ID: 1117156836

View in Genome Browser
Species Human (GRCh38)
Location 14:52950673-52950695
Sequence GGTGGAGGACCCGGGGCTTT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 263}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117156820_1117156836 15 Left 1117156820 14:52950635-52950657 CCCACCGAATTCGCAGCGCCGGC 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1117156836 14:52950673-52950695 GGTGGAGGACCCGGGGCTTTCGG 0: 1
1: 0
2: 2
3: 24
4: 263
1117156821_1117156836 14 Left 1117156821 14:52950636-52950658 CCACCGAATTCGCAGCGCCGGCC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1117156836 14:52950673-52950695 GGTGGAGGACCCGGGGCTTTCGG 0: 1
1: 0
2: 2
3: 24
4: 263
1117156831_1117156836 -7 Left 1117156831 14:52950657-52950679 CCACGGGCTGGGAGGTGGTGGAG 0: 1
1: 0
2: 8
3: 72
4: 552
Right 1117156836 14:52950673-52950695 GGTGGAGGACCCGGGGCTTTCGG 0: 1
1: 0
2: 2
3: 24
4: 263
1117156829_1117156836 -3 Left 1117156829 14:52950653-52950675 CCGGCCACGGGCTGGGAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 243
Right 1117156836 14:52950673-52950695 GGTGGAGGACCCGGGGCTTTCGG 0: 1
1: 0
2: 2
3: 24
4: 263
1117156822_1117156836 11 Left 1117156822 14:52950639-52950661 CCGAATTCGCAGCGCCGGCCACG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1117156836 14:52950673-52950695 GGTGGAGGACCCGGGGCTTTCGG 0: 1
1: 0
2: 2
3: 24
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117156836 Original CRISPR GGTGGAGGACCCGGGGCTTT CGG Intronic
900123311 1:1058788-1058810 GCTGGAGGCACCGGAGCTTTGGG + Intergenic
900269423 1:1779236-1779258 GCTGGAGGACTCGGGGAGTTGGG + Intronic
903576110 1:24340815-24340837 GGAGGAGGAGCTGGGGCCTTGGG + Intronic
904171403 1:28594062-28594084 GCTGGGGGACCTGGGGATTTGGG - Exonic
904737274 1:32644176-32644198 GGTGATAGATCCGGGGCTTTGGG + Intronic
905630102 1:39513839-39513861 GTTGGAGGTCCCAGGGCTCTGGG - Intronic
905667657 1:39772351-39772373 GTTGGAGGTCCCAGGGCTCTGGG + Intronic
907278023 1:53327685-53327707 GGTCCAGAACCCGGGGCTATCGG - Intronic
908930649 1:69312903-69312925 GGTGATAGACCCGGAGCTTTGGG + Intergenic
909672047 1:78200333-78200355 GGTGATAGACCTGGGGCTTTGGG - Intergenic
911611040 1:99959530-99959552 GGTGATAGACGCGGGGCTTTGGG - Intergenic
914430775 1:147619137-147619159 GGTGGAGGCGGAGGGGCTTTGGG - Exonic
915046550 1:153022192-153022214 GGGGGTAGACACGGGGCTTTGGG - Intergenic
920383254 1:205548298-205548320 GCTGGAGGAACAGGGGCTCTCGG - Intergenic
920695589 1:208179398-208179420 GGAGGTGCAGCCGGGGCTTTTGG + Intronic
922702436 1:227769712-227769734 GGTGGAGGGCCGGGGGCTGTAGG + Intronic
923638386 1:235724646-235724668 GGTGGAGTACCGAGGGTTTTTGG - Intronic
1062908891 10:1199507-1199529 TGTGGAGGGCCCGGGGCCCTGGG + Intronic
1063503758 10:6578906-6578928 GGTGGGGGACCCAGGACCTTAGG + Intronic
1063667446 10:8072297-8072319 GGTGGAGAACCCTTGGCTCTGGG - Intronic
1064742748 10:18449969-18449991 CGTGGAAGACCCGGGGCTGGCGG + Intronic
1065328400 10:24570044-24570066 GCTGAAGAACCCGGGGCTTAGGG + Intergenic
1067346799 10:45443464-45443486 GGAGGAGGACCCGGAGCTGCAGG + Exonic
1069041848 10:63704026-63704048 GGTGGAGGAGCTGTGGCTTCAGG + Intergenic
1071146838 10:82584867-82584889 GGTGAAGGACACAGTGCTTTTGG + Intronic
1072872049 10:99130752-99130774 GGTGACAGACCCGGGGCTTTGGG + Intronic
1072915454 10:99535070-99535092 AGAAGAGGACCCGGGGCTTCCGG - Exonic
1073137958 10:101230029-101230051 GGTGGAGGACCCCAGGGGTTGGG + Intergenic
1075969082 10:126637755-126637777 GGTGCAGGACCCAGGGCCTCGGG + Intronic
1076130957 10:128013598-128013620 GGTTGAGGAGGCGGGGCCTTGGG + Intronic
1076533420 10:131160430-131160452 GGTGTAGGGCCAGGGGCTTCAGG - Intronic
1076790224 10:132773079-132773101 GGTGGAGGCCTCTGGGCTGTGGG + Intronic
1076935583 10:133566195-133566217 GGAGGAGGAGCAGAGGCTTTCGG + Intronic
1077103889 11:833570-833592 GGTGCAGGTCCCGGGGACTTGGG + Intronic
1077445207 11:2587592-2587614 GGTGGAGGAGTCGGGGTTCTCGG - Exonic
1077593306 11:3509613-3509635 GGTGATAGACCCGGGGCTTTGGG + Intergenic
1080731314 11:34957471-34957493 GGTGGAGGACCTACGTCTTTGGG - Exonic
1081636974 11:44727571-44727593 GGTGGAGGAGTGGGGGCTTCTGG + Intronic
1081779002 11:45696904-45696926 GGAGGAGGCCCCGTGGCTTTCGG - Intergenic
1083801098 11:65046763-65046785 GGAGAAGAACCTGGGGCTTTGGG + Intronic
1084013050 11:66363312-66363334 GGTGGAGGCCCCTGGGCCTGAGG - Exonic
1084172108 11:67405736-67405758 GCTGGAGCACCTGGGGCTTGTGG - Intronic
1084249133 11:67882329-67882351 GGTGATAGACGCGGGGCTTTGGG + Intergenic
1084578162 11:70004112-70004134 GTGTGAGGACCTGGGGCTTTGGG - Intergenic
1084823675 11:71713141-71713163 GGTGATAGACGCGGGGCTTTGGG - Intergenic
1085519633 11:77130484-77130506 GGAGGAGGAGCTGGGGCTTTGGG + Intronic
1089080700 11:115774025-115774047 GCAGGAGGACCTGGTGCTTTCGG + Intergenic
1089712386 11:120325232-120325254 GGAGGAGGAGCCGGGGGTCTGGG - Intronic
1089852785 11:121514876-121514898 GGTGGAGGAGTTGGGGGTTTGGG + Intronic
1090157623 11:124458285-124458307 GGTGAAGAACCAGGGGCTGTGGG - Intergenic
1092125938 12:6075123-6075145 GGGGCAGGACACGGGGCTTTGGG + Intronic
1092141780 12:6189057-6189079 GGTGGAGGAGCAGGGACTCTGGG - Intergenic
1093474925 12:19544216-19544238 TGTGGAGGACGATGGGCTTTGGG + Intronic
1093742197 12:22701252-22701274 GGTGATAGACCCGGGGCTTTGGG + Intergenic
1094140821 12:27180557-27180579 GGTGAAAGACCACGGGCTTTGGG - Intergenic
1095887177 12:47201261-47201283 GGTGATAGACTCGGGGCTTTGGG + Intronic
1100560649 12:95746256-95746278 GGTGATAGACGCGGGGCTTTGGG - Intronic
1102519584 12:113470217-113470239 GGGGGAGGACCCAGGACTCTAGG + Intronic
1103582934 12:121929614-121929636 GGTGGAGGACAGGGGGTTTCAGG - Intronic
1103915643 12:124374338-124374360 TGTGGAGGACCGGGGACCTTGGG + Intronic
1103933350 12:124462350-124462372 GGTGCAGGACTGGGGGCTTGGGG - Intronic
1104812093 12:131625526-131625548 GGTGATAGACGCGGGGCTTTGGG - Intergenic
1104980980 12:132573023-132573045 CGTGGGGGACCCGGGCCTTACGG + Intronic
1109947936 13:69462599-69462621 GGTGATAGACGCGGGGCTTTGGG + Intergenic
1111015810 13:82380334-82380356 GGTGATAGACTCGGGGCTTTGGG - Intergenic
1112302222 13:98240559-98240581 GGTGGATGGTCTGGGGCTTTGGG + Intronic
1113275331 13:108722176-108722198 GGTGGAGGACCTGGTGGTGTTGG + Intronic
1113962218 13:114132462-114132484 GGTGGAGGACGAGGGGCTCCGGG - Exonic
1115320484 14:32075911-32075933 GGTAGAGCACACTGGGCTTTGGG - Intergenic
1115648302 14:35385197-35385219 GGTGGAGAAGGCGGGGCCTTTGG - Intergenic
1116003469 14:39267720-39267742 GGAGGAGGACCTGGGGCTCTGGG + Intronic
1116835754 14:49768026-49768048 GCTGGAGGACCCGGCGCTGGGGG + Exonic
1117156836 14:52950673-52950695 GGTGGAGGACCCGGGGCTTTCGG + Intronic
1120935577 14:89892389-89892411 GCTGGGGGACCTGGGGATTTGGG - Intronic
1121695481 14:95908843-95908865 GGGGAAGGACCCAGGGATTTGGG - Intergenic
1122302135 14:100737160-100737182 GGTGGAGGACCCAGGGGTTTGGG - Exonic
1122482441 14:102055727-102055749 GGAGGAGGAGCCAGGGCCTTGGG - Intergenic
1122483813 14:102064986-102065008 GGTGATAGACGCGGGGCTTTGGG - Intergenic
1125336653 15:38632831-38632853 GGTGGAGGACAGGGTGCTTCCGG - Intergenic
1129114588 15:73358164-73358186 GATAGAGGACCCAGGGCTCTGGG + Intronic
1130010915 15:80152676-80152698 TGTGGAGGACCTGGGGCTCGCGG + Intronic
1130923949 15:88371310-88371332 TGTGGAGAACCCGGGGCCTGTGG - Intergenic
1132052896 15:98625035-98625057 GGAGGAGGACAGGGGTCTTTGGG + Intergenic
1133063388 16:3189464-3189486 GGAGGAGGGGCCGGGGCTCTGGG + Intergenic
1133211259 16:4264470-4264492 GGTGCAGGCCCTGGGCCTTTGGG - Intronic
1133212551 16:4271661-4271683 GCTGGGGGACCCGACGCTTTCGG + Intronic
1134004588 16:10809756-10809778 GCAGGAGGAGCCTGGGCTTTAGG - Intronic
1134069545 16:11252346-11252368 GGTGCAGCTCCCAGGGCTTTAGG + Intronic
1135325602 16:21523588-21523610 GGTGGAGGACCCTGAGCCTCTGG + Intergenic
1135325617 16:21523650-21523672 GGTGGAGGACCCTGAGCTGCTGG + Intergenic
1135505073 16:23029319-23029341 GTTGAAGGACCATGGGCTTTGGG + Intergenic
1139421249 16:66850765-66850787 AGAGGAGCACCCGGGGCCTTTGG + Intronic
1139469020 16:67168602-67168624 GGTGGTGGAGCTGGGGCTTTGGG - Intronic
1139705118 16:68736080-68736102 GGTGGAGAAACTGAGGCTTTGGG + Intergenic
1141509868 16:84505140-84505162 GGAGGCGGACCCGAGGCTCTAGG - Intronic
1141628669 16:85275269-85275291 TGTGGAGGAACGGGGGCTATTGG - Intergenic
1141815143 16:86404674-86404696 GGGGGGGGGCCCGGGGCTATCGG - Intergenic
1142038625 16:87878292-87878314 GGTGGAGGACCCTGAGCTGCTGG + Intergenic
1142220090 16:88850039-88850061 GGTGGAGGGCAAGGAGCTTTGGG - Intronic
1142518757 17:490340-490362 GGTGGCGGTCCCGGGGCTGCCGG - Intergenic
1142667692 17:1471971-1471993 GGTGAAGTACCTGGGGCTGTTGG - Exonic
1142876271 17:2853608-2853630 GGTGGAGGACGCGGGGCACAGGG - Intronic
1143160022 17:4863520-4863542 GGTGGAAAACCCGGTCCTTTAGG + Intronic
1143471422 17:7178239-7178261 GGAGGTGGACCCGGGGGTGTGGG - Intronic
1143668861 17:8382957-8382979 GATGGAGGGACCGGGGATTTGGG - Exonic
1143729843 17:8875128-8875150 GGTGATAGACGCGGGGCTTTGGG + Intergenic
1144648375 17:16990728-16990750 GGGGGATGACCGGGGGCGTTGGG - Intergenic
1144874635 17:18390998-18391020 GGTGGAGGGCGCTGGCCTTTGGG - Intergenic
1145115363 17:20205065-20205087 GGTGGAGGACAGGGGCCTTGAGG - Exonic
1145157590 17:20553423-20553445 GGTGGAGGGCGCTGGCCTTTGGG + Intergenic
1145800003 17:27676780-27676802 GGTGGAGGATGCTGGCCTTTGGG + Intergenic
1148052501 17:44776023-44776045 GCTGGAGGGCCCGGGGATGTGGG + Intronic
1148106465 17:45121381-45121403 GCGGGAGGACCCGGGGCGTCAGG + Intronic
1148786671 17:50149199-50149221 CGTGGAGATCCCGGGGCTGTCGG - Exonic
1149848519 17:60021476-60021498 GGTGGAGGGCACTGGCCTTTGGG + Intergenic
1149861650 17:60125048-60125070 GGTGGAGGGCACTGGCCTTTGGG - Intergenic
1151479098 17:74359908-74359930 GGTGGAGGAGCCGGGGGCTGAGG + Intronic
1151980346 17:77504703-77504725 GGAGGAGGACCCGAAGATTTAGG - Intergenic
1152083373 17:78202619-78202641 GCTGGGGGTCCCGGGGCTTGGGG + Intronic
1152310617 17:79547738-79547760 GGGGGAGGACGCGGGACTTTAGG + Intergenic
1155053077 18:22165084-22165106 GGTGGAGGTCCCCGGGCTGCGGG - Intergenic
1157418799 18:47527560-47527582 GGTGGAGGAGATGGGGCTCTGGG + Intergenic
1157593161 18:48848258-48848280 GGTGGATGAGCCAGGGCTGTGGG - Intronic
1160837113 19:1129951-1129973 GGTGGAGGACCCTGGGCGGGAGG - Intronic
1160902426 19:1435025-1435047 GGGGGAGGGCGCGAGGCTTTTGG + Exonic
1161016833 19:1987438-1987460 GGTGGAGGACTCGGGGATGACGG - Intronic
1161030924 19:2057489-2057511 GGTGGGGGACCCGGGGGGTTAGG - Intergenic
1161480974 19:4510548-4510570 CAGGGAGGACACGGGGCTTTTGG - Exonic
1162078241 19:8203293-8203315 GGTGATAGACGCGGGGCTTTGGG + Intronic
1162490403 19:10987871-10987893 GGTCGAGGCCCCGCGGCTTCTGG - Exonic
1162821915 19:13228306-13228328 GGAGGAGGGCTAGGGGCTTTGGG + Intronic
1162971054 19:14181802-14181824 GCAGGATGACCCGGGGCTGTAGG - Intronic
1163535197 19:17872736-17872758 GGGGGAGGCGCTGGGGCTTTGGG + Intronic
1164219438 19:23180013-23180035 GGTGATAGACCCAGGGCTTTGGG + Intergenic
1165253906 19:34561103-34561125 GGTGATAGACGCGGGGCTTTGGG + Intergenic
1165282041 19:34805968-34805990 GGCCGAGGACCCTGGGCTTGGGG + Intergenic
1165475293 19:36026805-36026827 CGGGGAGGACCCTGGGCTTCAGG + Intronic
1165522417 19:36325142-36325164 GGTGATAGACGCGGGGCTTTTGG + Intergenic
1165523238 19:36330756-36330778 GGTGATAGACGCGGGGCTTTTGG + Intergenic
1165658584 19:37555011-37555033 GGTGATAGACCGGGGGCTTTGGG + Intronic
1165850865 19:38849716-38849738 GGTGGAGGAGCCGGGGCGGCGGG - Exonic
1166194931 19:41199186-41199208 GGTGTAGGACCCTGGGCATGGGG - Intronic
1167648928 19:50719376-50719398 GGTCGAGAACCTGGGGGTTTGGG - Intronic
1168043105 19:53774678-53774700 GGTGATAGACGCGGGGCTTTGGG + Intergenic
925278230 2:2665560-2665582 GATGGAGGACACGGGGCTCCTGG + Intergenic
925889548 2:8422347-8422369 GGAGGTGGTCCTGGGGCTTTGGG + Intergenic
927682015 2:25146024-25146046 GGTGGAGCACAGGGGGTTTTAGG - Intronic
930113355 2:47697738-47697760 GGTGATAGACGCGGGGCTTTGGG + Intronic
931457790 2:62425734-62425756 GTTGGAGGGTCCTGGGCTTTCGG + Intergenic
932435405 2:71700218-71700240 AGAGGTGGACCCGGGGCTTGTGG + Intergenic
934063964 2:88322265-88322287 GGAGGAGAACCCGGTGCTTCTGG - Intergenic
934475140 2:94588572-94588594 GGTGGAGGACAGGGGGCTGGAGG - Intronic
934852803 2:97712215-97712237 GGTGATAGACACGGGGCTTTGGG + Intergenic
934926230 2:98383471-98383493 GGTGGAGGGCACCGGGCTTGGGG - Intronic
936446988 2:112603955-112603977 GGTGGATGACCTGGGGATCTGGG - Intergenic
936491318 2:112975056-112975078 TGTGGAGGAGCAGAGGCTTTCGG + Intronic
937296663 2:120813638-120813660 GGTGGGGGACCTGGGGATCTGGG - Intronic
939969040 2:148639910-148639932 AGTGGAGATCCTGGGGCTTTGGG - Intergenic
940507791 2:154578014-154578036 GGTGATAGACCCGGGGCTTTGGG + Intergenic
944580299 2:201126310-201126332 GGTGATAGACGCGGGGCTTTGGG + Intronic
946355614 2:219182540-219182562 GGTGGAGCATCAGGGGGTTTTGG - Exonic
948738601 2:240027112-240027134 GATGATAGACCCGGGGCTTTGGG + Intergenic
1168771456 20:419402-419424 CCTGGGGGACCCCGGGCTTTGGG - Exonic
1172689029 20:36777902-36777924 GGAGGAGGAACTGGGGATTTAGG + Exonic
1174139176 20:48400758-48400780 GGAGGAGGAACCTGGGCCTTGGG + Intergenic
1175279556 20:57793991-57794013 GGTGGAGCAGCAGGGGGTTTGGG + Intergenic
1175486489 20:59350550-59350572 GGGGGAGGACCCAGGGCTCCAGG - Intergenic
1175702611 20:61151189-61151211 GGTTGGGGACCCGAGGCTTTGGG - Intergenic
1175824686 20:61930548-61930570 GGTGGGGGACCCTGTGGTTTGGG - Intronic
1179347851 21:40577814-40577836 GGTGATAGACTCGGGGCTTTGGG + Intronic
1179803727 21:43824402-43824424 GCTGGAAGACCCAGGGCCTTTGG - Intergenic
1180096445 21:45557426-45557448 TGTGCAGGACCCGGGGCTCAGGG - Intergenic
1180911639 22:19455017-19455039 GGTATAGGGCCAGGGGCTTTAGG + Intronic
1181432864 22:22893738-22893760 GGTGCTGGCCCCGGGGGTTTTGG + Exonic
1182353293 22:29710760-29710782 GGAGGAGGAAGCGGGGATTTAGG + Intergenic
1182688575 22:32140071-32140093 GGTGATAGACGCGGGGCTTTGGG + Intergenic
1183574885 22:38681854-38681876 ACTGGAGGACCCGGGGCTAGAGG + Intergenic
1184135654 22:42548092-42548114 GGTGATAGACGCGGGGCTTTGGG + Intergenic
1184820756 22:46907795-46907817 GGTGGAGGAGCTGCTGCTTTGGG + Intronic
1184993212 22:48184371-48184393 GCTGCAGGACCCTGGGCTTCGGG + Intergenic
1185192646 22:49448236-49448258 GGTGGGGCACTCGGGGCTTCAGG + Intronic
951527274 3:23665479-23665501 CGTGGAGGACCCTGGGCTGTGGG - Intergenic
953760896 3:45686085-45686107 GGTGATAGACCCGGGGCTTTGGG - Exonic
959064354 3:101641767-101641789 GGTGATAGACGCGGGGCTTTGGG - Intergenic
961237036 3:125375641-125375663 AGTGGAGGACTCGGGGATTCGGG + Intergenic
961289992 3:125839066-125839088 GGTGATAGACTCGGGGCTTTGGG - Intergenic
961897108 3:130176949-130176971 GGTGATAGACGCGGGGCTTTGGG + Intergenic
962024746 3:131536091-131536113 GGTGGGGGACGAGGGGGTTTAGG + Intronic
962378333 3:134876993-134877015 GGTGTAGGACCTGGGGCGTGTGG - Intronic
964612240 3:158627102-158627124 GGTGGGGGACCAGGGGTATTAGG + Intergenic
966763122 3:183434514-183434536 GGTGATAGACGCGGGGCTTTGGG + Intergenic
966896701 3:184450330-184450352 AGTGGAGGACCGTGGGCTTTTGG + Intronic
967193969 3:187010781-187010803 GGTGATAGACGCGGGGCTTTGGG - Intronic
967495064 3:190134001-190134023 GGTGATAGATCCGGGGCTTTGGG - Intergenic
967628269 3:191711560-191711582 GGTGATAGACGCGGGGCTTTGGG + Intergenic
968401546 4:303100-303122 GGTGATAGACGCGGGGCTTTTGG - Intronic
968483714 4:848887-848909 GGTGGAGGACCAGGGGCCCCTGG - Intergenic
968914775 4:3492616-3492638 GCTGTAGGCCCCGGGGCTTGGGG + Intronic
969007285 4:4030512-4030534 GGTGATAGACGCGGGGCTTTGGG + Intergenic
969313188 4:6366295-6366317 GGAGAAGGAGCCCGGGCTTTGGG - Intronic
969646027 4:8429451-8429473 GGTGATAGACGCGGGGCTTTGGG + Intronic
969746325 4:9075551-9075573 GGTGACAGACGCGGGGCTTTGGG - Intergenic
972327014 4:38026340-38026362 AGGGGAGGAGCCGTGGCTTTGGG + Intronic
973261498 4:48169229-48169251 GGTGGGTGACCCGGGGCTGGGGG - Intronic
984100062 4:175473629-175473651 GGTGATAGACCCGGGGCTTTGGG + Intergenic
985653102 5:1116090-1116112 GGTGGCGGATGTGGGGCTTTAGG - Intergenic
985888390 5:2697584-2697606 GGTGGCGGACATGGGGCGTTCGG + Intergenic
986004628 5:3657579-3657601 AGCTGAGGACCCGTGGCTTTGGG - Intergenic
986654459 5:9997389-9997411 GGTGGGGGACCTGGGACTCTTGG - Intergenic
987683311 5:21165191-21165213 GGTGATAGACTCGGGGCTTTGGG - Intergenic
989629659 5:43468245-43468267 GGTGAAAGACGCGGGGCTTTGGG + Intronic
994080837 5:95707599-95707621 GGTGATAGACCCGGGGCTTTGGG + Intergenic
998380058 5:141717873-141717895 GGGGGAGGAACAGGGGCTGTTGG + Intergenic
1002261286 5:177995489-177995511 GCTGGAGGGGCCAGGGCTTTGGG - Intronic
1002306168 5:178285163-178285185 GCTGGAGGACACGGGGCATAGGG - Intronic
1002423913 5:179164843-179164865 GGTGGAGGAAAGGGGGCTCTGGG - Intronic
1003076996 6:2990915-2990937 GGTGATGGACGCCGGGCTTTGGG - Intronic
1003911883 6:10750557-10750579 GGTGATGGACGCGGGGCTTTGGG + Intronic
1005561745 6:27047775-27047797 GGTGACAGACTCGGGGCTTTGGG + Intergenic
1006639072 6:35479756-35479778 GGAGGAGGCCCCGGGGCTACTGG - Intronic
1006743589 6:36325956-36325978 GATGAAGGACCTGAGGCTTTGGG - Intronic
1007072093 6:39045345-39045367 GGAGCAGGACCCGGAGCTCTGGG + Intergenic
1007152657 6:39709542-39709564 GGTGCATGGCCTGGGGCTTTGGG + Intronic
1011355896 6:86473263-86473285 GGTGATAGACACGGGGCTTTGGG - Intergenic
1012979034 6:105810771-105810793 GTTGGAGGATCTGGGGCTGTAGG + Intergenic
1013372655 6:109483524-109483546 GATGGCAGGCCCGGGGCTTTGGG + Intergenic
1016302988 6:142652535-142652557 GGTGGAGGACTCAGAGTTTTAGG + Intergenic
1018248428 6:161844019-161844041 GATGAAGGACCCGAGGCTTAAGG + Intronic
1019029834 6:169000523-169000545 CGGGGAGGAGCTGGGGCTTTGGG + Intergenic
1019337623 7:492788-492810 GGTGCAGGACCCGGAGCAGTTGG + Intergenic
1020022531 7:4877744-4877766 GGTGGCAGGCCCGGTGCTTTCGG - Exonic
1020210415 7:6154342-6154364 GGGGAAGGGCCTGGGGCTTTCGG - Exonic
1020979966 7:15054650-15054672 GGTGATAGACGCGGGGCTTTGGG - Intergenic
1026879583 7:73900251-73900273 GGTGGAGAATCCGGGCCTTGGGG + Intergenic
1027144345 7:75683635-75683657 GGTGGAGGACGTGGTGCTATGGG - Intronic
1029255272 7:99265422-99265444 GGTGGGGGACCTGGGGCCTCTGG + Intergenic
1033755321 7:144394324-144394346 AGTGGAGGGCCCGAGGCTTGGGG - Intergenic
1034237338 7:149582586-149582608 GGCGGAGGAGCTGGGGCTTGGGG - Intergenic
1034243951 7:149630470-149630492 GGTGGAGGAGCTGGGGTTTGGGG - Intergenic
1034736218 7:153431693-153431715 GGTGATAGACCCGGGGCTTTGGG - Intergenic
1035276662 7:157752093-157752115 TGTGGAGGAGCCTGGGGTTTGGG - Intronic
1035448050 7:158956469-158956491 GGTGCAGGCCCCGGCGCTTACGG - Intronic
1035458153 7:159022975-159022997 GGTGGAGGATGGGTGGCTTTTGG + Intergenic
1036368826 8:8145469-8145491 GGTGATAGACGCGGGGCTTTGGG - Intergenic
1036658328 8:10691862-10691884 GCTGGGGGACCCAGGGCTTGTGG - Intronic
1036882063 8:12520173-12520195 GGTGATAGACGCGGGGCTTTGGG + Intergenic
1037275303 8:17172071-17172093 GGTGATAGACGCGGGGCTTTGGG - Intronic
1037787373 8:21911034-21911056 GGTGGAGGTACCTGGCCTTTTGG - Intronic
1038640375 8:29319814-29319836 GGTGATAGACCCGGGGCTTTGGG - Intergenic
1038807889 8:30812137-30812159 GGTTCAGGGCCCGGGGCGTTGGG - Intronic
1039699142 8:39944627-39944649 GGTGATAGACTCGGGGCTTTGGG - Intronic
1040031978 8:42832997-42833019 GGTGATAGACACGGGGCTTTGGG + Intergenic
1040360276 8:46658488-46658510 TGTGGAGGCCCCGGAGCTTTTGG - Intergenic
1041226046 8:55699177-55699199 TTTGGAGCACCTGGGGCTTTGGG + Intronic
1042988143 8:74606150-74606172 GGTGATAGACGCGGGGCTTTGGG + Intronic
1044949007 8:97417705-97417727 TGTGCAGGACCTGGGGCTTCTGG - Intergenic
1044988955 8:97778620-97778642 GGTGACAGACGCGGGGCTTTGGG - Intronic
1045496646 8:102714945-102714967 GGTGGAGTCACCGGGGCTTCTGG - Intergenic
1046337460 8:112808609-112808631 GGTGATAGACGCGGGGCTTTGGG - Intronic
1047251476 8:123184575-123184597 GGTGGAGATCTCGGGGCATTGGG - Intronic
1048695162 8:137019493-137019515 GGTGATAGACGCGGGGCTTTGGG + Intergenic
1048720766 8:137321786-137321808 TGTGGAGGACTGGGGGCTGTGGG + Intergenic
1048788961 8:138082698-138082720 GGTGATAGACGCGGGGCTTTGGG - Intergenic
1049176317 8:141194698-141194720 GCTGGAGGCCCCGGGGCTCCAGG - Exonic
1049665688 8:143841489-143841511 GGGGGAAGACCCGGGGCATCTGG + Intergenic
1049719247 8:144108008-144108030 GGTCGAGGACCTGAGGCTGTAGG + Intronic
1051166983 9:14273333-14273355 AGTGGAAGACTCGGGGCTGTGGG + Intronic
1053682932 9:40497519-40497541 GGTGGAGGACAGGGGGCTGGAGG + Intergenic
1053932913 9:43125833-43125855 GGTGGAGGACAGGGGGCTGGAGG + Intergenic
1054280782 9:63127409-63127431 GGTGGAGGACAGGGGGCTGGAGG - Intergenic
1054296032 9:63333019-63333041 GGTGGAGGACAGGGGGCTGGAGG + Intergenic
1054394048 9:64637514-64637536 GGTGGAGGACAGGGGGCTGGAGG + Intergenic
1054501682 9:65878816-65878838 GGTGGAGGACAGGGGGCTGGAGG - Intronic
1056623188 9:88232447-88232469 GGTGGCTGACCTGGGGCTTCTGG + Intergenic
1057696083 9:97323879-97323901 GGAGGAGGACCTGGAGCTCTTGG + Exonic
1059674953 9:116529209-116529231 GATGGAGTACCCGAGGCCTTGGG + Intronic
1061009810 9:127948290-127948312 GGTGGAGGAACAGGGACTCTGGG - Intronic
1061307112 9:129738543-129738565 GGTGGAGGACCGGGAGCTTTGGG - Exonic
1062035244 9:134379964-134379986 GGTGGAGGCCTCGGGGCTGTCGG + Intronic
1062453898 9:136626853-136626875 GGTGGAGGTCACAGGGCTGTGGG + Intergenic
1062454642 9:136629751-136629773 GGCGGGGGACCTGGGGCATTGGG + Intergenic
1185772627 X:2776375-2776397 GGTGATAGACGCGGGGCTTTGGG + Intronic
1187083011 X:16011035-16011057 GGTGATAGACTCGGGGCTTTGGG + Intergenic
1191021617 X:55866771-55866793 GGTGATAGACTCGGGGCTTTGGG + Intergenic
1192206397 X:69099576-69099598 GGTGGAAGACCTGGGGATGTGGG + Intergenic
1192885008 X:75327830-75327852 GGAGGAGGACCCGGGCCTGGTGG - Intergenic
1193751176 X:85345982-85346004 AGTGGATGACCTGGGGCTGTTGG + Exonic
1195286066 X:103385300-103385322 GGTGATAGACGCGGGGCTTTGGG + Intergenic
1199874346 X:151919424-151919446 GGTGGAGGGGCCCGGGTTTTGGG - Intronic
1200786221 Y:7263222-7263244 GGTGATAGACACGGGGCTTTGGG - Intergenic