 11:79382671-79382693 GGGAGGGGGAGGAGGACACTGGG + Intronic
1085886924 11:80532834-80532856 GGGTGGTGGTGGGGGTGCCGTGG + Intergenic
1089351739 11:117825202-117825224 GGGATGTGGTGGGGGAGCAGTGG - Intronic
1089519021 11:119051590-119051612 GGGAGGTGGAGGAGGAGCCTGGG - Exonic
1089606902 11:119646662-119646684 GGGAGGTGAGGGAGGAACCCAGG + Intronic
1090077453 11:123588212-123588234 AGGAGGGGGTGGAGGAGCCCAGG - Intronic
1090390558 11:126384677-126384699 GGGAGGGGGAGGAGGCCCCTAGG - Intronic
1090645549 11:128764438-128764460 GGGAGGTGGCGGTGGCCCCAAGG - Intronic
1202808024 11_KI270721v1_random:15220-15242 GGGAAGGGGTGGAGGGCCCTCGG + Intergenic
1091495610 12:970073-970095 CGGAGGTGGTGGATCACCTGAGG + Intronic
1092106758 12:5926780-5926802 GGGAGGAGGTGCAGGCCACGAGG + Intronic
1094523864 12:31219150-31219172 GGCAGGTGGAGGAGGAGCGGTGG + Intergenic
1095098091 12:38158564-38158586 GGGAGGTTGAGGCGGCCCCGGGG + Intergenic
1096137115 12:49211769-49211791 CCGAGGTGGTGGATGACCTGAGG + Intronic
1096258159 12:50075169-50075191 GGGAGGGGGTGGAGGACTGAGGG - Intronic
1096487635 12:51994442-51994464 GGGAGGGGCCGGAGGAACCGAGG + Intronic
1096513723 12:52145430-52145452 GGGCGGTGGTGCAGGACCCCTGG - Intergenic
1096541426 12:52309497-52309519 AGAGGGTGGTGGAGGACCCTTGG - Intergenic
1097147287 12:56950603-56950625 GGGATATGGTGGGGGACCTGAGG + Intergenic
1100260730 12:92929601-92929623 GGGAGGCGGGCGAGGACCCCTGG + Intergenic
1101125623 12:101630783-101630805 GTGAGCTGGAGGAGGACCTGAGG + Intronic
1101504258 12:105331266-105331288 GGGAGGTGGGGGAGCGGCCGGGG - Intronic
1102998316 12:117366273-117366295 TGGAGGTGTTGGAAGACCCATGG + Intronic
1103080946 12:118023484-118023506 GGGAGGTGGAGGAGGAGAGGTGG + Intronic
1103328000 12:120134433-120134455 GGGTGGTGGTGGAGGCACCCAGG - Intronic
1103563747 12:121805238-121805260 GGGAGGTGGGGGAGGGACGGCGG - Intronic
1103719534 12:122966000-122966022 GGGAGGTGTTGGAGGATCCTGGG - Intronic
1103908033 12:124337164-124337186 AGGAGGTGGAGGTGGACCTGGGG + Exonic
1103921693 12:124402653-124402675 GGGAGGAGGAGGAAAACCCGTGG + Intronic
1104063301 12:125285841-125285863 GGGAGGTAGAGGAGAACCTGGGG + Intronic
1104165963 12:126230034-126230056 GGGAGTAGGGGGAGGACCGGTGG + Intergenic
1105322669 13:19343897-19343919 GGGAGGGGGTGGGGGGCCAGGGG + Intergenic
1109476584 13:62887122-62887144 TGGTGGTGGTGCAGGACCAGTGG + Intergenic
1111445845 13:88345455-88345477 GGGAGGTGGCGGGGGGCGCGGGG + Intergenic
1111950168 13:94703501-94703523 AGGAGGCGGCGGAGGACCCCAGG - Intergenic
1113933365 13:113980389-113980411 GGGAGGAGGTGGTGCACACGTGG - Intronic
1115155071 14:30329487-30329509 GGGTGGGGATGGGGGACCCGGGG - Intergenic
1117156835 14:52950666-52950688 GGGAGGTGGTGGAGGACCCGGGG + Intronic
1118320503 14:64749594-64749616 GGGGGTAGGTGGAGGACCCCAGG - Exonic
1118655237 14:67940304-67940326 GGCAGGTGGTGGATCACCTGAGG - Intronic
1119276295 14:73359688-73359710 GGGAGGTGGTGGAGGCAATGGGG + Intronic
1121117008 14:91350960-91350982 GGTAGGTAGTGGTGGACCCGGGG - Intronic
1121333002 14:93059796-93059818 TGGAGGGGGTGGGGGTCCCGAGG + Intronic
1121359796 14:93246116-93246138 GGGAGGTGGTGGAGGGGGCAAGG + Exonic
1121406145 14:93720453-93720475 GGGAGATGATGGAGGACTCTGGG + Exonic
1121516049 14:94550517-94550539 AGGAGGTGATGGAGGCCCAGGGG - Intergenic
1121612662 14:95292421-95292443 GGGTGGGGGTGGGGGACCCTTGG - Intronic
1121886221 14:97545445-97545467 GGGAGGTGGGGGAGGACTTAAGG + Intergenic
1122329916 14:100904972-100904994 GGGAGGTGGGTGTGGACCTGGGG + Intergenic
1122601878 14:102925558-102925580 GGGAGCTGATGGGGGACCTGTGG + Intronic
1122657961 14:103274346-103274368 GTGGGGTGGCGGGGGACCCGCGG - Intergenic
1122721314 14:103724087-103724109 GTGGGGTGATGGAGGATCCGTGG + Intronic
1123630402 15:22256972-22256994 GCGAGCTGGTGGAGTAGCCGCGG + Intergenic
1124563309 15:30794505-30794527 AGGAGGTGGAGGAGGAGTCGGGG - Intergenic
1124781721 15:32642333-32642355 GGGAGGGGGTGGATCACCTGAGG + Intronic
1125603485 15:40927843-40927865 TGGTGGTGGTGGAGGACTGGGGG - Intergenic
1126206632 15:46053140-46053162 GGGAGGAGGTGGGGGACAGGAGG + Intergenic
1127673885 15:61222143-61222165 TGTAGGTGGTGGAGGACTCCAGG - Intronic
1127994354 15:64144454-64144476 TGCAGGTGGTGGAGGACACCAGG - Intronic
1128142466 15:65311887-65311909 CGGAGGAGGTGGAAGTCCCGTGG - Intergenic
1128568145 15:68714669-68714691 AGGAGGTGGGGGAGGGCCCGGGG + Intronic
1129904899 15:79179602-79179624 GGGAGGTCGAGGAGGACTTGAGG - Intergenic
1129924274 15:79348943-79348965 TGGGGGTGGGGGAGGGCCCGAGG - Intronic
1130224348 15:82046059-82046081 GGGAGGGAGTGGAGGAGCCGGGG - Exonic
1130229667 15:82087010-82087032 AGGAGGTGGAGGAGGATCCAGGG + Intergenic
1131133175 15:89912896-89912918 GGGAAGTGCTGCAGGACGCGCGG + Exonic
1131550197 15:93350706-93350728 AGGAGGTGGGGGAGGAACTGAGG - Intergenic
1131566583 15:93491456-93491478 AGAAGGTGGTGGAGGATCAGAGG + Intergenic
1132071140 15:98777414-98777436 GGGAGGTGGTGAGGGGCCCGGGG + Intronic
1132411075 15:101578625-101578647 GGGAGGGGGCGGAGGATCAGCGG + Intergenic
1132788798 16:1673439-1673461 GGGAGGTGGGGTAAAACCCGAGG - Intronic
1132875682 16:2135907-2135929 GGGAGGAGGAGGAGGAGCCGCGG - Intergenic
1132896240 16:2230627-2230649 AAGAGGGGGTGGAGGAGCCGTGG + Intronic
1132910561 16:2308625-2308647 TGCAGGTGTTGGAAGACCCGGGG + Intronic
1132936245 16:2482804-2482826 GGGCGGTGGAGGAGCAGCCGCGG + Intronic
1133007767 16:2894311-2894333 GGGAGGCGCTAGAGGACCCGGGG + Intronic
1133102133 16:3486030-3486052 GGGAGGGCGGGGAGGACCCAAGG - Exonic
1133103598 16:3493656-3493678 GGGAGGAGGAGGAGGTTCCGAGG - Exonic
1133130283 16:3672524-3672546 GGGAGGTGGGGCAGCTCCCGGGG + Intronic
1133320212 16:4909077-4909099 GGCAGGAGGTGGAGGCCCAGGGG + Intronic
1134519303 16:14911446-14911468 GGGAGGAGGAGGAGGAGCCGCGG + Intronic
1134612189 16:15618315-15618337 GGGAGGTGGAAGAGGACCAGGGG - Intronic
1134706973 16:16310101-16310123 GGGAGGAGGAGGAGGAGCCGCGG + Intergenic
1134960567 16:18402023-18402045 GGGAGGAGGAGGAGGAGCCGCGG - Intergenic
1136073128 16:27800740-27800762 GGGAGGTGGTGGGAGAAACGTGG + Intronic
1136229199 16:28877065-28877087 GGCAGCTGCTGGAGGAGCCGAGG - Intergenic
1136428315 16:30183640-30183662 GGAAGGAGCTGGAGGAGCCGGGG - Exonic
1136605578 16:31331283-31331305 GGGAGGGGGTGGGGGAGCAGCGG - Intronic
1136913022 16:34159630-34159652 CGGAGGCGGTGGGGGAGCCGCGG + Intergenic
1138105432 16:54285158-54285180 GGGGGGAGGAGGAGGACACGGGG - Exonic
1138248678 16:55485713-55485735 TGTAGGTGGTGGAGCACCAGAGG - Exonic
1138548725 16:57735676-57735698 GGCAGGAGGCGGAGCACCCGCGG + Intergenic
1138678906 16:58671223-58671245 GGGCGGTGGTGGAAGGCCTGTGG - Exonic
1139706005 16:68741074-68741096 GGGAGGTGGCGGGGGACCCTGGG + Intronic
1139740825 16:69033677-69033699 GGGAGGTCCTGGAGGCCCTGGGG + Intronic
1140150564 16:72359978-72360000 GGTAACTGGTGGAGGACCTGGGG - Intergenic
1140188737 16:72796553-72796575 GGGAGGTGGTGGTGGCTCTGGGG + Exonic
1141668865 16:85480949-85480971 AGGAGGGGGTGGAAGACCTGCGG - Intergenic
1142174053 16:88636878-88636900 AGGAGGTGCTGGAGGGCCCAGGG + Intergenic
1142433667 16:90043925-90043947 GGTAGGTGATGTAGGACCAGGGG + Exonic
1142496090 17:307033-307055 GGGAGGTGGGGGAGGCCCCCGGG - Intronic
1142982929 17:3681772-3681794 GGCAGGGGCTGGAGGGCCCGGGG - Intronic
1143188092 17:5022561-5022583 GGGCGGAGGTGGAGGACCTCCGG + Exonic
1143337817 17:6186684-6186706 GTGAGCTGGTGGAGGCCCCATGG - Intergenic
1143472953 17:7187311-7187333 GGGGGGGGGTGGATCACCCGAGG + Intergenic
1143502184 17:7345883-7345905 TGGGGGTGGTGGATCACCCGAGG - Intronic
1144523362 17:15969115-15969137 GGGAGGAGGTGGAGGATGCAGGG - Intronic
1144679134 17:17181256-17181278 AGGAGGTGGGGGAGGGCCCATGG + Intronic
1144698769 17:17323113-17323135 GGCAGGTGGTGAAGGCCTCGGGG + Intronic
1144757168 17:17686669-17686691 GAGTGGGGGTGGAGGACCTGGGG + Intronic
1147255662 17:39180030-39180052 GGGTGGTGGTGGATCACCTGAGG + Intronic
1147476976 17:40721593-40721615 GGGAGGTGGTGGTGGCAACGGGG - Intergenic
1147671462 17:42179247-42179269 GGGAGTTGGAGAAGGACCCCAGG + Intronic
1147909586 17:43847404-43847426 GGGAGGTGGGGGTGGCGCCGGGG + Intronic
1148218126 17:45845054-45845076 GGGGCGTGGTGCAGGTCCCGGGG - Exonic
1148342925 17:46884143-46884165 GGGAAGAGGTGGGGGTCCCGGGG - Intronic
1148450692 17:47775957-47775979 GGGAGGTGCTGGAGGAGCTTTGG + Intergenic
1148457737 17:47820061-47820083 GGGAGGTGGTGGAGGAGCCTCGG - Exonic
1148479809 17:47952715-47952737 GGGGGAGGGTGGAGGACCCTGGG + Exonic
1148805998 17:50264347-50264369 GGGAGGCAGTGGAGGAGCGGCGG - Intergenic
1149077043 17:52607824-52607846 CTGAGGTGGTGGATCACCCGAGG + Intergenic
1149601158 17:57893699-57893721 GGGAGGAGGAGGAGGAGCAGGGG + Intronic
1150315106 17:64162690-64162712 GGGAGGTGGAGGAAGGCCCAGGG + Intronic
1151054107 17:71012126-71012148 GGGCGGTGTTGGAGGCCCTGGGG + Intergenic
1151380251 17:73720705-73720727 GGGAGGAGGAGGAGGAGCAGGGG - Intergenic
1151557243 17:74852676-74852698 GGGAGCTGATGGAGGGGCCGAGG - Intronic
1151563254 17:74882288-74882310 AGGAGGAGGTACAGGACCCGAGG + Intronic
1151615167 17:75205411-75205433 GGGAGGGGCAGGAGGACCCCGGG - Intergenic
1151681953 17:75627022-75627044 GGGAGTGGGTGGAGGATCTGAGG + Exonic
1151731553 17:75914393-75914415 GGGAGGAGGTGGTGGAGCCAGGG + Intronic
1152083945 17:78205880-78205902 GGGAGGTGGGGCAGGACATGGGG - Intronic
1152556353 17:81055074-81055096 AGGAAGCGGTGGAGGAGCCGGGG - Intronic
1154210596 18:12376209-12376231 GGGTGGTGGTTGAGGTCCCCGGG - Intronic
1156625754 18:38906047-38906069 GGGAGGTGGTGGGGGAAAGGAGG - Intergenic
1158415401 18:57245943-57245965 GGGAGGTGGGGGAGGGCGAGAGG + Intergenic
1158509892 18:58080927-58080949 GGGAGGTGGTAGAGGGCTGGGGG + Intronic
1159043367 18:63345707-63345729 GGGAGGGGGTGGATCACCTGAGG + Intronic
1159095238 18:63894482-63894504 GGGAGGTGCTGCAGGACCAAGGG + Intronic
1159102950 18:63975355-63975377 ATGAGGTTGTGGAGGACCCCGGG + Intronic
1160006937 18:75074898-75074920 TGAGGGTGGTGGAGGTCCCGGGG + Intergenic
1160240514 18:77119303-77119325 GGGTGGTGATGGAGTACACGTGG - Intronic
1160309402 18:77775195-77775217 GGGAGGTGGTGTTGGACACCAGG - Intergenic
1160584616 18:79905397-79905419 GGAAGGTGGTGCAGGCCCCTCGG + Intronic
1160747657 19:719551-719573 GGCAGGTGCTGGGGGTCCCGGGG - Intronic
1160865565 19:1254451-1254473 GGCAGGTGGTGGAGGCTGCGTGG - Exonic
1160925065 19:1540382-1540404 GACAGGTGGTGGTGGACCCTGGG - Intergenic
1161380051 19:3960029-3960051 GGGAGGTGGGGGAGCTCCCTGGG - Intronic
1161556920 19:4948567-4948589 GGTAGGTGGTGGATCACCTGAGG + Intronic
1161594645 19:5144820-5144842 GGGAGCTGGTGGAGCTCCGGTGG + Exonic
1161619992 19:5292836-5292858 GGGAGGTGGGGGAGGAGAGGGGG + Intronic
1161663070 19:5559203-5559225 GGGAGCTGGTGGAGGAAGTGGGG - Intergenic
1161699026 19:5784986-5785008 GGTAGCGGGTTGAGGACCCGGGG - Intronic
1161816345 19:6502112-6502134 GGGAGGCAGTGGCGGCCCCGGGG - Intronic
1162134080 19:8544547-8544569 GGGAGGGGGTGGAGGAGTGGAGG + Intronic
1162396468 19:10420472-10420494 GGGACGGGGCGGAGGAGCCGGGG + Intronic
1162789145 19:13054118-13054140 GGGAACTGGGGGAGGACCCTGGG - Intronic
1162907296 19:13831456-13831478 AGGGGGTGGGGGAGGACCCTTGG - Exonic
1164507361 19:28870787-28870809 GGGAGGCGGGGGAGCACCTGAGG + Intergenic
1164769863 19:30800260-30800282 AGGAGCGGGTGGAGGAGCCGCGG + Intergenic
1164834554 19:31349281-31349303 GGGAGGGGGCGGCGGGCCCGCGG + Exonic
1165850868 19:38849723-38849745 CGGTGGCGGTGGAGGAGCCGGGG - Exonic
1165890114 19:39106898-39106920 CAGAGCAGGTGGAGGACCCGCGG - Intronic
1166212759 19:41317814-41317836 GCGAGGTGGGGGTGGACCTGAGG + Intronic
1166303246 19:41923777-41923799 GGGAGGTGGGGGTGGATCTGGGG + Intronic
1166361039 19:42253215-42253237 GGGAGGTGGTGGGGCCCCCCAGG - Intronic
1166378666 19:42343419-42343441 TGGAGGTGGTGGAGGGGCTGGGG + Intronic
1166713793 19:44953728-44953750 GGGATGGGGTGGAGGAGCTGAGG + Intronic
1166765653 19:45251277-45251299 GGGAGGCGGTGGAGGGGCTGGGG - Exonic
1167016824 19:46846408-46846430 AAGAGGTGGTGGAGGAGCCTGGG - Intronic
1167045279 19:47045806-47045828 GAGAGGGGGGTGAGGACCCGGGG - Intergenic
1167129048 19:47572705-47572727 GGGAGGTCGGGTAGGGCCCGCGG + Intergenic
1167464745 19:49644879-49644901 GGGAGGAGGTGGAGGAGAGGAGG + Intronic
1167650018 19:50723984-50724006 GGGAGATGGAGGAGGACCAGGGG + Exonic
1167682263 19:50931017-50931039 GGGAGGTAGTGCAGGATCTGGGG - Intergenic
1167742197 19:51330268-51330290 GGGAGGGGGTGGGGGGCCCTGGG + Exonic
1168089748 19:54074755-54074777 GGGAGGAAGTGGAGGAACAGAGG - Intronic
1168124811 19:54277507-54277529 GGGAGGTGGGCGGGGTCCCGGGG - Intronic
1168304867 19:55429802-55429824 GGGAGGTGAAGGAGCACCCCTGG + Exonic
1168329595 19:55559582-55559604 GGGAAGTGGTTGAGGACATGGGG + Intergenic
1168411068 19:56140863-56140885 GGGAGGAGGAGGAGGAGCCATGG - Intronic
924962192 2:45687-45709 CCGAGGTGGTGGAGGCCCTGGGG - Exonic
925018596 2:551390-551412 GGGAGGTGTTTCAGCACCCGGGG - Intergenic
925019217 2:555425-555447 GGGAGGTCGTGGAGGAGCAGAGG - Intergenic
925603237 2:5630085-5630107 GGGAGATGGTGCAGGAACAGTGG + Intergenic
925855286 2:8123637-8123659 GGGAGGCAGGGGAGGACCCTGGG + Intergenic
927809192 2:26172717-26172739 GGCGGGTGATGGAGGACCCCAGG - Intergenic
929107243 2:38377146-38377168 GGGAGGTCGTGGACGAGACGTGG + Exonic
929557451 2:42934454-42934476 GGGAGGTGGTGCCGGAACCAAGG - Intergenic
929818674 2:45256734-45256756 GGGAGGTGGTGGGGGAAGAGAGG + Intergenic
929966850 2:46542868-46542890 GGGAGGGGGCGGCGGGCCCGGGG - Exonic
929977496 2:46649271-46649293 GGGAGGTGGGGAATGACCTGAGG + Intergenic
930198283 2:48530109-48530131 AGGAGGGGGAGGAAGACCCGGGG - Intronic
931360900 2:61577159-61577181 GGGAGGTGGTGGATCACCTGAGG + Intergenic
932468443 2:71938830-71938852 GGGGTGTGGTGGAGCTCCCGTGG - Intergenic
932892446 2:75608871-75608893 GGGAGGAGGTCGAGCACCCTGGG + Intergenic
933341597 2:81033384-81033406 TGGTGGTGGTGGAGGACATGGGG - Intergenic
934082875 2:88484294-88484316 TGGTGATGGTGGAGGACCTGGGG - Intergenic
934176771 2:89584264-89584286 GGAAGGTGCTAGAGGCCCCGGGG - Intergenic
934287077 2:91658624-91658646 GGAAGGTGCTAGAGGCCCCGGGG - Intergenic
934503321 2:94874949-94874971 GTGAGGAGCTGGAGGACGCGCGG + Exonic
935590542 2:104843221-104843243 GCGGGGCGGTGGAGAACCCGCGG - Intergenic
935592026 2:104853265-104853287 GAGAGGGGGTGGAGGAGCCAGGG + Intergenic
935593506 2:104862489-104862511 CGGAGGGGGAGGGGGACCCGAGG + Intergenic
937198642 2:120182168-120182190 GGGAGATGGTCAGGGACCCGGGG - Intergenic
937296665 2:120813645-120813667 GGGTGGTGGTGGGGGACCTGGGG - Intronic
937452390 2:122012349-122012371 GGGAGGTTCTGGAGAACCTGTGG - Intergenic
937644460 2:124250647-124250669 GGGAGCTGGAGGAGGAGCCTGGG + Intronic
938301111 2:130213650-130213672 GGGAGGGGGCGGCGGGCCCGGGG + Intergenic
939480840 2:142745258-142745280 AGGAGGTGGTGGAGTAGCTGAGG - Intergenic
941362240 2:164565357-164565379 GGGAGTTGGTGGAGGTGCAGAGG + Intronic
941687949 2:168467034-168467056 GGAAGGTGGGGGAGGAATCGAGG - Intronic
942992717 2:182221108-182221130 AGGAGGTGGTGGAGGAAAGGAGG - Intronic
943470918 2:188292546-188292568 GGGAGGCGGTGGGGAAACCGTGG + Intronic
944432266 2:199646076-199646098 GGGAGGAGGTGGAGGTCACCTGG - Intergenic
945613294 2:212033274-212033296 TGAAGGTAGTGGAGGACCCTTGG + Intronic
945639154 2:212400310-212400332 GGGAGGTGGTGAAGCACCTAGGG + Intronic
946391103 2:219417589-219417611 GGGAGGGGGCGGGGGACCCAGGG + Intergenic
946865314 2:224037222-224037244 GGGAGATGGGGGAGGACGTGAGG + Intronic
947536754 2:230944431-230944453 GGAGGGAGGTGGAGGAGCCGTGG + Intronic
947565532 2:231190693-231190715 GGGAGGTGGGGGTGCACCTGGGG + Intergenic
947938827 2:234030904-234030926 GGGAGCTGCTGTAGGACCCATGG + Intergenic
948381041 2:237550215-237550237 GGGAGGCGGTGGAGAGCCCCGGG - Intronic
948465778 2:238150993-238151015 GGAAGACGGTGGAGGCCCCGTGG - Exonic
948615921 2:239198852-239198874 GGGAAGTGGTGGATGAGCAGAGG - Intronic
948666571 2:239538447-239538469 GGGAGTTGGTTGAGGATCAGGGG - Intergenic
948760310 2:240186166-240186188 GGGAGTTGGTGGAGGAGAAGCGG + Intergenic
948862591 2:240760159-240760181 GGAAGGTGGAGGAGGAGCTGAGG - Intronic
948883196 2:240870701-240870723 TGGAGGAGGTAGGGGACCCGGGG + Exonic
1169780632 20:9306337-9306359 GGGAGGGGGTGGATCACCTGAGG - Intronic
1171988271 20:31675922-31675944 GGGAGGAGGTGGAGGAGGAGAGG - Intronic
1172136676 20:32690883-32690905 GGGTGGAGATGGAGGTCCCGAGG + Intergenic
1172951338 20:38725030-38725052 GGGAGGTGGTGGCGAATTCGGGG + Exonic
1173346511 20:42205521-42205543 AAGAGGTGGTGGAGGATCCCAGG + Intronic
1173527884 20:43746822-43746844 GGGAGGTGGTGGAGGGAGAGAGG + Intergenic
1174549892 20:51354792-51354814 GGGGGGTGGTGGATCACCCCAGG - Intergenic
1175010645 20:55731360-55731382 GGTAGGTGGTGGATCACCTGAGG - Intergenic
1175262190 20:57681632-57681654 GGGAGGAGGTGGAGGGTACGTGG - Intronic
1175338237 20:58210333-58210355 GGGAGTTGGAGGAGTAACCGAGG + Intergenic
1175429278 20:58890991-58891013 GGGAGGGGGAGGAGGCCTCGGGG + Intronic
1175715624 20:61252793-61252815 GGGGCTCGGTGGAGGACCCGGGG + Intronic
1175741574 20:61423238-61423260 GGCAGGAGGTGGAGGAGCTGTGG + Intronic
1175782998 20:61695641-61695663 GGGACGTGCTGGAGGATCCAGGG - Intronic
1175963718 20:62649704-62649726 AGGAGGGGGTGGGAGACCCGGGG - Intronic
1176271264 20:64236261-64236283 TGGCGGTGGTGGGTGACCCGGGG + Intronic
1177712076 21:24790161-24790183 GGGTGGTGGTGGATGACCTGAGG - Intergenic
1178680767 21:34670380-34670402 CGGAGGAGGCGGAGGTCCCGGGG + Exonic
1179434431 21:41350526-41350548 GGCTGGTGGGGCAGGACCCGGGG - Intronic
1179486013 21:41711198-41711220 GGGAGGTGGTGGAGTCACAGTGG - Intergenic
1179629008 21:42665423-42665445 GGGTGGGGGAGGAGGACCAGAGG - Intronic
1179761443 21:43532335-43532357 AGGAGGTGGTGGAGGAGGAGAGG - Intronic
1180041678 21:45283335-45283357 GGGAGGTGGGGGGGCACCTGCGG + Intronic
1180083126 21:45495500-45495522 GGGAGGAGCTGCAGGACCCCAGG - Intronic
1180614601 22:17119493-17119515 CGGAGGTGGTGGAGGGGCGGAGG + Exonic
1181359540 22:22323791-22323813 GGGAGGTGGTGGAGGTGTCTGGG + Intergenic
1181369620 22:22405535-22405557 GGGAGGTGGTGGAGGTGTCTGGG + Intergenic
1181958382 22:26604929-26604951 GGGAGGTGGTGGTGGAGACCAGG - Intronic
1182320260 22:29474231-29474253 GTGAGGTGGTGGAGGGGCTGTGG - Intergenic
1182511944 22:30826160-30826182 GGGAATTGATGGAGGACACGGGG + Intronic
1182522781 22:30893583-30893605 GGGAGGGGGTGCATGGCCCGGGG + Intronic
1183256670 22:36766776-36766798 GGGAGCTTGTGGGGGAGCCGAGG - Intronic
1183380101 22:37486365-37486387 GGGAGCAGGTGGAGGACTGGCGG - Exonic
1183697486 22:39431435-39431457 GGGAGGGCGTGGAGAATCCGGGG - Exonic
1184252363 22:43268044-43268066 GGGAGCTGGAGGAGGCCCGGGGG - Intronic
1184433672 22:44456896-44456918 GGGAGGTGGTGGAGGCCTCAGGG + Intergenic
1184531889 22:45061540-45061562 GGGAGGCAGTGGAGGAGCCCCGG - Intergenic
1184551944 22:45209278-45209300 CGGTGGAGGTGGGGGACCCGCGG - Intronic
1184707257 22:46223228-46223250 GGGAGGTGCAGGAGGACTCCAGG - Intronic
1185080695 22:48707975-48707997 GGGAGGTGGGGGAGGAGACAGGG - Intronic
1185266487 22:49906846-49906868 GGGTGCTGGGGAAGGACCCGGGG - Intronic
1185282994 22:49983636-49983658 GGGAGGAGGGGGCGGGCCCGGGG - Intergenic
1185388964 22:50548741-50548763 GGGGGGTGGTGGAGGGGCCCCGG + Exonic
949248922 3:1959204-1959226 GGGAGGAGCTGGAGGAGCTGAGG + Intergenic
949930804 3:9077107-9077129 GGGAGGGGGTGGGGGACTGGGGG - Intronic
950548043 3:13650474-13650496 GTGAGGTGGTGGGGGAGCAGCGG + Intergenic
952080433 3:29751830-29751852 GTGAGCTGGTGCAGGAGCCGGGG + Intronic
952316766 3:32238673-32238695 GGAAGGCGGTGGAGGCCCGGAGG - Exonic
953103110 3:39849470-39849492 GGGATGTGATGGATGACCTGGGG + Intronic
953362109 3:42306626-42306648 GGGAGGCGGTGGAGTACTGGGGG + Intergenic
953628124 3:44587656-44587678 GGGTGGTGATGGAGGAGCTGAGG - Intronic
954145853 3:48633985-48634007 GGCAGCTGGAGGAGGACCTGGGG - Intronic
954149560 3:48650642-48650664 GGGGGGTGGTGGAGGGGCAGTGG - Intronic
954215134 3:49120516-49120538 GAGAGGTGGTGGCGGGCTCGGGG - Intronic
954450895 3:50571150-50571172 GGGAGGAGGGGAAGTACCCGGGG + Exonic
954459243 3:50617114-50617136 GGGAGGGGGGGGAGGTCACGTGG + Intronic
954983396 3:54767066-54767088 GGGAGGTGGTGCAGGGCTTGGGG + Intronic
955060693 3:55489419-55489441 TGGAGGTGGGGGAGGACTGGAGG - Intronic
959155753 3:102664345-102664367 GTGAGCAGGTGGAGGAGCCGGGG - Intergenic
961099418 3:124185933-124185955 GGGAGATGGAGGAAGACCTGTGG + Intronic
961335785 3:126179151-126179173 GGGAGGAGGTGGAGGCCTGGAGG - Intronic
961417030 3:126766754-126766776 GGGAGGTGTTGGTGGCCCCCTGG + Intronic
961651143 3:128417271-128417293 GGGAGGTCGTGCAGGGCCTGGGG - Intergenic
961677502 3:128576654-128576676 AGGAGGTGGAGGAGAACCCAGGG + Intergenic
962277995 3:134030146-134030168 GGAAGGAGGTGGCGGGCCCGGGG + Intronic
962315464 3:134356825-134356847 GGCTGGTGGTGGGGGTCCCGTGG + Exonic
962591539 3:136894497-136894519 GGTATGTGGTGTAGGACCAGTGG + Intronic
963337748 3:143996603-143996625 AGGAGGTGGTGGAGGGACCAGGG + Intronic
964289836 3:155165468-155165490 GAGAGGTGGGAGAGGACCCTGGG + Intronic
964732057 3:159878007-159878029 TGGAGGTGGTGGGAGATCCGTGG - Intronic
964741561 3:159971547-159971569 TGGAGTTGCTGGAGGACCCTGGG + Intergenic
966818226 3:183906170-183906192 GGGAGGTGGCAGAGGGCCCAGGG + Intergenic
968222169 3:196947470-196947492 GGGAGGTGTAGGAGGTGCCGGGG + Exonic
968539189 4:1154353-1154375 GGGAGGTGGGTGTGGACCTGTGG + Intergenic
968546426 4:1201170-1201192 GGGAGGGGCTGGAGGAACTGGGG - Intronic
968586457 4:1418981-1419003 GGGAGGTGGAGGAGGAGACATGG - Intergenic
968962054 4:3750631-3750653 GTGAGCTGCTGGAGGACCCACGG + Intergenic
968972501 4:3803355-3803377 GGGAGGTGGAGCAGGACCAAGGG + Intergenic
969016670 4:4107928-4107950 TGGAGGTGGTGGGAAACCCGAGG + Intergenic
969553863 4:7892831-7892853 GGGATGTGGTGGGGGAGCAGCGG + Intronic
970506710 4:16738269-16738291 GGGAGGTGGGTGAGGAGCAGCGG - Intronic
972714592 4:41632895-41632917 GGGAGGTGAAGGAGGACAGGTGG + Intronic
978212839 4:106158308-106158330 GGGAGGTTGTGGATCACCTGAGG + Intronic
978520527 4:109610348-109610370 TGGAGGTTGGGGAGGATCCGTGG + Intronic
978749617 4:112232052-112232074 GGGAGGAGGAGGAGGAGCGGCGG + Exonic
979831925 4:125315141-125315163 GGGAGGTGGAGAAGGGCTCGCGG + Intergenic
980133572 4:128839292-128839314 GGGAGGGGGTTGTGAACCCGAGG - Intronic
982722927 4:158877931-158877953 GGGGGGTGGGGGAGGAGACGGGG - Intronic
982984769 4:162193188-162193210 AGGAGGGGGTGGATCACCCGAGG + Intergenic
984467909 4:180124743-180124765 GGGATGTCTTGGAGGACCAGGGG - Intergenic
984682348 4:182624573-182624595 GGGAGCAGGTGGAGAACCTGAGG - Intronic
985535796 5:465136-465158 GCGTGGTGGTGGAGTACCTGCGG + Exonic
985572431 5:655608-655630 GTGGGGTGGTGGAGGGCGCGGGG + Intronic
985636456 5:1038113-1038135 GGGAGGTGGTGGCCGTCCTGAGG - Exonic
985670815 5:1205679-1205701 GGGAGAGGGTGGAGGACACTGGG + Intronic
985706904 5:1406558-1406580 GGGATGGGGAGGAGGACCCGAGG - Intronic
986171697 5:5319653-5319675 GGGAGGAGGAGGAGGAGCCTGGG - Exonic
988138450 5:27204339-27204361 GTCAGGGGGTGGAGGACTCGGGG + Intergenic
988954501 5:36301235-36301257 GTGGGCTGGTGAAGGACCCGGGG - Intronic
989241671 5:39209556-39209578 GGCAGGTGGTGGATCACCTGTGG - Intronic
991082488 5:62616054-62616076 GGGAGGTGGGGGAGGAAGGGGGG + Intronic
991571671 5:68060986-68061008 GGGAGGCGGTGGATCACCTGAGG - Intergenic
993919874 5:93788342-93788364 GGGAGGTGCGGGAGGGCCGGAGG + Intronic
994188026 5:96837527-96837549 GGTGGGTGGTGCAGGAGCCGAGG + Intronic
997854205 5:137358511-137358533 GGGAGGAGGTGGAGGAGTGGGGG + Intronic
997878088 5:137566852-137566874 GTGAGGTGGGGCAGGATCCGAGG + Intronic
997963248 5:138338307-138338329 GGTAGGTGGTGGAGGGCAGGTGG + Exonic
998093122 5:139382429-139382451 GGGAGGGGCTGGAGTCCCCGGGG + Intronic
998805725 5:145916100-145916122 GCGAGGAGGTGGAGGAAGCGGGG + Intergenic
1001325658 5:170721934-170721956 GGGAGGTGATGCAGAACCAGAGG - Intronic
1001510497 5:172317536-172317558 GAGAGGTGGTGGATCACCTGAGG + Intergenic
1002303758 5:178271875-178271897 TGTAGGTGGTGGAGGAGCAGAGG + Intronic
1002850889 6:995516-995538 GGGAGGAGGAGGAGGACGGGTGG + Intergenic
1004127395 6:12887030-12887052 AGGAGGGGGTGGAGGACAAGGGG - Intronic
1005901423 6:30220074-30220096 GGGGGGTGGTGGATCACCTGAGG - Intergenic
1006014516 6:31069147-31069169 GGGAGGTGGGGGTGACCCCGTGG - Intergenic
1006296175 6:33171054-33171076 GGGAGCTGAGGGAGGACCAGAGG + Intronic
1006342875 6:33456162-33456184 GTCAGGGGGTGGAGGACCTGGGG + Exonic
1006359654 6:33580061-33580083 GGGTGGAGATGGAGGTCCCGAGG + Exonic
1006434895 6:34020958-34020980 GGGAGGGGGTGCAGGACCCAGGG + Intronic
1006447057 6:34085471-34085493 GGCAGGAGGTGGAGGTCCCAGGG + Intronic
1006606139 6:35259328-35259350 AGGAGGTGGCGGAGGCCCCGAGG - Intronic
1007474069 6:42107387-42107409 GGGAGGTGGTGGGGGTGCTGTGG + Exonic
1007772514 6:44202803-44202825 GGGAGGTGGGGGAGGGGCAGTGG - Intergenic
1008648902 6:53544362-53544384 GGGAGGCGCTCGAGGACCCCCGG + Intronic
1010419951 6:75661817-75661839 GGCAGGTGGTGGATCACCTGAGG + Intronic
1012475139 6:99608757-99608779 GGGAGCTGGTGGACGAGTCGGGG + Exonic
1014821730 6:125996167-125996189 GGGTGGCGGTGGGGGACCAGAGG + Intronic
1015411958 6:132903814-132903836 GCGAGGTGGTGGATCACCTGAGG - Intergenic
1015790113 6:136957752-136957774 GGGCGGTGGTGGGGGAGCCTGGG - Intergenic
1015939168 6:138431543-138431565 AGGAGGAGGAGGAGGAGCCGGGG + Exonic
1017251517 6:152285138-152285160 GAGAGGTGGTGGAAGACAGGCGG - Intronic
1017618202 6:156267285-156267307 GGGAGGTGGGGGAGGGTCCTTGG - Intergenic
1019342646 7:515858-515880 GGGTGGGGGTGGAGGAGGCGGGG + Intronic
1019404785 7:877599-877621 GAGAGGTGGGGGAGGTCCAGGGG - Intronic
1019404831 7:877733-877755 GGGAGGTGGGGGAGGGGCGGTGG - Intronic
1019436016 7:1022549-1022571 AGGAGGTGGTGGAGGGCACGTGG - Intronic
1019614079 7:1951031-1951053 GGAAGGAGGAGGAGGACCTGTGG - Intronic
1019992721 7:4703291-4703313 GGAGGGAGGGGGAGGACCCGAGG + Intronic
1020007305 7:4789582-4789604 GGGAGTTGGCAGAGGAGCCGTGG + Intronic
1020183646 7:5942125-5942147 CGGAGGGGGTGGATCACCCGAGG - Intronic
1020189872 7:5987280-5987302 CGGAGGTGGAGAAGGACTCGGGG - Exonic
1020293051 7:6737394-6737416 CGGAGGTGGAGAAGGACTCGGGG + Intergenic
1021508476 7:21410430-21410452 GGGAGGTGTAGGTGGACCTGTGG + Intergenic
1021621121 7:22551986-22552008 GGGAGATGGTGGGGGATGCGGGG + Intronic
1021868657 7:24981773-24981795 GCGAGGTGGTTTAGGAACCGCGG - Intergenic
1022628720 7:32065053-32065075 GGGGGGGGGGGGAGGAGCCGGGG + Intronic
1022769502 7:33454110-33454132 AGGAGATGGGGGAGGACCAGAGG - Intronic
1022858826 7:34343833-34343855 GGAAGGTGGTGGAGGATGCGTGG + Intergenic
1023681964 7:42696305-42696327 GGGAGGAGGAGGAGGAACCAAGG + Intergenic
1023828903 7:44028123-44028145 GGGAGCTGGTGGGGGACCACAGG + Intergenic
1023838631 7:44082805-44082827 TGGAGGGGGTGGAGGAGGCGGGG + Intergenic
1023850219 7:44146151-44146173 GGGAGGAGGGGGAGGGCCCAAGG - Intronic
1023872052 7:44268622-44268644 GGCTGCTGGTGGAGGACCTGTGG - Intronic
1024006497 7:45228214-45228236 GGCAGGTGGAGGAGGCCCAGGGG + Intergenic
1024355250 7:48407788-48407810 CCGAGGTGGTGGATCACCCGAGG - Intronic
1024980379 7:55153164-55153186 GAGCAGTGGTGGAGGAGCCGAGG - Intronic
1026684050 7:72493147-72493169 GGGAGGTGGTGGGAGACCCGGGG - Intergenic
1026742249 7:72986179-72986201 GGCAGATGGGGGAGGGCCCGAGG - Intergenic
1027101486 7:75378899-75378921 GGCAGATGGGGGAGGGCCCGAGG + Intergenic
1027190820 7:75994624-75994646 GGGCGGTGGCGGAGGAGCCTCGG - Exonic
1027269769 7:76513053-76513075 GGGAGGTGGTGGGGGAGGAGGGG - Intronic
1027320480 7:77006948-77006970 GGGAGGTGGTGGGGGAGGAGGGG - Intergenic
1029206084 7:98870078-98870100 GGGAGGAGGAGGAGGGCGCGCGG - Intronic
1029466755 7:100730442-100730464 GGAAAGTGGGGGAGGACCCTTGG - Intergenic
1029487616 7:100852948-100852970 TGGGGGAGGAGGAGGACCCGGGG + Intronic
1029529781 7:101117616-101117638 GGGTGGGGGTGGAGGTCCCAGGG - Intergenic
1029739203 7:102482380-102482402 GGGAGCTGGTGGGGGACCACAGG + Intergenic
1029757204 7:102581559-102581581 GGGAGCTGGTGGGGGACCACAGG + Exonic
1029775144 7:102680620-102680642 GGGAGCTGGTGGGGGACCACAGG + Intergenic
1030033593 7:105389297-105389319 GAGAGGTGGTGCGAGACCCGCGG - Intronic
1030262540 7:107580422-107580444 GCGCGGTGGTCGAGGGCCCGCGG + Intronic
1030537683 7:110789689-110789711 GTGAGGTGGTGGAGGCTCAGAGG - Intronic
1031990207 7:128192662-128192684 GGGAGGAGGAGGAGGACAAGGGG - Intergenic
1032501605 7:132404088-132404110 TGGAGGTGCTTGGGGACCCGTGG - Intronic
1032710171 7:134454308-134454330 AGGAGGTGGTGGAGGACTCAAGG - Intronic
1033067037 7:138166006-138166028 GGGAGGGGGTGGATTACCTGAGG + Intergenic
1033597083 7:142865954-142865976 GGGAGCCGATGGAGGACCTGGGG - Exonic
1033899275 7:146116122-146116144 CGGAGGAGGAGGAGGAGCCGAGG + Intergenic
1034179571 7:149126754-149126776 GGTAGGTGGTGGGGGGCGCGCGG + Intronic
1034465640 7:151227000-151227022 GCGGGGTGGGGGAGGACCCGGGG - Intronic
1035122371 7:156579241-156579263 GGGAGGTGGTGGGGGGGCGGGGG + Intergenic
1035264591 7:157684320-157684342 GGGAGGCGGTGGAGCCGCCGCGG + Intronic
1035581209 8:739874-739896 GGGAGGCCGTGGAGGGACCGAGG + Intergenic
1036258406 8:7222362-7222384 TGGAGGTGGTGGGAAACCCGAGG + Intergenic
1036259466 8:7228506-7228528 TGGAGGTGGTGGGAAACCCGAGG + Intergenic
1036307159 8:7611018-7611040 TGGAGGTGGTGGGAAACCCGAGG - Intergenic
1036310459 8:7680958-7680980 TGGAGGTGGTGGGAAACCCGAGG + Intergenic
1036311508 8:7687076-7687098 TGGAGGTGGTGGGAAACCCGAGG + Intergenic
1036358002 8:8059005-8059027 TGGAGGTGGTGGGAAACCCGAGG - Intergenic
1036359075 8:8065147-8065169 TGGAGGTGGTGGGAAACCCGAGG - Intergenic
1036830351 8:12015480-12015502 TGGAGGTGGTGGGAAACCCGAGG + Exonic
1036891883 8:12601805-12601827 TGGAGGTGGTGGGAAACCCGAGG + Intergenic
1036892947 8:12607941-12607963 TGGAGGTGGTGGGAAACCCGAGG + Intergenic
1037815166 8:22108218-22108240 GGGAGGTGAAGGAGGAGGCGGGG - Exonic
1037818638 8:22125059-22125081 GGGAGGTGGGGGAGCTCCTGAGG - Intronic
1037899277 8:22678093-22678115 GGGAGCTGGAGGAGGACCATGGG + Intergenic
1038017919 8:23530237-23530259 AGGAGGTGGTGTAGGAGCCTGGG - Intronic
1038326912 8:26578720-26578742 GGGTGGGGGCGGAAGACCCGGGG - Intronic
1038660087 8:29489847-29489869 AGGAGGTGGAGGAGGAGCTGAGG - Intergenic
1038719420 8:30020356-30020378 GGGAGGTGGAGGAGGAGGCTGGG + Intergenic
1038797182 8:30720236-30720258 GGGAGGTTGTGGGGAACCAGAGG - Intronic
1039403690 8:37294672-37294694 GGGTGGTGGTGGAGAGCCTGTGG - Intergenic
1040452440 8:47561668-47561690 GGGAGATGGGGGAGGATCCCAGG - Intronic
1040466218 8:47697715-47697737 GGGGGGTGGTGCAGGACACGCGG - Intronic
1040484392 8:47856223-47856245 GGGGGGTGGTGGTGGAGCTGGGG + Intronic
1040663653 8:49604687-49604709 GGGAGGTGGTGGGGGGCCATAGG - Intergenic
1041099471 8:54381692-54381714 GGGAGGGGGTGGCGGACGAGGGG + Intergenic
1041177523 8:55211984-55212006 ATGAGGTGGTGGAGGCCCCAAGG + Intronic
1041711637 8:60899694-60899716 GGGACGGGGTGGGGGACCCAAGG + Intergenic
1044857713 8:96493717-96493739 AGGAGAAGGAGGAGGACCCGGGG + Exonic
1045500132 8:102738517-102738539 GGGAGGTGGAGGACGAAACGAGG + Intergenic
1045502108 8:102751441-102751463 GGGAGGGGGTGGATCACCTGAGG + Intergenic
1046109283 8:109702363-109702385 TGGAGGTGGTGGAGGTACAGTGG - Intergenic
1048889816 8:138937018-138937040 GGTGGGTGGTGGAGGACGTGGGG - Intergenic
1049199804 8:141334498-141334520 AGGAGGGTGTGGAGGACCCAAGG - Intergenic
1049644290 8:143729120-143729142 GGGAGATTGGGGAGGACCCGTGG - Intronic
1049705624 8:144040767-144040789 GGGAGGTGGTGGGGGAGGTGGGG - Exonic
1049718904 8:144106684-144106706 GGGAGGTGGGGGAGGAGGCGGGG - Intronic
1049808990 8:144554883-144554905 GGGAGGAACTGGAGGACCCGAGG - Intronic
1049827395 8:144678386-144678408 GAGAGGGGGTGGAGCACCTGAGG + Intergenic
1050684158 9:8147992-8148014 GGTAGGCGGTGGAGGGCCCCAGG - Intergenic
1053287269 9:36857981-36858003 GGGAGGTGGTGGAAAGCCCCTGG + Intronic
1053350412 9:37410329-37410351 GGGAGGGGGAGAAGGACCAGTGG + Intergenic
1053489440 9:38487994-38488016 GGTGGGTGGTGGAGGAGCGGCGG + Intergenic
1055514066 9:77019629-77019651 GGAGGGCGGTGGAGGAGCCGGGG + Intergenic
1057229122 9:93308323-93308345 GGCTGCTGGTGGAGGACCCTGGG - Exonic
1057704298 9:97386671-97386693 GGGGGGTGCTGGAGGAGCCCTGG + Intergenic
1059518357 9:114916532-114916554 TGGAGGTGGTGGTGGAACAGTGG + Intronic
1060113835 9:120925913-120925935 GTGAGGTGATGGAGGAGCGGAGG - Intronic
1060282016 9:122221288-122221310 GGGAGCTGGGGGAGGAGCCTCGG - Intronic
1060394028 9:123303191-123303213 GGGAGGTCTTGGAGGAACCTGGG + Intergenic
1060966340 9:127714317-127714339 GCGAGGTGCTGGGGGACCCCTGG + Intronic
1061130494 9:128705379-128705401 AGGAGGGGGTGGAGAACCTGCGG + Exonic
1061201480 9:129140803-129140825 GGGAGGTGGGGGAGGGGCTGGGG + Intronic
1061239335 9:129360164-129360186 GGTGGGTGGTGGAGGAGCAGGGG - Intergenic
1061291661 9:129653831-129653853 GTGGGAGGGTGGAGGACCCGAGG + Intergenic
1061491690 9:130948340-130948362 GGGAGGTGCTGGAGGTGCTGAGG + Intergenic
1061789372 9:133050953-133050975 GGAAGGTGGAGGAGGAGCTGAGG + Exonic
1061875347 9:133540806-133540828 GGGAGGCAGTGGCGGCCCCGGGG + Intronic
1062035243 9:134379957-134379979 GGGGGTTGGTGGAGGCCTCGGGG + Intronic
1062107894 9:134765712-134765734 GGGAGGTCCGGGAGGACCTGGGG - Exonic
1062383372 9:136298367-136298389 GGGAGGAGATGGAGAGCCCGAGG + Intronic
1062451761 9:136618717-136618739 GGGAAGTGGTGAAGAAGCCGAGG + Intergenic
1203772455 EBV:56488-56510 GGAAGGAGGAGGAGAACCCGAGG - Intergenic
1203564206 Un_KI270744v1:78813-78835 GTGAGGAGCTGGAGGACACGCGG + Intergenic
1185463167 X:341546-341568 GGGAGGAGGTGGAGGCCCCGTGG + Intronic
1185631042 X:1515948-1515970 GGGGGGTGGTGGATCACCTGAGG + Intronic
1185647251 X:1624487-1624509 GGGAGGTGGTGGCTGACCCCAGG + Intronic
1185647262 X:1624518-1624540 GGGAGGTGGGGGCTGACCCCAGG + Intronic
1185647313 X:1624673-1624695 GGGAGGTGGTGGCTGACCACAGG + Intronic
1185647322 X:1624704-1624726 GGGAGGTGGGGGCTGACCCCAGG + Intronic
1185647331 X:1624735-1624757 GGGAGGTGGTGGCTGACCACAGG + Intronic
1185647340 X:1624766-1624788 GGGAGGTGGGGGCTGACCCCAGG + Intronic
1185647381 X:1624890-1624912 GGGAGGTGGGGGCTGACCCCAGG + Intronic
1185647400 X:1624952-1624974 GGGAGGTGGGGGCTGACCCCAGG + Intronic
1186340983 X:8646018-8646040 GGGAGGGGGTGGATCACCTGAGG - Intronic
1186463352 X:9765628-9765650 GGGACGTCGCGGGGGACCCGGGG + Exonic
1187195330 X:17078005-17078027 TGGAGGTGGGGGAGGCCCAGAGG + Intronic
1189157553 X:38774079-38774101 GGAAGGTGGTGGAGGAGAGGTGG + Intergenic
1189390807 X:40575005-40575027 CGGAGGTGGTGGATCACCTGGGG + Intergenic
1190862345 X:54357294-54357316 GGGAGCTGATGGAAGACCAGGGG - Intronic
1192801135 X:74465812-74465834 GGGAGGTGGTGGAGGATATGGGG + Intronic
1193099996 X:77599456-77599478 GGGAGGTGGTGAAGGAAATGTGG - Exonic
1195133770 X:101882033-101882055 GGTAAGTGGTAGAGGACCAGAGG - Intergenic
1196061357 X:111411243-111411265 GGGAGGGGGTGGAGCACCTGGGG - Intronic
1198767287 X:140092188-140092210 GCGAGGTGGAGGAGGAGCGGGGG - Intergenic
1199508874 X:148597251-148597273 ATGAGGTGGTGGAGGAGCTGAGG + Intronic
1199650745 X:149944640-149944662 GAGAGGAGGTGGAGGACAGGAGG + Intergenic
1200258629 X:154599713-154599735 GGGCAGTGGTGGTGGACGCGGGG - Intergenic
1201349150 Y:13020219-13020241 GGGAGGGGGTGGATCACCTGAGG - Intergenic