ID: 1117156839

View in Genome Browser
Species Human (GRCh38)
Location 14:52950684-52950706
Sequence CGGGGCTTTCGGCAGAAACT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 51}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117156820_1117156839 26 Left 1117156820 14:52950635-52950657 CCCACCGAATTCGCAGCGCCGGC 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1117156839 14:52950684-52950706 CGGGGCTTTCGGCAGAAACTCGG 0: 1
1: 0
2: 0
3: 5
4: 51
1117156822_1117156839 22 Left 1117156822 14:52950639-52950661 CCGAATTCGCAGCGCCGGCCACG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1117156839 14:52950684-52950706 CGGGGCTTTCGGCAGAAACTCGG 0: 1
1: 0
2: 0
3: 5
4: 51
1117156829_1117156839 8 Left 1117156829 14:52950653-52950675 CCGGCCACGGGCTGGGAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 243
Right 1117156839 14:52950684-52950706 CGGGGCTTTCGGCAGAAACTCGG 0: 1
1: 0
2: 0
3: 5
4: 51
1117156831_1117156839 4 Left 1117156831 14:52950657-52950679 CCACGGGCTGGGAGGTGGTGGAG 0: 1
1: 0
2: 8
3: 72
4: 552
Right 1117156839 14:52950684-52950706 CGGGGCTTTCGGCAGAAACTCGG 0: 1
1: 0
2: 0
3: 5
4: 51
1117156821_1117156839 25 Left 1117156821 14:52950636-52950658 CCACCGAATTCGCAGCGCCGGCC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1117156839 14:52950684-52950706 CGGGGCTTTCGGCAGAAACTCGG 0: 1
1: 0
2: 0
3: 5
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117156839 Original CRISPR CGGGGCTTTCGGCAGAAACT CGG Intronic
903498377 1:23787501-23787523 TGGGGCTTGCTGCAGAAACCTGG + Exonic
905592654 1:39177997-39178019 GGGGGATTTCCGCAGAATCTGGG + Intronic
905645027 1:39619314-39619336 CAGGGCTTTCAGCAAAATCTGGG - Intergenic
907179093 1:52553670-52553692 CGGGGGCCTCGGCAGAGACTAGG - Intergenic
907285215 1:53375723-53375745 CGGGGCCTTGGGCGGAAGCTGGG + Intergenic
909063937 1:70910264-70910286 TGTGGCTTTAGGCAGAAACTGGG - Intronic
916616452 1:166446264-166446286 CGGGGCTTTTGGGAGATATTGGG - Intergenic
920947123 1:210540053-210540075 CAGGACTTTAGGCAGAAATTAGG - Intronic
923550928 1:234962574-234962596 CAGTGCTTTCAGGAGAAACTTGG + Intergenic
1070969554 10:80552293-80552315 CTGGGCTTTTGGCAGCAGCTGGG - Intronic
1076633971 10:131870656-131870678 CGGGGCTTTCCCCAGATTCTGGG + Intergenic
1077043811 11:535698-535720 CGGGGCTTCCGGGAGCAACGCGG + Intronic
1085784220 11:79437449-79437471 CGGCGCTTGCGGCTGGAACTTGG + Intronic
1088433301 11:109782427-109782449 CTGGGCTTTAGGCAGAAAACTGG - Intergenic
1090866551 11:130705748-130705770 CGGGGCAGTTGGCAGAAACTTGG + Intronic
1100468887 12:94873330-94873352 CGGGGCTTTGGGCAGAATTCTGG + Intergenic
1102006993 12:109595454-109595476 CGGGGCTGTCCGCACAAGCTTGG + Intronic
1106911451 13:34467577-34467599 CGGAGCTTTCAGCAAAACCTTGG + Intergenic
1108056438 13:46489931-46489953 AGGGCATTTGGGCAGAAACTTGG - Intergenic
1117024715 14:51607810-51607832 CGTGGCACTCGGCAGAAACCGGG - Intronic
1117156839 14:52950684-52950706 CGGGGCTTTCGGCAGAAACTCGG + Intronic
1122817525 14:104320930-104320952 CGGGACTCTCGGCAGAGGCTGGG + Intergenic
1124707140 15:31975493-31975515 CGGGGCTGTCGCCAGCCACTGGG - Intergenic
1128710758 15:69869733-69869755 TGGGGCCATCAGCAGAAACTGGG + Intergenic
1134813222 16:17185025-17185047 CTTGGCTTTCTGCAGAACCTTGG + Intronic
1147875641 17:43618581-43618603 CAGGGCTTTGGGCAGAAATAGGG + Intergenic
1157483961 18:48073820-48073842 TAGGGCTTTGTGCAGAAACTCGG - Intronic
1160809457 19:1007166-1007188 CAGGGTTTTCGGGAGAAACAGGG + Intronic
1168056859 19:53869082-53869104 CGGGGCTTGCGGGAGCACCTGGG - Intronic
926035276 2:9631063-9631085 CGGGACTCTCGGGAGAAGCTCGG - Intergenic
931853944 2:66282006-66282028 AGGGGCTTTGGGCATAATCTAGG - Intergenic
946859548 2:223987738-223987760 AGGGGCTTTCTGGAAAAACTGGG - Intronic
947328309 2:229001726-229001748 TGGGGCTTTCGGCAGGTAATTGG + Intronic
1170898882 20:20440822-20440844 CGGGGCATTCTGAAGAAAGTGGG - Intronic
1178938951 21:36888945-36888967 TGGGGCTTTGGGCAGAAAGGAGG - Intronic
1179708010 21:43193738-43193760 CCGGGCGTTCAGCAGCAACTTGG + Intergenic
1184746809 22:46460985-46461007 AGGGGCTTTCAGCAGCCACTTGG + Intronic
953282765 3:41574968-41574990 CAGGGCTGTGGACAGAAACTGGG - Intronic
963441933 3:145351368-145351390 CTGGGCATTGTGCAGAAACTAGG - Intergenic
968258202 3:197298035-197298057 TGGGGCGTGCGGCAGCAACTGGG - Intronic
968914769 4:3492606-3492628 CGGGGCCTACAGCAGAAACCTGG - Intronic
970411886 4:15816873-15816895 AGGGGCTTTGGCCAAAAACTAGG + Intronic
989956700 5:50368540-50368562 CGGATCTCTCGGCAGAAACTAGG + Intergenic
994332779 5:98526844-98526866 AGGGGCTGTGGGCAGAAGCTGGG - Intergenic
995215665 5:109591714-109591736 CGGGGCTTTCAGCAAAGACTTGG + Intergenic
997773624 5:136577500-136577522 TGGGGCTCTAGGCAGAGACTAGG - Intergenic
999242539 5:150136263-150136285 CTGGGCCTTGGGCAGAACCTGGG - Intronic
1002171226 5:177375650-177375672 CGGGGATTTCTGCAGCATCTAGG - Intergenic
1002536972 5:179881148-179881170 GGCGGCTTTCGGCAGAAGCTTGG + Intronic
1004175524 6:13336619-13336641 CTGGTCTTGTGGCAGAAACTCGG + Intergenic
1012326603 6:97927464-97927486 TGGGGCTTTTGGCGGTAACTAGG - Intergenic
1029424266 7:100486640-100486662 AGGGGCTTCAGGCAGAATCTTGG - Intronic
1039690655 8:39861430-39861452 AGGGCCTTCCGGCAGTAACTAGG - Intergenic
1040683526 8:49842539-49842561 TGGGCCTTGCGGCAGCAACTTGG - Intergenic
1050552384 9:6758895-6758917 CGGGGCTGTAGGCAGGAGCTTGG + Intronic
1062166676 9:135111295-135111317 AGGGGATTTGGGCAGGAACTTGG + Intronic
1200268478 X:154659596-154659618 CAGGCCTTTCAGAAGAAACTGGG + Intergenic