ID: 1117156840

View in Genome Browser
Species Human (GRCh38)
Location 14:52950685-52950707
Sequence GGGGCTTTCGGCAGAAACTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 126}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117156829_1117156840 9 Left 1117156829 14:52950653-52950675 CCGGCCACGGGCTGGGAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 243
Right 1117156840 14:52950685-52950707 GGGGCTTTCGGCAGAAACTCGGG 0: 1
1: 0
2: 0
3: 6
4: 126
1117156822_1117156840 23 Left 1117156822 14:52950639-52950661 CCGAATTCGCAGCGCCGGCCACG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1117156840 14:52950685-52950707 GGGGCTTTCGGCAGAAACTCGGG 0: 1
1: 0
2: 0
3: 6
4: 126
1117156831_1117156840 5 Left 1117156831 14:52950657-52950679 CCACGGGCTGGGAGGTGGTGGAG 0: 1
1: 0
2: 8
3: 72
4: 552
Right 1117156840 14:52950685-52950707 GGGGCTTTCGGCAGAAACTCGGG 0: 1
1: 0
2: 0
3: 6
4: 126
1117156820_1117156840 27 Left 1117156820 14:52950635-52950657 CCCACCGAATTCGCAGCGCCGGC 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1117156840 14:52950685-52950707 GGGGCTTTCGGCAGAAACTCGGG 0: 1
1: 0
2: 0
3: 6
4: 126
1117156821_1117156840 26 Left 1117156821 14:52950636-52950658 CCACCGAATTCGCAGCGCCGGCC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1117156840 14:52950685-52950707 GGGGCTTTCGGCAGAAACTCGGG 0: 1
1: 0
2: 0
3: 6
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117156840 Original CRISPR GGGGCTTTCGGCAGAAACTC GGG Intronic
900168425 1:1254350-1254372 GGGGCCTTCTGCAGGGACTCCGG + Intronic
900513487 1:3070810-3070832 GGAGCGTCCGGCACAAACTCGGG - Intronic
900537890 1:3187799-3187821 GGGGCTTTAAGCTGACACTCAGG - Intronic
900643512 1:3698445-3698467 GGGGCCTCCCGCAGACACTCAGG + Intronic
902296717 1:15472670-15472692 TGAGGTTTCGGCAGAACCTCCGG - Intronic
909714963 1:78696917-78696939 GGAGCTTTTGGCAGAGACTATGG + Intergenic
917840593 1:178974296-178974318 GGGGCTGTCTTCAGGAACTCTGG + Intergenic
918515967 1:185363554-185363576 GAGCCTTTGGGCAGAAACTATGG - Intergenic
1063835206 10:10004324-10004346 GGGAATTTCAGCAGAACCTCTGG - Intergenic
1065059687 10:21886992-21887014 GGAGCTTTGGGCCGAAACTATGG - Intronic
1065857297 10:29840833-29840855 GGGGCTGTGGGCAGAAACCATGG + Intergenic
1066301563 10:34101804-34101826 GGTGCTTTCAGTAGAGACTCTGG - Intergenic
1067822377 10:49541237-49541259 GGGTCTTTAGGCAGCAAATCTGG - Intergenic
1068147706 10:53092309-53092331 GGGGCTTGGAGCAGAGACTCTGG + Intergenic
1069822237 10:71235200-71235222 GGGGCTGTCTGCAGATAATCAGG - Intronic
1071199444 10:83202403-83202425 GGGGCTTTTGCCTGAAACTATGG + Intergenic
1071571760 10:86701077-86701099 GGGGCTTTAGGGAGCATCTCAGG - Intronic
1071908315 10:90200218-90200240 TGGGCTTTGGGTAAAAACTCAGG - Intergenic
1074612811 10:115038126-115038148 GGGGCTTTGGGCAAAAATTATGG - Intergenic
1075263213 10:120980238-120980260 GGGGGTTTCTGCTGAAGCTCAGG + Intergenic
1075390220 10:122086282-122086304 GGGGCTTTCGCCAGGAGCTCTGG - Exonic
1075653458 10:124145483-124145505 GTGGCTATTGGCAGAAACGCTGG - Intergenic
1077043812 11:535699-535721 GGGGCTTCCGGGAGCAACGCGGG + Intronic
1077476797 11:2794298-2794320 GGGGCTCACAGCAGAAGCTCGGG - Intronic
1077865338 11:6217549-6217571 AGGGCTTTGGGCAGGAGCTCCGG - Exonic
1081805427 11:45887388-45887410 GGGGCCTTGGGAAGACACTCTGG - Intronic
1090217193 11:124979656-124979678 GGAGCTTTGGGCAGAGACTATGG + Intronic
1091566302 12:1650997-1651019 GAGGCTTTCAGCAGAATATCAGG + Intergenic
1092270471 12:7019039-7019061 TGGGCTTTCCGCTGAACCTCCGG - Intronic
1095826658 12:46536750-46536772 GGGGGTTGAGGCTGAAACTCAGG + Intergenic
1096574464 12:52544180-52544202 GGGGCCTTGGGCAGAGACCCAGG + Exonic
1096920406 12:55079119-55079141 GAGGCTTTTGGCAGATTCTCTGG - Intergenic
1096994842 12:55832048-55832070 GGGGCACGGGGCAGAAACTCAGG - Intergenic
1104902333 12:132196314-132196336 GGGGCTCTCGGCACAGAGTCAGG - Intergenic
1104970726 12:132529497-132529519 AGGGCTTTAGACAGAACCTCAGG - Intronic
1106680713 13:32004187-32004209 GGGGCTCCAGGCACAAACTCAGG - Intergenic
1107172893 13:37363913-37363935 GGGACTTTAGGGATAAACTCCGG - Intergenic
1108056437 13:46489930-46489952 GGGCATTTGGGCAGAAACTTGGG - Intergenic
1108329429 13:49370488-49370510 GAGGCTTTCTGCAGGAATTCTGG - Intronic
1109987522 13:70009481-70009503 GGGTTTTACGGCAGAAACTCAGG + Intronic
1111956083 13:94759861-94759883 GAGGCTTTGGGCAGAAGCTGTGG + Intergenic
1113785668 13:113000999-113001021 GGGATTTTCGGCTCAAACTCTGG + Intronic
1117156840 14:52950685-52950707 GGGGCTTTCGGCAGAAACTCGGG + Intronic
1122295321 14:100702204-100702226 GGGGTGTTCAGCAGCAACTCTGG + Intergenic
1123118750 14:105907346-105907368 GGGGTTTTTGTCTGAAACTCTGG + Intergenic
1123120977 14:105916961-105916983 GGGGTTTTTGTCTGAAACTCAGG + Intergenic
1123403692 15:20008537-20008559 GGGGTTTTTGTCTGAAACTCAGG + Intergenic
1123513029 15:21015183-21015205 GGGGTTTTTGTCTGAAACTCAGG + Intergenic
1125541088 15:40470712-40470734 GGGGGATTCGCCACAAACTCAGG - Intergenic
1128710759 15:69869734-69869756 GGGGCCATCAGCAGAAACTGGGG + Intergenic
1130371478 15:83288489-83288511 GGGGCTGTTGGCAGAAAGACAGG + Intergenic
1133423151 16:5664577-5664599 GGGTCCTGTGGCAGAAACTCTGG - Intergenic
1134350516 16:13433685-13433707 GAGGCTTTGGGTAAAAACTCTGG + Intergenic
1136467869 16:30457544-30457566 GAGGCTTTCTGCAAGAACTCAGG + Intergenic
1146905686 17:36616460-36616482 GGGGCTGTCGACGGAAAGTCTGG - Intergenic
1148633596 17:49130722-49130744 GGGGCTACAGGCAGAAACTATGG - Intergenic
1152839617 17:82558663-82558685 TGGGCTTTCTGCAGAAGTTCAGG + Intronic
1153610245 18:6877454-6877476 GGGGCTTCCTGCAGAAAATATGG + Intronic
1155618177 18:27745595-27745617 TGGGCTTTCTGCAGATATTCTGG - Intergenic
1157483960 18:48073819-48073841 AGGGCTTTGTGCAGAAACTCGGG - Intronic
1158213411 18:55074829-55074851 GGGGCATTCGGAAAGAACTCAGG + Intergenic
1160772633 19:839880-839902 GGGGCGTACGGCATAAACCCGGG - Intergenic
1161098857 19:2410266-2410288 GTGGCTTTCTGCAGCACCTCTGG - Exonic
1161420646 19:4174574-4174596 GGGGCTTTTTGTAGAAACTGTGG - Exonic
1161816937 19:6504978-6505000 AGGGCTTTCAGCAGCATCTCTGG - Intergenic
1163747337 19:19056206-19056228 GGGGCTTTCTGGTGAAACCCTGG + Intronic
1164644676 19:29849685-29849707 GGGCCTTTAGGAAGAAACTGAGG + Intergenic
1167381344 19:49139971-49139993 GGGGCTTTGTGCAGAGAATCTGG - Exonic
1168154059 19:54463486-54463508 GGGGCTTCCTGCGGCAACTCCGG + Exonic
934557375 2:95294590-95294612 GGGGCTGTGGGGAGAAACTGAGG - Intergenic
935410860 2:102760391-102760413 GCAGCTTTTGGCAGAAAATCAGG + Intronic
936255661 2:110908613-110908635 TGGGCTTTCCTCAGAAACTTAGG + Intronic
941609772 2:167646318-167646340 GGGGAGTTTGGCAGAAACCCTGG - Intergenic
942737843 2:179136384-179136406 GGGACTTTCTCAAGAAACTCAGG - Intronic
943391564 2:187275844-187275866 GGAGCTTTGGGCAGAGACTATGG + Intergenic
944868168 2:203882492-203882514 GGGGCATGCGCCAGCAACTCGGG + Intergenic
948903203 2:240966369-240966391 GGGACTTTGTGCAGAAGCTCCGG + Intronic
1170961622 20:21030303-21030325 GGGGCTTGAGCAAGAAACTCCGG + Intergenic
1174046183 20:47735581-47735603 GTGGCTTTCTGCAGAGGCTCAGG + Intronic
1175700738 20:61135208-61135230 GGGGCTTTCGCAAGTAACTGAGG + Intergenic
1178855346 21:36245853-36245875 GGAGCTTTCCGTAGAAACTCTGG - Exonic
1180214430 21:46315474-46315496 GGGACCTTCTGCAGAGACTCCGG - Exonic
1182587328 22:31352035-31352057 GGGGCTTTCAGCACAAATCCAGG + Intergenic
1183615200 22:38940175-38940197 GAGGCTTTCTCCAGAATCTCAGG + Intergenic
1184746810 22:46460986-46461008 GGGGCTTTCAGCAGCCACTTGGG + Intronic
950333886 3:12178395-12178417 GTGGCTTTCGGCAGACAAGCTGG - Intronic
950542367 3:13620166-13620188 TGGGGATTCGGCAGAATCTCAGG - Intronic
951268438 3:20597606-20597628 GGGGCTTGCTGCTGATACTCTGG + Intergenic
951345993 3:21547457-21547479 GGGGCTATCGTCAGACGCTCTGG - Intronic
957041705 3:75340960-75340982 GGTGCTTTCCCCAGAAACTTAGG - Intergenic
958460603 3:94389984-94390006 GAGGCTTTGGGCAGAGACTACGG - Intergenic
959751507 3:109841991-109842013 GGGCATTAAGGCAGAAACTCTGG + Intergenic
961317907 3:126052928-126052950 GGGGCTTTCAGCAGGAAGCCTGG + Intronic
963069042 3:141287367-141287389 GGGGCTTTCGAAAGAGGCTCCGG - Exonic
967461837 3:189756894-189756916 AGGGATTTCAGCAGAAACACAGG + Intronic
969879182 4:10158924-10158946 GGGGCTTTTTTCAAAAACTCAGG + Intergenic
973872477 4:55180192-55180214 AGGTCTTCCGGCAGAAACTGAGG - Intergenic
976075257 4:81290865-81290887 GGGGCTTTAGGCAAAAACAATGG - Intergenic
982658434 4:158177467-158177489 GGGGCTTTTTGAAGAAACCCAGG - Intergenic
985137626 4:186803007-186803029 GGTGGTTTCGGCATAAACCCCGG + Intergenic
986244505 5:5993939-5993961 GAGCCTTTAGGCAGAAACTATGG + Intergenic
990246525 5:53868633-53868655 TGGGCTTTGGTCAGAAACCCTGG + Intergenic
994381985 5:99082051-99082073 GAGGTTTTGGGCAGAAACTATGG + Intergenic
995215666 5:109591715-109591737 GGGGCTTTCAGCAAAGACTTGGG + Intergenic
997773623 5:136577499-136577521 GGGGCTCTAGGCAGAGACTAGGG - Intergenic
1000417516 5:160998316-160998338 GGCCCTTTGGGCAGAAACTGAGG - Intergenic
1003440639 6:6138223-6138245 GAGCCTTTAGGCAGAAGCTCAGG + Intergenic
1006577458 6:35056889-35056911 GGGGCTTTCCCCAGGATCTCAGG + Intronic
1011785706 6:90842286-90842308 GGGTTTTTCGCCAGACACTCTGG + Intergenic
1013532688 6:111034516-111034538 GGGGATTTCGCCAGCTACTCAGG + Intergenic
1017037506 6:150279796-150279818 GGGACTTTCTGCAAAACCTCTGG - Intergenic
1018433485 6:163741876-163741898 GGGCCTTTCAGCAGGGACTCAGG - Intergenic
1029424265 7:100486639-100486661 GGGGCTTCAGGCAGAATCTTGGG - Intronic
1031945616 7:127836732-127836754 GTGGCTGTGGCCAGAAACTCAGG - Intronic
1033654148 7:143362130-143362152 GGGGCGTGCGAAAGAAACTCGGG + Intronic
1035645842 8:1219012-1219034 GAGCCTTTGGGCAGAAACTGCGG + Intergenic
1037694306 8:21209952-21209974 AGGGCTTATGGGAGAAACTCAGG - Intergenic
1040292682 8:46133438-46133460 TGGGCTGGTGGCAGAAACTCAGG - Intergenic
1040306684 8:46215556-46215578 GGGACTTTCGCTAGAGACTCTGG - Intergenic
1040683525 8:49842538-49842560 GGGCCTTGCGGCAGCAACTTGGG - Intergenic
1048935688 8:139354809-139354831 GTGCCTTTAGGCAGAAAGTCTGG - Intergenic
1055530516 9:77178214-77178236 GGGGCCTTCGTCATAAACCCAGG - Intronic
1057182153 9:93036036-93036058 GGGGCTGCAGGCAGAACCTCAGG - Exonic
1057415743 9:94860678-94860700 GCGGCTTCTGCCAGAAACTCGGG - Intronic
1062099088 9:134718733-134718755 GGGGCTGCAGGCAGAGACTCAGG + Intronic
1062166677 9:135111296-135111318 GGGGATTTGGGCAGGAACTTGGG + Intronic
1189613408 X:42761951-42761973 GGGGCTCTTGGGAGAAACACCGG + Intergenic
1191074260 X:56435551-56435573 GGATCTCTCGGCAGAAACTCTGG - Intergenic
1191074494 X:56437781-56437803 GGATCTCTCGGCAGAAACTCTGG + Intergenic
1192756719 X:74054079-74054101 GAGGCTTTGGGCAGAGACTATGG - Intergenic
1193598340 X:83476503-83476525 GGAGCTTTTGGCAGAGACTATGG - Intergenic
1195842056 X:109184947-109184969 GGGGCTTTCCTCAAAATCTCTGG + Intergenic
1198133651 X:133725220-133725242 GGTGCTTTTGGCAAAAATTCTGG + Intronic